ID: 1133258660

View in Genome Browser
Species Human (GRCh38)
Location 16:4534410-4534432
Sequence TGCAGTGATCACAATGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 199}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133258653_1133258660 24 Left 1133258653 16:4534363-4534385 CCAGACAGGAAAAAACACCATTT 0: 1
1: 0
2: 1
3: 43
4: 779
Right 1133258660 16:4534410-4534432 TGCAGTGATCACAATGGGGCTGG 0: 1
1: 0
2: 2
3: 7
4: 199
1133258654_1133258660 7 Left 1133258654 16:4534380-4534402 CCATTTCTTGAATTCCAGTCAAC 0: 1
1: 0
2: 1
3: 19
4: 219
Right 1133258660 16:4534410-4534432 TGCAGTGATCACAATGGGGCTGG 0: 1
1: 0
2: 2
3: 7
4: 199
1133258655_1133258660 -7 Left 1133258655 16:4534394-4534416 CCAGTCAACTCCGTGATGCAGTG 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1133258660 16:4534410-4534432 TGCAGTGATCACAATGGGGCTGG 0: 1
1: 0
2: 2
3: 7
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133258660 Original CRISPR TGCAGTGATCACAATGGGGC TGG Intronic
900649406 1:3723653-3723675 AGCAGTGTGCACAGTGGGGCGGG - Intronic
902281004 1:15374481-15374503 TGCTGTGGGCAGAATGGGGCGGG - Exonic
905474704 1:38217822-38217844 GGCAGTGATCTCACTGGGGAGGG + Intergenic
905695383 1:39969704-39969726 TGCTGTGCTCACTGTGGGGCCGG + Exonic
906920981 1:50064118-50064140 TGCAGTCATTACAATGTGTCTGG + Intronic
911628711 1:100157856-100157878 TGTAGTGATAGCAATGGGACTGG - Intronic
911649557 1:100372211-100372233 AGCAGCCATCACACTGGGGCAGG - Intronic
915115436 1:153595782-153595804 TGCAGTGGTCACTATGTGCCAGG - Intergenic
915156610 1:153881908-153881930 TGCAGGGCTCTCAAGGGGGCTGG - Intronic
915638871 1:157205679-157205701 TGCAGTGACCACAATATGGATGG + Intergenic
915863065 1:159468206-159468228 TGAAATGTTCACACTGGGGCTGG + Intergenic
916360617 1:163963132-163963154 GGCAGTACTCACAATGGGTCTGG + Intergenic
919401128 1:197118644-197118666 TGAAGTGTTCAGAATGGTGCTGG - Intronic
921595241 1:217047507-217047529 TTGAGTGATGACAATGGGGATGG - Intronic
922619525 1:226981386-226981408 TGCAGTGACCCCAAGGGTGCAGG - Intronic
1063957513 10:11280671-11280693 TGCAGGGATGTCCATGGGGCAGG + Intronic
1067702408 10:48583339-48583361 TGCAGTGATCCCCCTGGGGTAGG + Intronic
1068627856 10:59268693-59268715 TGCAGTGATTACAAGGAGGAAGG + Intronic
1069610901 10:69771951-69771973 TCCAGTGATGGCATTGGGGCCGG - Intergenic
1069883655 10:71609774-71609796 AGCTGTCAGCACAATGGGGCTGG - Intronic
1071555486 10:86598256-86598278 TGCAGTGAGAACATTTGGGCAGG - Intergenic
1073585708 10:104708025-104708047 TGAAGTGTTGACAAAGGGGCTGG + Intronic
1073704555 10:105968421-105968443 TGAAGTGCTCAGAATGCGGCTGG + Intergenic
1076851587 10:133095947-133095969 TGCAGCGATCACCAGGGGGCTGG + Intronic
1083651199 11:64205895-64205917 TCCAGTGAACACACTGGGGTTGG - Intergenic
1083841878 11:65309242-65309264 TGTAGTGATCACAGTCGGGGAGG + Intergenic
1085865439 11:80285617-80285639 TGCATTGGTCTTAATGGGGCTGG + Intergenic
1088407205 11:109495166-109495188 TGCAGTAATCAAGATGGGGTAGG + Intergenic
1090079104 11:123599326-123599348 TGCAGTGATCAGAATTGATCTGG + Intronic
1091444783 12:538258-538280 AACAGTGATCAAAATTGGGCTGG + Intronic
1092077028 12:5682438-5682460 GTCAGTGGTGACAATGGGGCTGG + Intronic
1092099504 12:5871570-5871592 TGCACAGATCACAATAGGGTCGG - Intronic
1093344140 12:18019563-18019585 TGAAGTAATCTCAATGGGACTGG - Intergenic
1095620083 12:44242434-44242456 TGCAGGGATGACGATGGAGCTGG - Intronic
1095928495 12:47603362-47603384 TGCTGTGAGCACAGTGGTGCTGG - Intergenic
1100395254 12:94180510-94180532 GGCAGTGAACAAAATGGGGAAGG - Intronic
1100396439 12:94189953-94189975 TGTAATGATCACAATGAGGAGGG + Intronic
1102246541 12:111360109-111360131 TGCCGTGAGCACCATGTGGCTGG - Intergenic
1103757935 12:123224574-123224596 TGCAGTGATCTCAATGGGGAAGG + Intronic
1104383304 12:128327111-128327133 TGGAGTGATTTTAATGGGGCAGG + Intronic
1105531618 13:21225992-21226014 TGGAATGATCACAATGGCGACGG + Intergenic
1105567124 13:21560675-21560697 TGCAATAATCCCAATGGGGTAGG - Intronic
1108572389 13:51764490-51764512 TCCAGGGATCACAAGTGGGCTGG + Exonic
1110045105 13:70818272-70818294 TGCAGTGTGCCCAATGAGGCTGG - Intergenic
1110194771 13:72775759-72775781 TGCAGTGCTCACAATTTGTCAGG - Intronic
1111315282 13:86548767-86548789 GTCAGTGAACACAATGGGCCTGG + Intergenic
1113634119 13:111908411-111908433 TGAGCTGATCACACTGGGGCAGG + Intergenic
1118919888 14:70140251-70140273 TGAAGGTATCACAATGGGACAGG - Intronic
1119280726 14:73405308-73405330 AGAAGTGAGCACAATGGTGCAGG + Intronic
1119385160 14:74253524-74253546 TTCAGTTATCACTATGTGGCAGG + Intronic
1120242438 14:81965189-81965211 TGCACTGGACACAATGGTGCTGG - Intergenic
1121417268 14:93788265-93788287 TGCAGTGTGCGCAATGAGGCCGG - Intronic
1202848894 14_GL000225v1_random:3340-3362 TGCACTGATCACCCTGGGGAGGG - Intergenic
1202850118 14_GL000225v1_random:11134-11156 TGCACTGATCACCCTGGGGAGGG - Intergenic
1202850622 14_GL000225v1_random:15778-15800 TGCACTGATCACCCTGGGGAGGG - Intergenic
1202853004 14_GL000225v1_random:32807-32829 TGCACTGATCACCCTGGGGAGGG - Intergenic
1202857770 14_GL000225v1_random:62170-62192 TGCACTGATCACCCTGGGGAGGG + Intergenic
1202859078 14_GL000225v1_random:70459-70481 TGCACTGATCACCCTGGGGAGGG + Intergenic
1202863367 14_GL000225v1_random:99307-99329 TGCACTGATCACCCTGGGGAGGG + Intergenic
1202864488 14_GL000225v1_random:106268-106290 TGCACTGATCACCCTGGGGATGG - Intergenic
1202866517 14_GL000225v1_random:122697-122719 TGCACTGATCACCCTGGGGAGGG + Intergenic
1202866969 14_GL000225v1_random:127028-127050 TGCACTGATCACCCTGGGGAGGG + Intergenic
1126403433 15:48298067-48298089 TGCAGAGATTACAAAGGAGCAGG - Intronic
1126498669 15:49320665-49320687 TCCAGTGATCACAAATGGCCTGG + Intronic
1128146383 15:65334514-65334536 TGCAGGGATGAGAATGGGGTGGG + Intronic
1128301851 15:66570890-66570912 TGCAGGGATGAGAGTGGGGCTGG + Intergenic
1130030809 15:80311832-80311854 TTCAGTGATCAAAATGAGGATGG - Intergenic
1130290626 15:82597271-82597293 AGCAGTGATCAAAATGTAGCAGG + Intronic
1133258660 16:4534410-4534432 TGCAGTGATCACAATGGGGCTGG + Intronic
1133284502 16:4684286-4684308 TGTGGTGATCCCAGTGGGGCCGG - Intronic
1134612575 16:15621622-15621644 TGCAATCATCACAAGGGGGTGGG + Intronic
1134787932 16:16961894-16961916 TACAGTGCCCACGATGGGGCAGG - Intergenic
1136122117 16:28144461-28144483 TGCAGTGATCACGCTGTGGCTGG - Intronic
1137350580 16:47710771-47710793 TACAGTGAACTAAATGGGGCAGG + Intergenic
1139044622 16:63041662-63041684 TGGAGTCATCAGAATGGAGCTGG + Intergenic
1141423105 16:83930006-83930028 TGCAGTGGTGACAATGCTGCTGG + Intronic
1146061829 17:29611904-29611926 TGCAGTGATGGCAGTGGGGTTGG - Exonic
1146650665 17:34604178-34604200 AGCACTGATAACAGTGGGGCTGG + Intronic
1147331149 17:39700226-39700248 CGCAGTGAGCACCATGGAGCTGG + Exonic
1147675841 17:42204971-42204993 TGCAGTCATCAAAATGAGGTTGG + Intronic
1149879362 17:60272919-60272941 TGAAGTGAATACAATGAGGCTGG + Intronic
1149931070 17:60756214-60756236 TGCAGAGTTCATAATGGGGTTGG + Intronic
1152965493 18:110737-110759 TGCACTGATCACCCTGGGGAGGG + Intergenic
1152965504 18:110805-110827 TGCACTGATCACCCTGGGGAGGG + Intergenic
1154307609 18:13241937-13241959 TGCAGAGGTCAAACTGGGGCGGG + Intronic
1155363656 18:25029079-25029101 TGAAGTGATTACAATGTGTCAGG - Intergenic
1157327599 18:46680249-46680271 CGCAGTGACCAGAATGAGGCCGG + Exonic
1158279936 18:55813479-55813501 ATCAGTGAGCACAATGGGCCTGG - Intergenic
1159601075 18:70429393-70429415 TGGAGTGGTCAAAATGGGGATGG + Intergenic
1160039795 18:75335174-75335196 TGCAGTCATGCCAATGGTGCAGG + Intergenic
1162263742 19:9552955-9552977 AGCAGTGATCACACTGAGGTAGG + Intergenic
1163893488 19:20037594-20037616 TTCAGTGAGCAGGATGGGGCGGG - Intronic
1164833860 19:31344449-31344471 GGCAGGGATGAAAATGGGGCAGG + Intronic
1164894867 19:31865603-31865625 TGCAATGAACACAATGGGCATGG - Intergenic
1165161341 19:33818595-33818617 TGCAGAGGTCACCATGGGCCTGG - Intergenic
1166381131 19:42355970-42355992 TGCAATGCCCACACTGGGGCAGG + Exonic
1168722917 19:58564080-58564102 TGGAGTGCTCACAGTGTGGCTGG - Intronic
925813766 2:7727223-7727245 TGGGGTGAGCACAGTGGGGCAGG + Intergenic
927526314 2:23744573-23744595 TGCAGTAACCACCATGGGGTTGG + Intergenic
930212870 2:48661216-48661238 TGCAGTGAAAACAATGGGGAGGG - Intronic
932715753 2:74100034-74100056 TGCAGTGATCCCGACTGGGCTGG + Intronic
932899149 2:75678028-75678050 TTCAGTGATCACAAAGAGCCAGG + Intronic
934578192 2:95416389-95416411 TGCAGGAATCACAAAGGGACCGG - Exonic
934601247 2:95660315-95660337 TGCAGGAATCACAAAGGGACCGG + Intergenic
937088204 2:119186100-119186122 TGCAGAGATCATCATGGGGAGGG - Intergenic
940769021 2:157820626-157820648 TGCAGTGAAGATGATGGGGCTGG - Intronic
941475816 2:165951005-165951027 AGCAGTGATCACAAGGAGGGAGG - Intronic
943155582 2:184170759-184170781 TGCAGTGTTTACAATGTGCCAGG - Intergenic
943457963 2:188131119-188131141 TGCAGTGGTTACAATGGGCTAGG - Intergenic
944026175 2:195170868-195170890 TTCAGTGATGACATCGGGGCAGG + Intergenic
945431144 2:209767128-209767150 TGCAGTGATTACCATAGAGCTGG + Intergenic
945512273 2:210717277-210717299 TGAAGTGATTACCATGTGGCAGG - Intergenic
947126417 2:226873579-226873601 TGCAGTGATGACTCTGGGGAAGG + Intronic
948225840 2:236308803-236308825 TGCAGTGAACACAGGAGGGCAGG + Intergenic
948995875 2:241578151-241578173 AGCAGTTATCACCAGGGGGCTGG + Intergenic
1172628187 20:36360710-36360732 TGCAGTGCCCTCAGTGGGGCGGG + Intronic
1172949721 20:38715143-38715165 TGCAGGCATGCCAATGGGGCAGG + Intergenic
1174655722 20:52170500-52170522 TGCAGGGATCATTTTGGGGCAGG + Intronic
1175630447 20:60530982-60531004 AGGAGTGATCAGTATGGGGCTGG - Intergenic
1176138056 20:63533668-63533690 CCCAGTCATCCCAATGGGGCAGG + Exonic
1181347312 22:22229339-22229361 TGCAGTGTTCAGAGTGGGGATGG + Intergenic
1182396755 22:30041648-30041670 CGCAGAGAACACAGTGGGGCTGG - Intergenic
1182495690 22:30705773-30705795 TGCAGTGACCACAATGTGCAAGG + Intronic
1183090830 22:35520635-35520657 GGGAGTGATCGGAATGGGGCAGG + Intergenic
1184666252 22:45990652-45990674 TGCAGTGATCCCACCTGGGCTGG + Intergenic
1184764053 22:46562314-46562336 TGAAGTGATCCCAAGGGGACAGG + Intergenic
951274439 3:20668538-20668560 TGCAGTGATCAGCTGGGGGCTGG + Intergenic
952861994 3:37820636-37820658 TTGAGTGATCACTATGGGCCAGG - Exonic
959123127 3:102256895-102256917 TACAGTGATCAAAATTGGGTGGG - Intronic
961403441 3:126663150-126663172 TGCAGTGGGCACACTGGGGCTGG - Intergenic
962315104 3:134354335-134354357 TGCACTGGTCACCATGTGGCAGG + Intergenic
964770016 3:160214562-160214584 TCCAGAGAGCACAGTGGGGCTGG - Intergenic
966274768 3:178152409-178152431 TTCAGTGATCACAAGGCAGCTGG - Intergenic
967662445 3:192129809-192129831 AGCAGTGATCACAAAGGAGTTGG + Intergenic
967813325 3:193778995-193779017 TGCAGTGAAGAGAATGTGGCAGG - Intergenic
967868825 3:194212815-194212837 TCAAGTGGTCACAATGGGGAAGG - Intergenic
967933534 3:194708134-194708156 TGCAGTCATCTGCATGGGGCTGG + Intergenic
968076660 3:195819605-195819627 AGCAGAGCTGACAATGGGGCCGG + Intergenic
968475769 4:807170-807192 TGCAGGGATAGGAATGGGGCTGG + Intronic
968558337 4:1261735-1261757 TGCAGTAGAGACAATGGGGCTGG + Intergenic
971904548 4:32710016-32710038 TGCCCTGATCACAAAGGGGCAGG + Intergenic
976824811 4:89249085-89249107 TGCAGTGAGGATACTGGGGCTGG + Exonic
977308987 4:95361094-95361116 TTCAGGGTTCACAGTGGGGCAGG + Intronic
979748578 4:124247511-124247533 ACCAGTGATCAAAATGGGTCAGG + Intergenic
984497738 4:180519222-180519244 TGCAGAGACCACACTGGAGCTGG + Intergenic
985480585 5:107844-107866 TGCAGTGATCCGGGTGGGGCTGG + Intergenic
986974780 5:13382079-13382101 TGCAGTGTTCAGGCTGGGGCAGG - Intergenic
994163571 5:96584225-96584247 TGCACTGTTCCCAATAGGGCTGG + Intronic
998404956 5:141869075-141869097 TGCAGGGATCACCAGGGAGCTGG + Exonic
1002779183 6:353456-353478 TCCATGGATCACAGTGGGGCAGG - Intergenic
1002904483 6:1437832-1437854 GGCAGTGATCTCAGTTGGGCAGG + Intergenic
1006928590 6:37673594-37673616 TGCAGTGAGCACAGAAGGGCAGG - Intronic
1008050965 6:46899795-46899817 AGCAGTGATGGCAATGGGGAGGG + Intronic
1011095767 6:83660190-83660212 TGCAGAGGTCACAATGCAGCTGG + Intronic
1012503299 6:99914975-99914997 GGAAGTTATCACAATGGGCCAGG - Intergenic
1012552236 6:100474339-100474361 TGCAGTGACCAGAATGTGGTGGG + Intergenic
1013629615 6:111973508-111973530 TACACTGATAACAGTGGGGCGGG - Intergenic
1014533212 6:122585278-122585300 TGCATTGATCATAAAGGTGCAGG - Intronic
1016920464 6:149288345-149288367 TGCAGAGTCTACAATGGGGCAGG - Intronic
1017170009 6:151448109-151448131 TGCAGTGATAAAAATGGGCTGGG - Intronic
1019330788 7:459795-459817 TGCACTGATCATATTGAGGCTGG - Intergenic
1021491541 7:21224638-21224660 TTCAGTGAACACTATGTGGCAGG + Intergenic
1023020988 7:36011622-36011644 TGCAGTCATCACACGTGGGCTGG - Intergenic
1023748445 7:43345727-43345749 TGCAGTGATCTGGATGAGGCTGG - Intronic
1024584465 7:50829627-50829649 GACAGTGATCACCATGAGGCAGG - Intergenic
1025025178 7:55510791-55510813 TGCAGTGGGGACCATGGGGCTGG - Intronic
1025030108 7:55549919-55549941 TGCAGTGACCATGATGGGGATGG - Intronic
1026439984 7:70435793-70435815 TGCTGTGCCCACAATGGGGGAGG - Intronic
1027046012 7:74991790-74991812 AGCAGTGGTCACATGGGGGCTGG + Intronic
1027247176 7:76375091-76375113 TGCTGTGATTCCTATGGGGCTGG + Intergenic
1029017404 7:97328549-97328571 AGCAATGAACACAATGGGCCTGG + Intergenic
1035319718 7:158020820-158020842 TGCAGTGATCCCAGTGGCTCAGG - Intronic
1035705882 8:1674339-1674361 AGCAGTGAAAACAATGGAGCTGG - Intronic
1037079037 8:14760069-14760091 AGCAGTGCTCATCATGGGGCGGG - Intronic
1037738175 8:21583198-21583220 TGCAGTGACACCCATGGGGCTGG - Intergenic
1037779086 8:21855541-21855563 TGCATTGATGACAGTGGGCCAGG - Intergenic
1042488592 8:69373940-69373962 TGCTGGGATCCCAGTGGGGCTGG - Intergenic
1042814739 8:72866001-72866023 TGGAGTGACCACAATGGGGCAGG - Intronic
1044848592 8:96406156-96406178 TGCAGAGTTCACAATAAGGCTGG + Intergenic
1045549706 8:103160456-103160478 TTCAGTAATCACACTGAGGCAGG - Intronic
1047048826 8:121085781-121085803 TGCAGAGGCCACAATGTGGCTGG + Intergenic
1048380994 8:133864617-133864639 AGGAGTGAGCGCAATGGGGCAGG - Intergenic
1049588483 8:143442537-143442559 TCCACTGTTCACAAAGGGGCAGG + Intronic
1052656584 9:31370539-31370561 AGCAGAGAGCAGAATGGGGCGGG - Intergenic
1054864706 9:69988098-69988120 TGCAGTGAGAAAAATGGAGCAGG + Intergenic
1055160192 9:73117343-73117365 TGCAGTGATCACCATGGCAAGGG + Intergenic
1055459165 9:76500987-76501009 TGAAGTGCTCAGAATGGGGCAGG + Exonic
1056300209 9:85232431-85232453 TGCATTGATCACAATAGAGATGG - Intergenic
1056889067 9:90472436-90472458 TTCTGTGATCACAATGAAGCTGG + Intergenic
1057555161 9:96082339-96082361 TGCAGTGATGTGAATGTGGCTGG - Intergenic
1057707783 9:97409673-97409695 TGCAGAGACCAAATTGGGGCTGG + Intergenic
1058851463 9:109015023-109015045 TTCAGTGTACACAATGGTGCCGG + Intergenic
1058888576 9:109341857-109341879 TGCTGTGTTAACACTGGGGCTGG - Intergenic
1058983320 9:110190026-110190048 TGCAGTGATTACAACGAGGCAGG - Intronic
1060413325 9:123414010-123414032 AGCAGTGAAGACAGTGGGGCTGG - Intronic
1061652280 9:132060490-132060512 TGCAGTGGTCACAGTCGGGTGGG - Intronic
1203737602 Un_GL000216v2:151547-151569 TGCACTGATCACCCTGGGGAGGG - Intergenic
1203737825 Un_GL000216v2:153597-153619 TGCACTGATCACCCTGGGGAGGG - Intergenic
1203738114 Un_GL000216v2:156332-156354 TGCACTGATCACCCTGGGGAGGG - Intergenic
1203740639 Un_GL000216v2:174564-174586 TGCACTGATCACCAAGGGGATGG - Intergenic
1188091164 X:25967485-25967507 TGCAGTGTTAATAATAGGGCTGG + Intergenic
1193067382 X:77274690-77274712 TGCAGTTCTGACAATGGGGGAGG + Intergenic
1195552927 X:106188653-106188675 TGGATTGACTACAATGGGGCAGG - Intronic
1198045541 X:132898072-132898094 TGCAGAGTTCACAATAGGGTTGG - Intronic
1198279402 X:135126843-135126865 TGCAGTGATGGGAGTGGGGCTGG + Intergenic
1198291554 X:135245671-135245693 TGCAGTGATGGGAGTGGGGCTGG - Intergenic
1201176179 Y:11309591-11309613 TGCACTGATCACCCTGGGGAGGG - Intergenic
1201177433 Y:11317669-11317691 TGCACTGATCACCCTGGGGAGGG - Intergenic
1201178521 Y:11324030-11324052 TGCACTGATCACCCTGGGGAGGG - Intergenic