ID: 1133258926

View in Genome Browser
Species Human (GRCh38)
Location 16:4536046-4536068
Sequence GAGAGCTCTGCAGAGGACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 5, 3: 27, 4: 314}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133258926_1133258934 19 Left 1133258926 16:4536046-4536068 CCAAGGTCCTCTGCAGAGCTCTC 0: 1
1: 0
2: 5
3: 27
4: 314
Right 1133258934 16:4536088-4536110 CCAGCACTTCCTCCACCTACAGG 0: 1
1: 0
2: 1
3: 28
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133258926 Original CRISPR GAGAGCTCTGCAGAGGACCT TGG (reversed) Intronic
900378790 1:2373556-2373578 GAGGGCTCTGCTGAGGATCCAGG + Intronic
900680016 1:3911558-3911580 AAGAACTCTGCAGAGGGGCTGGG - Intergenic
901301339 1:8201809-8201831 GAGAACTCTGGAGAGGCTCTGGG + Intergenic
902334613 1:15747742-15747764 CAGAGCTCAGCACAGGCCCTGGG + Exonic
902621780 1:17654989-17655011 GGGAGCTGTGCAGAGGACCTGGG + Intronic
902746754 1:18479774-18479796 GAGACCCCTGCACAGGACTTTGG + Intergenic
902747874 1:18485168-18485190 GAGAACTCTACATAGGAGCTGGG + Exonic
903015177 1:20356887-20356909 GACTGCTAGGCAGAGGACCTAGG + Intergenic
903154541 1:21435134-21435156 GTGAGGTCTGGAGAGGAGCTGGG + Intergenic
903421899 1:23223869-23223891 GAGAGTACTGCAGGGGACCAGGG + Intergenic
904295155 1:29515508-29515530 GAGAGCTCAATAGAGGACCAAGG - Intergenic
904743270 1:32695002-32695024 CAAAGCTCTGCAGAGAACCCAGG - Exonic
905118973 1:35667117-35667139 GAGAGCTCTGGAGAGGGCAGAGG - Intergenic
905573262 1:39023183-39023205 GAAAGCTCTGCAGCTGATCTGGG - Intergenic
906796356 1:48699161-48699183 GGGAGCTCTGCATAGGACCCAGG + Intronic
907988493 1:59556077-59556099 GAGAGATCTGCAGAGGCCTGAGG + Intronic
909560796 1:77007322-77007344 GAGAGCGTTGCAGAGGTGCTGGG - Intronic
911596473 1:99803741-99803763 GAGAGCTGAGCAGAGGAATTGGG - Intergenic
912314202 1:108651845-108651867 TAGAGCACAGCAAAGGACCTTGG - Intronic
913674707 1:121129982-121130004 GGGAGCTCTACAGAGGTCCATGG + Intergenic
914026548 1:143917612-143917634 GGGAGCTCTACAGAGGTCCATGG + Intergenic
914664928 1:149825043-149825065 GGGAGCTCTACAGAGGTCCATGG + Intergenic
914670837 1:149868777-149868799 GGGAGCTCTACAGAGGTCCATGG - Intronic
914756848 1:150567407-150567429 AACAGCTCTGCAGAGGAGCCTGG - Intergenic
915069555 1:153254924-153254946 GAGAGCTCTGCAGTGGTTCGTGG - Intergenic
915214260 1:154329352-154329374 GTGTGCTCTGCAGGGGTCCTGGG + Intronic
916116552 1:161489740-161489762 GTGAGGTGTGCAGAGGACTTGGG + Intergenic
916379726 1:164196036-164196058 GACAGCTCTGAAGAGGACAGCGG + Intergenic
917286130 1:173423394-173423416 GAGAGCTTTGCAGAGGAAGTGGG - Intergenic
917793150 1:178512760-178512782 GAGCGCACAGCAGAGGACATGGG + Intergenic
917981420 1:180271955-180271977 GAGAGCTCTGCAGAGGACTGTGG + Exonic
919229207 1:194751705-194751727 GAGAGCACTGTAAAGGCCCTAGG + Intergenic
920937734 1:210451144-210451166 CAGAACTCTGCAGAGAAGCTTGG + Intronic
921993806 1:221395912-221395934 GAGAGCTCTGAAGAGGCCCCGGG + Intergenic
922955346 1:229594686-229594708 GAGCGCTCAGCAGGGGAACTCGG - Exonic
923157778 1:231293596-231293618 CAGTGATCTGCAGGGGACCTGGG + Intergenic
924325867 1:242893347-242893369 GAAAGCTCATCAGAGAACCTAGG + Intergenic
924901572 1:248407038-248407060 TGGAGCTCTGAAGAGGGCCTTGG + Exonic
1062796723 10:350435-350457 GAGAGTGCTGCAAAGGAACTAGG - Intronic
1063974600 10:11405247-11405269 GAGAACACTGGAGAGGATCTCGG - Intergenic
1064324914 10:14340697-14340719 GAGTGCTTGGCAGAGGACATGGG - Intronic
1065997664 10:31074499-31074521 GAGAGCTCTGCAGAGGAGAGGGG + Intergenic
1068986322 10:63110680-63110702 GAGAGGTCAACAGAGAACCTTGG + Intergenic
1069573032 10:69506082-69506104 GTCAGCCCAGCAGAGGACCTCGG - Intronic
1070551978 10:77497041-77497063 CAGACCTCTGCAGAGGCCTTGGG - Intronic
1070818000 10:79337252-79337274 GAGAGCTCAGCACAGTACTTAGG + Intergenic
1071813591 10:89208526-89208548 GAGAGCTCTTGAGAGACCCTGGG + Intergenic
1072138310 10:92568047-92568069 GAGAGCTTTGCAGAGAACATAGG - Intronic
1073121809 10:101126586-101126608 GAGGGCTGTGCAGATGTCCTGGG - Intronic
1073944159 10:108730918-108730940 GTGAGATGTGCAGAGGACTTGGG + Intergenic
1074427146 10:113361404-113361426 GACAGCTCTGCCGAGGAAGTGGG + Intergenic
1074874255 10:117602116-117602138 GTGGGCTCTGCAGAGGAGCTGGG + Intergenic
1075086939 10:119419925-119419947 CTGAGCTCTGCAGAGTACCGGGG + Intronic
1075341951 10:121653919-121653941 CAGAGCTCTACTGAGCACCTGGG - Intergenic
1075967786 10:126627734-126627756 GAGAATTCTGCTGAGTACCTAGG - Intronic
1076450717 10:130555283-130555305 GAGAGCTCAGCAGAAGACAGAGG + Intergenic
1077121827 11:912425-912447 GGGAGCTCTGCAGAGGGGCCTGG - Intronic
1079270659 11:18982830-18982852 GTGAGATGTGCAGAGGACTTGGG + Intergenic
1081266630 11:41032021-41032043 GAGAGCTCTCCAGTTGAGCTGGG + Intronic
1081997724 11:47375935-47375957 GAGAGGTCAGAAGAGGACCAGGG + Intronic
1084091582 11:66882461-66882483 GAAAGCCCAGCAGAGCACCTGGG + Intronic
1085746066 11:79115301-79115323 GAGAGGGCTGGGGAGGACCTTGG + Intronic
1085830414 11:79894936-79894958 GATACCTCTGGAGAGGAGCTTGG + Intergenic
1086100051 11:83089723-83089745 GAGAACTCTGAAATGGACCTTGG - Intergenic
1086917536 11:92547891-92547913 GAGGGCTGTGCAGAGGCTCTGGG + Intronic
1089395991 11:118136550-118136572 GAGGCCTCTGGAGAAGACCTGGG - Exonic
1089752304 11:120660464-120660486 GAGAGTGCTGCACAGGACTTGGG + Intronic
1090068647 11:123525384-123525406 CAGAGGTGTGCAGAGGACCTAGG + Intergenic
1090201781 11:124862835-124862857 GAGAGGGCTGCAGAAGAGCTGGG + Intergenic
1090806932 11:130208703-130208725 TAGGGCTCCGCAGAGGGCCTGGG + Intronic
1091257621 11:134204017-134204039 GATAGCTCTGCATAAAACCTTGG - Intronic
1091875867 12:3932310-3932332 GGGAGGCCTGCAGAGCACCTGGG + Intergenic
1091907024 12:4197225-4197247 GAGACCTCTGCACAGGGCCCGGG - Intergenic
1092053936 12:5493542-5493564 GAAAGCTCGGCAGAGCACCCTGG + Intronic
1096978243 12:55712818-55712840 TAGAGCTGAGCAGAGGACATGGG - Intronic
1097336429 12:58388689-58388711 GGGAGCTCTGGAGAGGAAGTGGG + Intergenic
1097980057 12:65729214-65729236 GGGAGCGGTGCAGAGGACCGGGG - Intergenic
1100690409 12:97033424-97033446 GTGAGTTCTGGAGAAGACCTGGG + Intergenic
1104262093 12:127193898-127193920 GAGGCCTCTGAAGAAGACCTGGG - Intergenic
1104574239 12:129952248-129952270 GAGATTTATTCAGAGGACCTTGG + Intergenic
1105969986 13:25419854-25419876 GAGTGCTCTGCAAAGAACCCTGG + Intronic
1106017818 13:25885557-25885579 GGGGGCTCTGCAGATGAGCTGGG - Intronic
1106688129 13:32084119-32084141 GAGAATTCTGCAGAGGACACAGG - Intronic
1107189273 13:37560079-37560101 GTGAGATGTGCAGAGGACTTGGG + Intergenic
1108653185 13:52502492-52502514 GAGGGCACTGCAGAAGACCAGGG - Intergenic
1110613583 13:77516487-77516509 GAGAGTTTTGCTGAGGATCTGGG - Intergenic
1112256782 13:97841447-97841469 GAGAGCAATGCAGAGAAACTTGG - Intergenic
1113102336 13:106734361-106734383 GAGTGTTCTGGAGAGGAGCTGGG - Intergenic
1113758915 13:112833985-112834007 GAGAGGCCAGCAGAGGACCCGGG - Intronic
1113881008 13:113626199-113626221 GAGAGCTCTCCACAGGGCCAGGG - Intronic
1113952582 13:114080154-114080176 GAGAGCCCTGGACAAGACCTGGG - Intronic
1114264000 14:21060490-21060512 GAGAGCTCAGAACAGGACCCTGG - Intronic
1116268076 14:42721504-42721526 GAAAGCTCTGCAGCTGATCTGGG + Intergenic
1116289941 14:43021784-43021806 GAGATCTTTAAAGAGGACCTGGG + Intergenic
1116419273 14:44714087-44714109 GGGAGCTATGCAGAGTCCCTGGG + Intergenic
1117493084 14:56271987-56272009 CAGAGCTCTTCAGAGCAGCTTGG + Intronic
1118892373 14:69921074-69921096 GAGAGCTTCTCAGAGCACCTGGG + Intronic
1119326394 14:73762098-73762120 CACAGGTCTGCAGAGGAACTTGG - Intronic
1121991812 14:98565187-98565209 TAGAGTTCTGCAGTGGACATAGG - Intergenic
1122299937 14:100725745-100725767 GGGAGCTCTGCAGAGGAAGAGGG + Intronic
1122313401 14:100811543-100811565 GAGAGCGCAGAAGCGGACCTGGG - Intergenic
1123205736 14:106711373-106711395 GAGAGCACTGCAGAGCCCCGTGG - Intergenic
1125173450 15:36793147-36793169 GAGAGCTATGCAGAAGGCCCTGG - Intronic
1126911276 15:53419658-53419680 GTGAAGTCAGCAGAGGACCTGGG - Intergenic
1128075165 15:64821275-64821297 GACAGCTCTGGAGAGGAGCGTGG + Exonic
1130759321 15:86801854-86801876 GAGAGAGCTGCAGAGGAACCTGG + Intronic
1130772714 15:86940923-86940945 GTGAGCTGAGCAGAGGACATTGG - Intronic
1130776684 15:86991616-86991638 GAGGGCTCTGAGGAGGAACTAGG + Intronic
1131237606 15:90710573-90710595 GAGAGCCCTCCACAGGACTTTGG - Intergenic
1131396156 15:92088024-92088046 GAGACATCTGCAGAGGGACTTGG + Intronic
1132645603 16:997958-997980 GAGAGCTCGCCAGAGGACTGTGG + Intergenic
1133258926 16:4536046-4536068 GAGAGCTCTGCAGAGGACCTTGG - Intronic
1134178721 16:12030429-12030451 AAGAGCTGTCCAGGGGACCTGGG - Intronic
1135305467 16:21364172-21364194 AAGAGCTGTCCAGGGGACCTGGG - Intergenic
1136056763 16:27695468-27695490 GAGAGCCTCGCAGAGGACCAGGG - Intronic
1136302205 16:29343324-29343346 AAGAGCTGTCCAGGGGACCTGGG - Intergenic
1136746937 16:32598652-32598674 CACAGGTCTGCAGAGGAACTTGG - Intergenic
1136923078 16:34347030-34347052 GGGAGCACAGCAGAGGCCCTGGG - Intergenic
1136981495 16:35064776-35064798 GGGAGCACAGCAGAGGCCCTGGG + Intergenic
1138334993 16:56246019-56246041 GAGATCTCTGCAGGGCCCCTGGG + Intronic
1138378772 16:56585713-56585735 GAGGACTCTGCAGGGGGCCTGGG - Intergenic
1139937126 16:70579638-70579660 GAGTGTTCTGGAGAGGAGCTGGG + Intergenic
1140408742 16:74728406-74728428 GAGGGCTTTGCAGAGGATCTGGG + Intronic
1141827420 16:86490631-86490653 GGAAGCTCTGCAGAGTTCCTTGG - Intergenic
1142020721 16:87780470-87780492 GAGAGCTGGGCAGAACACCTTGG - Intergenic
1203049067 16_KI270728v1_random:857856-857878 CACAGGTCTGCAGAGGAACTTGG - Intergenic
1142590895 17:1005516-1005538 GAAAGCTCTGAAGAGGCCCTGGG - Exonic
1142638190 17:1270612-1270634 GAGGACTCTGCGGAGGACTTGGG + Exonic
1142862329 17:2770273-2770295 CTGAGCTCTGCAGAGCTCCTTGG - Intergenic
1143371859 17:6445219-6445241 GAGACCTCTGTAGGGGCCCTGGG + Exonic
1143812224 17:9481247-9481269 AAGAGCTATGCTGAGGACTTTGG - Intronic
1144331273 17:14226315-14226337 CAGAGGTCTCCAGAGGACGTGGG - Intergenic
1144966012 17:19077756-19077778 GAGCGTTGTGCAGAGGACCCTGG + Intergenic
1144981956 17:19174433-19174455 GAGCGTTGTGCAGAGGACCCTGG - Intergenic
1144986267 17:19203806-19203828 GAGCGTTGTGCAGAGGACCCTGG + Intergenic
1145957243 17:28862923-28862945 AAGAGCTCTGAAGAGGGGCTAGG - Intergenic
1147724721 17:42559664-42559686 GAGAGCTTTGGGGAGAACCTTGG - Intergenic
1147877986 17:43635127-43635149 GAGGGATTTGCAGAGAACCTTGG + Intergenic
1148644803 17:49213540-49213562 GAGAACTCTGCAGGTGACCCTGG - Intronic
1150225486 17:63522682-63522704 AGGAGCTCTGCATGGGACCTAGG + Intergenic
1151548593 17:74808287-74808309 GAGTGCTCTAAAGAGGAACTGGG + Intronic
1151680173 17:75618996-75619018 GTGTGCTCAGCAGAGGGCCTAGG - Intergenic
1151803661 17:76392096-76392118 GAGAGCTGAGAAGAGGTCCTAGG + Exonic
1152410812 17:80121937-80121959 CATCGCTCTGCAGAGGACTTCGG - Intergenic
1152880886 17:82814433-82814455 GGGAGATCTGAAGAGGCCCTGGG + Intronic
1152946849 17:83202664-83202686 GAGAACTCTGCAGAGGATGCTGG - Intergenic
1153776836 18:8462036-8462058 AAGAGCTGAGCAGAGGAGCTTGG + Intergenic
1154411071 18:14142642-14142664 CAAAGCTGTGCAGAGGCCCTGGG - Intergenic
1155109710 18:22702170-22702192 GACAGCACTGCACAGGCCCTGGG - Intergenic
1156261093 18:35445501-35445523 GAGTGGGCTGCAGAGGATCTAGG - Intronic
1156491486 18:37498908-37498930 GAGTGCCCAGCAGAGCACCTGGG + Intronic
1156617056 18:38799534-38799556 GAAAGCTTTGCCCAGGACCTTGG - Intergenic
1157756293 18:50220666-50220688 GAGGGTTCTGCAGAAGACCAGGG + Intergenic
1157756599 18:50223262-50223284 GAGGGTTCTGCAGAAGACCAGGG + Intergenic
1157845472 18:51000171-51000193 GAGAGCACCGGAGAGGACCCAGG - Intronic
1158281240 18:55830777-55830799 TGGAGCTCTGCACAGCACCTAGG - Intergenic
1159904131 18:74075214-74075236 GTGATCTCTGCAGAGAACCTCGG + Intronic
1160302828 18:77701446-77701468 GAGAGCTCTCCAGAGCACTCAGG - Intergenic
1160443298 18:78909044-78909066 AAGAGGTGTGCAGAGGGCCTTGG + Intergenic
1160963018 19:1732818-1732840 GAGCCATCTGCAGAGGAGCTGGG - Intergenic
1161166206 19:2789179-2789201 AACAGTTCTGCAGAGGACCCAGG - Intronic
1161166213 19:2789211-2789233 AACAGTTCTGCAGAGGACCCAGG - Intronic
1161562605 19:4981722-4981744 GAGAGCACTGCAGAGCAGGTGGG - Intronic
1161594005 19:5142100-5142122 CAGAGGTCTGCAGAGCACCACGG - Intronic
1162078730 19:8206170-8206192 GGGAGCTCAAAAGAGGACCTGGG - Intronic
1162567696 19:11453322-11453344 GAGATCTCTGCAGAGAACCTGGG + Exonic
1162785569 19:13032686-13032708 GAATGGTGTGCAGAGGACCTGGG + Intronic
1165410575 19:35658348-35658370 GACAGCTCTGCAGTGGGCCTGGG + Intronic
1166236797 19:41462699-41462721 GAGGGCACTGCAGGGGACCAGGG + Intergenic
1167922587 19:52794114-52794136 GAGAGGCCTGCAGGGGACATGGG + Intronic
1167927846 19:52836063-52836085 GAGAGGCCTGCAGGGGACATGGG + Intronic
1167932244 19:52875350-52875372 GAGAGGCCTGCAGGGGACATGGG + Intronic
1167988784 19:53340385-53340407 GAGAGGTCTGCAGGGGCCATGGG - Intronic
1168115702 19:54220457-54220479 GAGAGCTCTCCTGGGGGCCTGGG + Intronic
1168118689 19:54240203-54240225 GAGAGCTCTCCTGGGGGCCTGGG + Intronic
1168187201 19:54707977-54707999 GAGATGTGTGCAGAGGGCCTGGG + Intergenic
1168325475 19:55536663-55536685 GCGGGCTGTGCAGAGGGCCTGGG + Intronic
925823763 2:7825945-7825967 GCGTGCTCTGCAGATGACTTGGG - Intergenic
927130731 2:20057031-20057053 GACAGCTGTGCAGGGGGCCTAGG + Intergenic
927794011 2:26033245-26033267 GAGCGCTCTGCAGAGGAGGTGGG - Intergenic
927808550 2:26169359-26169381 GAGCCCACTGCAGAGGAGCTGGG + Intergenic
927884488 2:26710158-26710180 AAGAGCTTTGCAGGGAACCTGGG + Intronic
929079583 2:38109248-38109270 GAGAGCTCAGCAGAGGAAAAGGG - Intronic
929435787 2:41927423-41927445 GAGGGCTCTCCAGAGAACGTCGG - Intergenic
929891018 2:45918718-45918740 GAGTCCTCTGCAGTGGGCCTGGG + Intronic
931710903 2:64988850-64988872 GCGAGCTCTGGAGAGGAGCGCGG + Intronic
933968894 2:87454003-87454025 AGGAGCTCTGCAGAGGATGTGGG - Intergenic
935595511 2:104874259-104874281 GAGACCTCTGGAGAGGACAAAGG + Intergenic
935935205 2:108174959-108174981 CAGAGCTCTTCAGAGACCCTGGG - Intergenic
936324898 2:111496502-111496524 AGGAGCTCTGCAGAGGATGTGGG + Intergenic
937321709 2:120964819-120964841 GAGAGGTCAGCAGAGGCCCAGGG - Intronic
937981244 2:127617136-127617158 GTGAGATGTGCAGAGGACTTGGG - Intronic
939396862 2:141641772-141641794 AATGACTCTGCAGAGGACCTGGG + Intronic
940962451 2:159800438-159800460 GAGAGTCCAGCAGAGGAGCTGGG - Intronic
941162603 2:162052760-162052782 GAGAGCTGTGGATAGAACCTCGG + Intronic
943446067 2:187989455-187989477 GATAGCTGTGCAGAGGGCTTGGG - Intergenic
946193690 2:218021164-218021186 GAGAGCTCTGCACAGCCCTTGGG + Intergenic
946478525 2:220031994-220032016 AAGAGCTCTGCAGTAGGCCTAGG + Intergenic
946910373 2:224454757-224454779 GAGAGCTCTGCTGGGGAAGTGGG + Intergenic
948454505 2:238098515-238098537 GTGAGCTCTGCAGGGGTCCAGGG - Exonic
948482903 2:238261662-238261684 GAGCCCCCTGCAGAGGACATAGG - Intronic
948592428 2:239059927-239059949 GAGAGCTCTCCGGGGGCCCTTGG + Intronic
948900170 2:240952699-240952721 GAGAGGTGTGCAGTGGAGCTAGG + Intronic
1169619780 20:7492358-7492380 GAGAACTCTGCAGAGGCCCAAGG + Intergenic
1170336625 20:15277268-15277290 GAGAGGTCTGCTGAGGACCTTGG - Intronic
1170571348 20:17634530-17634552 GGGAGCTCTGAAGTGGGCCTGGG + Intronic
1172016920 20:31881333-31881355 GTCAGCTCTGCTGAGGACCAGGG - Intronic
1172131681 20:32660214-32660236 GGCAGCTCTCCAGAGGATCTGGG + Intergenic
1172134978 20:32680820-32680842 GAGAGCTCTGCAAAGGCCCCAGG + Intergenic
1172449946 20:35014918-35014940 GAGAGCTCTGAACAGGACATTGG - Intronic
1172840931 20:37902644-37902666 GATAGCTCTGCCGCCGACCTCGG - Intergenic
1173116443 20:40247873-40247895 GAGAGCGTTACAGAGGGCCTTGG - Intergenic
1173311263 20:41898021-41898043 GCTAGCTCTGCAGAGGACAGTGG - Intergenic
1173457798 20:43217359-43217381 GACACCTCTGCAGAGCTCCTAGG - Intergenic
1173823488 20:46032858-46032880 GAGAGCTCTTCTGAGACCCTGGG + Intronic
1175093419 20:56523116-56523138 GATAGCTCTACAGATGACCCAGG + Intronic
1175094527 20:56530958-56530980 GATAGCTCTACAGATGACCCAGG + Intergenic
1175363332 20:58432331-58432353 GAGAGCTCTGAGGAGGAACAAGG - Intronic
1175921938 20:62454275-62454297 TCCAGCTCTGCAGAGGAGCTGGG - Intergenic
1176075302 20:63245537-63245559 GAGAGCTTTGGGGTGGACCTGGG - Intronic
1176184517 20:63771089-63771111 GCCAGCTCTGAAGAGGGCCTGGG - Intronic
1176676654 21:9784789-9784811 GAGAGGGCTGCAGAGAGCCTGGG + Intergenic
1176861984 21:14015773-14015795 CAAAGCTGTGCAGAGGACCTGGG + Intergenic
1178918600 21:36723574-36723596 GAAAGCTCTGCCTTGGACCTTGG - Intronic
1179540779 21:42082257-42082279 GAGTGCTCTGCAGAGAACTTGGG + Intronic
1180030160 21:45201315-45201337 TACAGCTCTGCAGAGGCCCTGGG - Intronic
1180595855 22:16972794-16972816 GAGAGAGCTGGAGAGGCCCTGGG - Intronic
1181440745 22:22934117-22934139 CAGAGCTCTGCAGAGGGGCAGGG + Intergenic
1181543075 22:23584254-23584276 GAGGGCTCTGCAGAGGCACCAGG - Intergenic
1182433003 22:30311611-30311633 GAGAGCTGGGCAGAGGTCCAGGG - Intronic
1184099976 22:42336850-42336872 GAGACCTCTCCAGAGGACCCTGG + Intronic
950186603 3:10949296-10949318 CAGAGCTCGGCAGAGTCCCTGGG + Intergenic
950649355 3:14397610-14397632 GACAGCTCTGCAGGGGACCGGGG - Intergenic
953706330 3:45233812-45233834 TCCAGCTCTGCTGAGGACCTGGG + Intergenic
954291854 3:49654048-49654070 GAGAACTCTGCTGTGGCCCTTGG - Exonic
954717615 3:52534163-52534185 GAGAGGGCGGCAGAGGACCCGGG - Intronic
960505576 3:118489287-118489309 GAGAGCTCTGGAAAGGCCTTGGG + Intergenic
960930751 3:122846887-122846909 GAGGGCTCCCCAGAGGACTTTGG + Intronic
960941971 3:122940810-122940832 GAGAGCTCTGCTAAGGACTTGGG - Intronic
962892724 3:139686601-139686623 GAAACCTGTGCAGGGGACCTAGG - Intergenic
962924998 3:139984674-139984696 CAGAGCTCAGAAGAGCACCTTGG - Intronic
964753798 3:160076653-160076675 CAGTGATCTGCAGGGGACCTGGG + Intergenic
965468868 3:169065520-169065542 GAGATCTGTGAAGAGGGCCTTGG - Intergenic
967187874 3:186960891-186960913 GAGAGCAGGGCAGAGGCCCTGGG - Intronic
967925150 3:194640075-194640097 AGCAGCTCTGCAGAGGCCCTTGG + Intergenic
969369642 4:6723537-6723559 AAGAGCCCTGGAGAGCACCTGGG + Intergenic
970133409 4:12895716-12895738 GAGAGCTGGGCAGAAGACCTGGG - Intergenic
971048178 4:22829548-22829570 GAGAGCTCTCCACACTACCTGGG - Intergenic
972081347 4:35154389-35154411 GAGAGATAAGCAGAGGAGCTAGG - Intergenic
976548081 4:86360506-86360528 TAGTGCTGTGCAGATGACCTCGG - Intronic
977009112 4:91613252-91613274 GAGTGCTCTGCAGAGGATACTGG + Intergenic
978113307 4:104988961-104988983 GAGGGCTCTGAAGAGATCCTAGG - Intergenic
979809863 4:125023118-125023140 GAGAGTTGTGCAGTGGACTTTGG + Intergenic
981390737 4:144188561-144188583 GAACTCTCTGAAGAGGACCTGGG - Intergenic
981424554 4:144588087-144588109 GAGGGTACTGCAGAGGACCAGGG + Intergenic
982313447 4:154008769-154008791 TAGGGCTCTGCAGAAGACTTGGG - Intergenic
983461289 4:168028224-168028246 GAGTTCTCAGCAGAGGACTTGGG - Intergenic
983743295 4:171162523-171162545 GAAAACACTGCAAAGGACCTGGG + Intergenic
985398883 4:189573979-189574001 GAGAGGGCTGCAGAGAGCCTGGG - Intergenic
985895786 5:2749381-2749403 GAGACCTCGGCAGAGGACGAAGG - Exonic
986451373 5:7869090-7869112 GAAAGCTCCGAAGGGGACCTGGG - Exonic
987692426 5:21283868-21283890 GTGAGATGTGCAGAGGACTTGGG - Intergenic
988933422 5:36059569-36059591 GTGAGATGTGCAGAGGACTTGGG + Intronic
990925124 5:61012308-61012330 GAGAGTTCTGTAGAAGATCTTGG - Intronic
991747932 5:69766182-69766204 GTGAGATGTGCAGAGGACTTGGG + Intergenic
991799508 5:70346030-70346052 GTGAGATGTGCAGAGGACTTGGG + Intergenic
991829089 5:70664008-70664030 GTGAGATGTGCAGAGGACTTGGG - Intergenic
991891867 5:71345459-71345481 GTGAGATGTGCAGAGGACTTGGG + Intergenic
992449407 5:76862452-76862474 GAGGCCTCTGAAGAGCACCTAGG + Intronic
993528643 5:88998738-88998760 GTGAGCTCGGAAGAGGACCCTGG + Intergenic
993573881 5:89577674-89577696 CACAGGTCTTCAGAGGACCTAGG - Intergenic
994785336 5:104153384-104153406 AAGAGCTCTGCAAAAGAGCTTGG + Intergenic
997690155 5:135822894-135822916 CAGAGCTCTGCAGAGTGTCTGGG + Intergenic
997995720 5:138584432-138584454 GAGAGCTCTGCAGAGGAGGGAGG + Intergenic
999774932 5:154804448-154804470 GAAAGCTCAGCCCAGGACCTGGG + Intronic
1000227971 5:159287287-159287309 GAGAGCTCTGTTGAGTACTTGGG - Intergenic
1001257589 5:170196182-170196204 GAGTGCTCTGATGAGAACCTGGG - Intergenic
1001532936 5:172477470-172477492 GAGAGCTGAACAGAGCACCTTGG - Intergenic
1001986408 5:176077030-176077052 CACAGGTCTGCAGAGGAACTTGG - Intronic
1002230459 5:177761095-177761117 CACAGGTCTGCAGAGGAACTTGG + Intronic
1002264877 5:178022652-178022674 CACAGGTCTGCAGAGGAACTTGG - Intronic
1002357548 5:178642882-178642904 GACAGTTCTGCAGATGGCCTTGG - Intergenic
1002384974 5:178859977-178859999 GAAAGCTCCGCAGAGCGCCTGGG - Exonic
1002653546 5:180723346-180723368 GAGCGTGCTGCATAGGACCTAGG + Intergenic
1002889665 6:1321263-1321285 GAGGGGTCTGCAGGGAACCTGGG + Intergenic
1003045913 6:2732598-2732620 GCCAGCTCTGCAGTGGCCCTAGG + Intronic
1004036146 6:11926019-11926041 CAGACCTATGCAGAGGAGCTGGG - Intergenic
1005582462 6:27247926-27247948 GAGAGCTCTGCCCAGGGCCTGGG + Exonic
1007270277 6:40630865-40630887 GAGAAAGCTGCAGAGGTCCTTGG + Intergenic
1007707622 6:43800428-43800450 GAAAGCTGTGCAAAGGCCCTGGG - Intergenic
1007950363 6:45866804-45866826 GAGAGCTCTGGAGGGGTCCTTGG + Intergenic
1009480058 6:64145923-64145945 TAGGGCTCTTCTGAGGACCTTGG - Intronic
1009943133 6:70312644-70312666 GAGAGCCCTGGCGAGGCCCTTGG - Intergenic
1010825652 6:80470263-80470285 TATAACTCTGAAGAGGACCTGGG - Intergenic
1011516946 6:88165905-88165927 GAGAGCTCTGCAGGGAGCCGAGG + Exonic
1013587354 6:111591394-111591416 GAGAGGTCTGGGGAGGTCCTGGG + Exonic
1013857254 6:114588809-114588831 CACAGCTTTGCAGAGGCCCTGGG + Intergenic
1016825110 6:148381447-148381469 GAGAAAAATGCAGAGGACCTTGG + Intronic
1018615934 6:165687020-165687042 GATCGCTCTGCAGAAGAGCTGGG + Intronic
1019472881 7:1230442-1230464 GAGAGCTCTTCAGAGGCCCTCGG - Intergenic
1019563300 7:1668219-1668241 GGGCGCTCTGAAGAGGCCCTCGG + Intergenic
1019854139 7:3587139-3587161 CAGAACTCTGCTGTGGACCTAGG + Intronic
1021202522 7:17742080-17742102 GAGAGTTCAGCAGGTGACCTGGG + Intergenic
1022602266 7:31772484-31772506 GAGAGAACTGCAGAAGCCCTGGG - Intronic
1028772929 7:94647733-94647755 AAGACCTCTGTAGAGGCCCTGGG - Intronic
1030305848 7:108018380-108018402 GACAACCCTGCAGAGGACATTGG - Intergenic
1034114844 7:148575633-148575655 GAGAGCTCTGGAGACAACATAGG + Intergenic
1037918801 8:22789602-22789624 CAGAGCTCTGCAGTGGGCCCAGG - Intronic
1039889508 8:41674534-41674556 GAGAGCTCTTCAGTGGTCATGGG - Intronic
1044991386 8:97799345-97799367 GTGAGCTAAGCAGAGGAGCTTGG + Intronic
1046394559 8:113625193-113625215 GGGAGGGCTGCAGAGGAACTGGG + Intergenic
1047327497 8:123853851-123853873 GGCAGCTCTGCAGAGTCCCTGGG - Intronic
1047418424 8:124685460-124685482 GAGAGCTCTGCCCAGAATCTGGG - Intronic
1048011921 8:130464700-130464722 AAGAGCTCTCCAGGGGACCCAGG - Intergenic
1049443430 8:142619433-142619455 GAGAGCCCTGGAGGGGACCAGGG + Intergenic
1050678994 9:8087981-8088003 TAGAGCTTTGGAGAGGACATTGG + Intergenic
1051106015 9:13581139-13581161 TAGAGTTCTGCAGAGGAACATGG - Intergenic
1051148955 9:14060050-14060072 GAGGGCTCTGGTGAGGGCCTTGG + Intergenic
1051297062 9:15608017-15608039 GGGAACTCTGCAGAGGTCCAAGG + Intronic
1051362020 9:16289521-16289543 AAGCTCTCTGCAGAGTACCTGGG + Intergenic
1051609937 9:18951276-18951298 GAGACCTCAGGGGAGGACCTGGG - Intronic
1052118890 9:24684080-24684102 GATAGTTCTGCAGAGTACTTAGG + Intergenic
1053348037 9:37392500-37392522 GAGTGCTCCTCAGAGGGCCTGGG - Intergenic
1053426047 9:38010811-38010833 GAGCGCACTGCAGAGGGCCCAGG + Intronic
1054954332 9:70890877-70890899 GACAGCTCTGCAGCAGAGCTGGG + Intronic
1055355496 9:75433254-75433276 TAGAGTTCTGAAAAGGACCTTGG - Intergenic
1057801689 9:98195054-98195076 GAGACCTCTGCAATGAACCTGGG + Intergenic
1059524567 9:114978656-114978678 GAGAGCTCTGCAGAGCCCCAAGG - Intergenic
1060401343 9:123351244-123351266 GAGAGGTGGGCAGAGGAGCTGGG + Intergenic
1060552820 9:124493663-124493685 GAGAGCTCTGCGTAGGCCCGGGG - Intronic
1060556938 9:124512850-124512872 AAGGGCTGGGCAGAGGACCTGGG + Intergenic
1061800195 9:133109427-133109449 GAGAGCTGTGGAGGGGTCCTGGG - Intronic
1062015433 9:134288845-134288867 GAGGTCTTTGCAGAGCACCTCGG + Intergenic
1062685862 9:137813096-137813118 GAGCGCTCTGCAGATGAGCAAGG + Exonic
1186076367 X:5883759-5883781 CAAAGCTCTGCAGAGGACAGAGG + Intronic
1186351268 X:8742130-8742152 TACAGCTCTGCAGAGCAACTAGG - Intergenic
1186510358 X:10125681-10125703 GTGAGCACTGCAGAGGTCATTGG - Intronic
1190108236 X:47573888-47573910 GGGACCCCTGCATAGGACCTGGG + Intronic
1190730384 X:53221939-53221961 GAGAGGTCTGCATAGGAGGTTGG - Intronic
1191921137 X:66258295-66258317 GAGAGTTATGGAGAGGAACTAGG + Intronic
1192144280 X:68670649-68670671 GACAGGTCTGAAAAGGACCTGGG + Intronic
1192179419 X:68907087-68907109 GAGAGCACTGCTGTGGTCCTGGG + Intergenic
1198935231 X:141896970-141896992 GAGGACTCTGCGGAGGACCCTGG - Exonic
1199222414 X:145333120-145333142 GAGATCGCTGGAGTGGACCTGGG + Intergenic
1200957899 Y:8970195-8970217 GGGAGCTCAGGAGAGGGCCTGGG - Intergenic
1201223318 Y:11791890-11791912 GAAAGCTCATCAGAGAACCTAGG + Intergenic
1201414606 Y:13735707-13735729 TAGAGCTCTGCAGAGCAACTAGG + Intergenic