ID: 1133262185

View in Genome Browser
Species Human (GRCh38)
Location 16:4558100-4558122
Sequence GCCTCTTTGCTGCTCCTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 223}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133262185_1133262189 18 Left 1133262185 16:4558100-4558122 CCTGTGAGGAGCAGCAAAGAGGC 0: 1
1: 0
2: 1
3: 19
4: 223
Right 1133262189 16:4558141-4558163 AAGAGGAAACTGACGCTCAGAGG 0: 1
1: 6
2: 155
3: 691
4: 1917
1133262185_1133262186 1 Left 1133262185 16:4558100-4558122 CCTGTGAGGAGCAGCAAAGAGGC 0: 1
1: 0
2: 1
3: 19
4: 223
Right 1133262186 16:4558124-4558146 TTCCTTCTGCCTTACAGAAGAGG 0: 1
1: 0
2: 0
3: 45
4: 341

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133262185 Original CRISPR GCCTCTTTGCTGCTCCTCAC AGG (reversed) Intronic
900472313 1:2860995-2861017 GCCTCTGTGCTGCTTCCCTCTGG + Intergenic
900673581 1:3870423-3870445 GGCTCCTTGCTGCTCCTGCCAGG + Intronic
900936810 1:5771177-5771199 GTCTCTTTGCTGCACTTCAGTGG + Intergenic
900969809 1:5985337-5985359 GCTTCTGTGCTGCTGCCCACGGG - Intronic
901659117 1:10787689-10787711 GCCTCTTTGCTGATGGTCTCTGG - Intronic
903370323 1:22831129-22831151 GCATCTTTGCAGGTCCACACTGG + Intronic
905595644 1:39204415-39204437 GGCTCCTTGCTTCTCCTCCCGGG + Intronic
905665711 1:39761793-39761815 GCCACTCTGCTCTTCCTCACAGG + Intronic
905926285 1:41752229-41752251 ACCTCTGTGCTGCACCTCCCTGG + Intronic
906041002 1:42787758-42787780 GCCTCTGTGCTACTTCACACTGG - Intronic
906078048 1:43066731-43066753 GCCTCCCTGCTGCTCCAGACTGG + Intergenic
906299557 1:44672205-44672227 TCCTTATTGCTGCTCCTGACTGG - Intronic
906593288 1:47048407-47048429 TCTTCTTAGGTGCTCCTCACTGG + Intronic
906612641 1:47213939-47213961 GCCTCCTTGGTGCCCCCCACGGG - Intergenic
907329465 1:53661714-53661736 ACCTCTATGCTGCCCCTCTCTGG + Intronic
907745774 1:57212233-57212255 GACCATTTGCTTCTCCTCACTGG - Intronic
910209349 1:84777534-84777556 GCCTCTTTACTGCTGCTGCCTGG - Intergenic
913115472 1:115692501-115692523 GCCTCTTTCCTGGTCCTAAGTGG - Exonic
913383180 1:118231879-118231901 TCCTCTTTCCAGCTGCTCACCGG + Intergenic
915087574 1:153398546-153398568 GCCTCTGTGCAGCTCCTCTCTGG + Intergenic
918338751 1:183549250-183549272 TCCTCTTTCCTGTCCCTCACCGG + Exonic
918586762 1:186197139-186197161 GACTCTTTTCTGCTTCTCTCAGG - Intergenic
920173290 1:204084660-204084682 GCCTCTTGTCTCCTCCTCCCTGG + Intronic
920282393 1:204853954-204853976 GCTTCTTTTCTGCTCCTCCTTGG + Intronic
920353310 1:205352152-205352174 GCCTCTTTGCTTCTCCCAGCAGG + Intronic
922648863 1:227319009-227319031 GCCCCTTACCTGCTCCCCACCGG + Intergenic
924808954 1:247384342-247384364 GCCTCCTTCCTTCTCCTGACTGG - Intergenic
1063565645 10:7170718-7170740 GCCTCATTCCTGCTCCTCTCAGG - Intronic
1067458017 10:46437307-46437329 GCCTCTTTGCAGAACCTCCCTGG - Intergenic
1067629180 10:47947327-47947349 GCCTCTTTGCAGAACCTCCCTGG + Intergenic
1067750029 10:48965369-48965391 GACTCCATGCTGCTCCTGACAGG + Intronic
1069558310 10:69412395-69412417 CCCTCTTATCTGCTCCACACTGG - Intronic
1069777355 10:70934804-70934826 GCCTCTTTCCTGCTGCACATGGG + Intergenic
1070358135 10:75660465-75660487 GCCTCTGTTCTGCCCATCACAGG + Intronic
1070422462 10:76250755-76250777 GCCTGTTTCCTGTTCCTAACTGG + Intronic
1071446523 10:85753799-85753821 GCCTCATAGCAGCTCCTCAGAGG + Intronic
1073047719 10:100650638-100650660 GCCACCTGGCTGGTCCTCACAGG - Intergenic
1075933793 10:126322596-126322618 GCCTCTCTCCTGTCCCTCACCGG - Intronic
1076619095 10:131775630-131775652 GCCTCTCTGCCGCTCTCCACCGG - Intergenic
1077338919 11:2017460-2017482 GCCTGTTTGCTGCTCCTGGGAGG + Intergenic
1078094510 11:8288528-8288550 GCATATTTGCTGCTTCCCACTGG - Intergenic
1080750022 11:35142592-35142614 GCCTCTTTGCTCCTTCACATGGG - Intronic
1083822829 11:65182334-65182356 GCCTCTTTGATCCTGTTCACAGG - Intronic
1084793858 11:71491372-71491394 TCTTCTTTGCTTATCCTCACTGG + Intronic
1084981882 11:72833513-72833535 TGCTCTTTTCTGTTCCTCACAGG + Intronic
1086445361 11:86865496-86865518 GCCTCCTTGCTGGGCCTCAGTGG + Intronic
1087173450 11:95074380-95074402 GGCTCTGTGCTATTCCTCACTGG + Intergenic
1088007576 11:104961341-104961363 GCCTCCTTCCTTCTCCTGACTGG + Intronic
1088400953 11:109422458-109422480 GCCTCCTTGCTGCTCCCAAGAGG - Intronic
1089115038 11:116087958-116087980 TCCTGTGTGCTGCTCCTCCCTGG - Intergenic
1089221202 11:116873461-116873483 GGCTCTGTGCTGCTACTCACTGG + Exonic
1202821903 11_KI270721v1_random:72642-72664 GCCTGTTTGCTGCTCCTGGGAGG + Intergenic
1093101728 12:15036877-15036899 GCCTCCTTCCTTCTCCTGACCGG - Intergenic
1094425213 12:30310108-30310130 GCCTCTGTGCTGCTCCTGGGTGG - Intergenic
1095859870 12:46905093-46905115 GGGTCTTTGCTGCCCCACACTGG + Intergenic
1096474771 12:51901615-51901637 GCCTCATTACTGCTCCTCCACGG - Intergenic
1099218944 12:79889413-79889435 GGCTCTGAGCTGCTCCCCACTGG + Intronic
1100285972 12:93166974-93166996 TCCTCTTTGCTTCTCCTCTGGGG - Intergenic
1100363599 12:93899390-93899412 GTGTCTCTTCTGCTCCTCACTGG - Intergenic
1101382988 12:104230754-104230776 GCCACTTTTCTGCCCCACACAGG - Intronic
1102207012 12:111097726-111097748 GTCTCTTTGCGGATCCTCCCTGG - Intronic
1103043347 12:117714386-117714408 CCCTCTTTGCTGCTCCCTAGGGG - Intronic
1104769875 12:131354759-131354781 GCCTCCTTTCTGCTCTTCACAGG - Intergenic
1110410322 13:75197855-75197877 GCCTCTGTGTTGCTCCTCCAGGG - Intergenic
1110796317 13:79642836-79642858 GAGACTTTGCTGGTCCTCACTGG + Intergenic
1112033213 13:95475531-95475553 GCTTCTCTGCTGCTCCCCAAGGG + Intronic
1113630761 13:111882049-111882071 GCTTCTTTGCTGCTGCTCACAGG - Intergenic
1114532323 14:23403695-23403717 GCCTCCCTGCTGGTACTCACAGG + Exonic
1116301141 14:43184823-43184845 GCCACTTTTCTGCCCCACACGGG + Intergenic
1117817329 14:59611521-59611543 GCCTCCTTTCTTCTCCTGACTGG + Intronic
1118572558 14:67208069-67208091 CCCTCCTTACTACTCCTCACGGG + Intronic
1119512557 14:75222801-75222823 CCATCTTTGCTGCTCCTACCTGG + Intergenic
1119673693 14:76538640-76538662 GACTCTTTGCTGTGCCTGACTGG + Intergenic
1120385883 14:83845279-83845301 GCCTCCTAGCAGGTCCTCACAGG + Intergenic
1121331844 14:93054600-93054622 GCATCTTTCTTGCTCTTCACTGG - Intronic
1121407959 14:93730410-93730432 GAGTCCTTGCTGCTCCTCCCTGG - Intronic
1122314649 14:100818525-100818547 GCCTTTTGGCTGAGCCTCACTGG - Intergenic
1122571285 14:102704160-102704182 CCCTCTTTGCTTCTCCTCTTTGG - Intronic
1122767786 14:104083777-104083799 GCCTTCTTGCTGTGCCTCACAGG - Intergenic
1124653662 15:31490192-31490214 GCTGCATGGCTGCTCCTCACTGG - Intronic
1124817325 15:33007987-33008009 GCCTCTTTGATGCTACTGAACGG - Intronic
1127082764 15:55396849-55396871 GCCTCCTTGCTGTTTCTCAGAGG - Intronic
1127543357 15:59965441-59965463 GACTCATTCCTGCTCATCACTGG + Intergenic
1128075879 15:64825210-64825232 CCCTCTTTGCATCTCCCCACGGG - Intronic
1128359030 15:66947769-66947791 GTCTCTTTGCTGCAACCCACAGG + Intergenic
1128410215 15:67389379-67389401 CTCTCTTTGCTGATCCACACAGG + Intronic
1129300217 15:74621088-74621110 GCCTCTCCACTGCTCCTCAGGGG - Intronic
1129381364 15:75169582-75169604 GCCTCCTTCCTTCTCCTGACTGG + Intergenic
1129601588 15:77002064-77002086 GCAGCATTGCTGCTCCTCAGGGG - Intronic
1130021449 15:80235076-80235098 GCCTCTCAGCTGCTCTTCCCTGG + Intergenic
1130151681 15:81316049-81316071 CCCTCTGTGCTGTTCCTCAAAGG + Intronic
1130833638 15:87628538-87628560 TCCTGGTTGCTGCTCCCCACAGG + Intergenic
1131406859 15:92172019-92172041 ACCTCTTTGGTCCTCATCACAGG - Intronic
1133262185 16:4558100-4558122 GCCTCTTTGCTGCTCCTCACAGG - Intronic
1135793963 16:25423893-25423915 GCTTCTATGCAGCTCCTGACTGG - Intergenic
1136408983 16:30065620-30065642 GCCTCTGGGCTGCGCCTCTCGGG + Intronic
1137675907 16:50303844-50303866 TCCTCCTGGCTGCTTCTCACAGG + Intronic
1138339309 16:56278379-56278401 ACTCCTTTCCTGCTCCTCACAGG - Intronic
1139701671 16:68711576-68711598 GCCTCTGTTCTGCTTCCCACTGG + Intronic
1142292152 16:89198130-89198152 GCATCCCTGCTGCTCCTCGCTGG - Exonic
1142517728 17:443608-443630 GACCCTATGCTGCTTCTCACTGG - Intronic
1143994277 17:10993311-10993333 GTCTCTGTGCTGCTCCTCCCAGG + Intergenic
1145718898 17:27049849-27049871 CCCTCCCTGCTGCACCTCACTGG + Intergenic
1146525594 17:33564582-33564604 GCCATTATGCTGCTCCTCAGGGG - Intronic
1146662868 17:34676271-34676293 GCTGCTTTGCTGTTCCTCAAAGG + Intergenic
1148391417 17:47275743-47275765 GCCTCTTTGCCGTTCAGCACGGG + Intronic
1148752589 17:49953999-49954021 TCCTCTTGGCTGCACCTCCCTGG + Intergenic
1149524138 17:57340878-57340900 GCATCTTGGCTGCTCCTCCTTGG + Intronic
1150793959 17:68222999-68223021 GCCTCTCTGCTGCTCCTACTTGG - Intergenic
1152418449 17:80178204-80178226 GCCTGTCTGCGGCTCCCCACAGG - Intronic
1153043100 18:832453-832475 CCCTCATTTCTGCTGCTCACGGG - Intergenic
1155469234 18:26173239-26173261 GCCTCTTTACTGTTCTTCAGAGG + Intronic
1157652274 18:49345586-49345608 GCCTCTTTGTTGTTCCTTAAAGG - Intronic
1157878290 18:51294202-51294224 GCCTCTCTGCTGTTCCTCTCTGG - Intergenic
1158564998 18:58547355-58547377 GTCTCTTTCCTGCCCCTCTCTGG - Intronic
1160193295 18:76732876-76732898 GCCTCCTTCCTTCTCCTGACTGG - Intergenic
1160868882 19:1268084-1268106 CCCGCTTTGCTGCTCATCCCAGG - Intronic
1163639945 19:18456501-18456523 TCCTCCTTCCTGCTCCTCCCTGG - Intronic
1164527509 19:29022772-29022794 GCCTGTCTGCTGCTCCACGCTGG - Intergenic
1164674562 19:30092850-30092872 GCTTCTGGGCTGCTCCTCCCTGG + Intergenic
1165259100 19:34597749-34597771 CGCTCTCTGCTGCTGCTCACAGG - Intronic
1166377490 19:42335909-42335931 GTCTCTTTTCTCTTCCTCACAGG + Exonic
1167149166 19:47699083-47699105 GCCTCTGGGCTCCTCCTCGCTGG + Intronic
1167566854 19:50262069-50262091 GCCTCCTTGCTGCACCTCTATGG - Intronic
1168508538 19:56956105-56956127 CCCTCTTTTCTGCTCATCATGGG + Intergenic
925182040 2:1823642-1823664 GCCTCATCGCTGCTCCTCCCAGG - Intronic
928672052 2:33611995-33612017 GCCTCCTTCCTTCTCCTGACTGG + Intergenic
931860229 2:66346745-66346767 CCCTCTTTGCTGCCTCTCACAGG - Intergenic
932209337 2:69914635-69914657 GCAGCCTGGCTGCTCCTCACCGG - Intronic
933051733 2:77610225-77610247 CCATCCTTGCTTCTCCTCACTGG + Intergenic
933255696 2:80078451-80078473 TCCACTTTTCTGCTCCTCGCTGG - Intronic
935553512 2:104482713-104482735 GTTTCTTTGCTGCGCTTCACTGG - Intergenic
938344015 2:130554087-130554109 GCCACTTGGCTGCTTCCCACAGG + Intergenic
938345818 2:130566635-130566657 GCCACTTGGCTGCTTCCCACAGG - Intergenic
940968439 2:159867034-159867056 GCTCCTTTGCTGCACCTCAGAGG + Intronic
943758552 2:191584507-191584529 GCCTCTTTCCTTCTCCCAACTGG + Intergenic
944539584 2:200743037-200743059 GAGTCTTGGCTGCTCCTCTCTGG - Intergenic
946080145 2:217111300-217111322 TGCTCTTTTCTGCTCCTCATGGG - Intergenic
946408991 2:219507224-219507246 GCCTCCCTGTTCCTCCTCACCGG + Intergenic
946650505 2:221888196-221888218 GCCTTTCTGCTGTTCCTCCCAGG - Intergenic
947457395 2:230267699-230267721 GCCTCTTTGCTGTTTGTCACGGG - Intronic
948932049 2:241138043-241138065 GTCTCTTTGCTCATCTTCACGGG - Exonic
1168950899 20:1801397-1801419 GTGACTTTGCTGCTCCTCCCTGG + Intergenic
1169198741 20:3697411-3697433 GCCTCCTTCCTGCTCCTTCCAGG - Intronic
1170749389 20:19131799-19131821 CCCTCTTTGTTGCTCCTTAAGGG + Intergenic
1171024225 20:21614216-21614238 GTCTCATTGCTGATCCTCCCAGG + Intergenic
1173333542 20:42095399-42095421 GCCTCTGTGCTGTTCCTCAAGGG + Intronic
1175819379 20:61900449-61900471 GCCTCCTTGCTCCTCCTACCAGG + Intronic
1175916314 20:62427609-62427631 GCCTCCTTTCTGCTCCTGGCTGG - Intergenic
1176135191 20:63519455-63519477 GCCTCTGCACTGCTCCCCACGGG + Intergenic
1176885841 21:14254841-14254863 GCCTTGGTGCTGCTCCCCACAGG - Intergenic
1177832124 21:26150517-26150539 GTCTCTATCCAGCTCCTCACTGG + Intronic
1178388790 21:32181495-32181517 GCCTCATTTCTCCTTCTCACTGG - Intergenic
1179316170 21:40246214-40246236 GCCTCTTTTCTGCTTCTTTCTGG - Intronic
1179902253 21:44400334-44400356 GCCTTCCCGCTGCTCCTCACCGG + Exonic
1181688959 22:24547757-24547779 GCCTCTCTGCTGCTGCTCCCTGG + Intronic
1184815060 22:46862771-46862793 GCCTCTCAGCTGCACCTCCCAGG - Intronic
1185068754 22:48644917-48644939 GACTCTCTGCTGATCCCCACAGG + Intronic
1185212149 22:49576341-49576363 GCCTCTGTCCTGCTCCCCCCTGG - Intronic
1185335499 22:50269407-50269429 GCCGCTTAGCTGCTGCCCACTGG - Intronic
949177524 3:1083659-1083681 GCCTATTTGCTGCTACACAGTGG + Intergenic
949791863 3:7801602-7801624 GCCACTTTCCTGCTCCTCAAAGG + Intergenic
951383991 3:22022925-22022947 GCCTCTTCCCTGATCCCCACAGG - Intronic
955336286 3:58088853-58088875 GCCTCATTACTGCTCCTCCATGG - Intronic
958082695 3:88767443-88767465 GCCTCTTTTTTTCTCCTCATGGG - Intergenic
958698750 3:97560778-97560800 GCTTCTTTACTGCTCTTCACAGG + Intronic
959453786 3:106534490-106534512 GCCTCTATATTCCTCCTCACTGG + Intergenic
960990116 3:123304665-123304687 ACCTCCTTCCTGCTCCTCGCTGG - Intronic
961406052 3:126680183-126680205 GCTTCTTTCCTTCTCCTCCCAGG + Intergenic
966931431 3:184678204-184678226 CCCAGTTTGCTGTTCCTCACCGG + Intronic
966935616 3:184706794-184706816 GCCTCCTTCCTTCTCCTGACTGG - Intergenic
967465805 3:189805109-189805131 GCTTCTTTGTTGCTTCTCAATGG + Intronic
968577607 4:1375213-1375235 GCCTGCTATCTGCTCCTCACGGG - Intronic
968668862 4:1837163-1837185 CCCTCCTTGGTGCTGCTCACAGG + Intronic
968929926 4:3573423-3573445 GCCTCTGTGCTGCCACTCAGGGG + Intergenic
969705139 4:8787615-8787637 GCCTCTTTACTGCTGGTCCCTGG - Intergenic
974021042 4:56692735-56692757 GCCTGTGTGCTGCTCCTCCAAGG - Intergenic
977295293 4:95202781-95202803 GCCCCTGTGCTGCTCCTCGCTGG - Exonic
978961295 4:114682516-114682538 GTATGTTTGCTGTTCCTCACTGG + Intergenic
984934022 4:184874200-184874222 CCCTCTCAGCTGCTCCTCTCTGG + Intergenic
985389301 4:189478542-189478564 GCCCCCTCACTGCTCCTCACAGG - Intergenic
985599758 5:821159-821181 GGCTCTCTGCTGCTCCCCCCGGG + Intronic
985800823 5:2004591-2004613 GCCACTTTCCTGCCCCACACAGG - Intergenic
985800835 5:2004631-2004653 GCCCCTTTCCTGCCCCACACAGG - Intergenic
985801009 5:2005286-2005308 GCCCCTTTCCTGCCCCACACAGG - Intergenic
985801032 5:2005366-2005388 GCCCCTTTCCTGCCCCACACAGG - Intergenic
985801042 5:2005406-2005428 GCCCCTTTCCTGCCCCACACAGG - Intergenic
985958540 5:3282392-3282414 GCCTCTTGCTTGCTCCTCCCAGG - Intergenic
985986626 5:3521698-3521720 CCCTCTTCCCTGCACCTCACAGG + Intergenic
986142934 5:5048765-5048787 GCCTCTCTTCTGATCCTCCCTGG + Intergenic
988907203 5:35801982-35802004 GCTTCTTTTGTGTTCCTCACGGG - Intronic
994130960 5:96226790-96226812 CCCTCTTGGCCGCTCCTCCCTGG + Intergenic
994994586 5:107043797-107043819 GTCTCTTTGCAGCACTTCACAGG + Intergenic
997166059 5:131660994-131661016 GCCTCCTTCCTTCTCCTGACTGG + Intronic
997416431 5:133732262-133732284 GCCTGTGTACTGATCCTCACTGG + Intergenic
1002326056 5:178407130-178407152 GCCTCATTACTGCTCCCCATGGG - Intronic
1006644804 6:35508879-35508901 GCCTGTGTGCTCCTCCTCCCTGG + Intronic
1007849375 6:44789037-44789059 GCCTCTTTCCTCCTCCCCTCAGG + Intergenic
1010654558 6:78496737-78496759 GCCACTTTGCTACTCCTTCCAGG + Intergenic
1014129078 6:117810732-117810754 GCATCTTTGCTGCACTTCATTGG + Intergenic
1014688911 6:124536729-124536751 GCTTCTTTGCTGCTTCTCAACGG + Intronic
1016291934 6:142536648-142536670 GCCTCTTTCTTGCTCTTCAGGGG - Intergenic
1017248599 6:152255728-152255750 GCCTCTTTGCCCCTCCACTCTGG + Exonic
1020056189 7:5118830-5118852 TCCTTCTTGGTGCTCCTCACTGG - Intergenic
1020769321 7:12368510-12368532 GCAGCTTTGCTGTTCCTCAAAGG - Intronic
1022946421 7:35289600-35289622 GCCACTTTGCTGCCAGTCACTGG - Intergenic
1023809632 7:43901953-43901975 CCCTCCTGGCTGCTCCTCTCAGG - Intronic
1029595168 7:101533816-101533838 GCATCTCTCCTGCTCCTCACTGG + Intronic
1030093910 7:105880968-105880990 GCCTCTTTCCTGCCCCTTGCAGG + Intronic
1030480113 7:110092678-110092700 GCTTCTGTGCTGCTCTTCTCAGG - Intergenic
1030748310 7:113196719-113196741 GGCTCTTTGGAGCTCCTCATGGG + Intergenic
1035319123 7:158017267-158017289 GCCTCTTTGATGTTCCTAGCTGG - Intronic
1039432162 8:37533422-37533444 GCCAATTTGCTGCTCTTGACAGG - Intergenic
1039449148 8:37657648-37657670 GCTTCTTTGCGGCTTCTCACAGG - Intergenic
1041330708 8:56720652-56720674 GGCTCTTTTCTATTCCTCACTGG - Intergenic
1042408849 8:68438756-68438778 TGCTCTTTGCTGTTCCTGACTGG + Intronic
1044176762 8:89135330-89135352 GCCTCATTATTGCTCCCCACTGG - Intergenic
1046897357 8:119487151-119487173 CCTTCTTTGCTGCTTATCACAGG - Intergenic
1047210542 8:122836679-122836701 GCCTCTTTCTTGATCTTCACGGG + Intronic
1047423218 8:124724365-124724387 GCCTCTATTCTGCTCAGCACAGG + Intronic
1048920550 8:139226002-139226024 CCCTCTCTGCTTCTCCTCTCTGG - Intergenic
1049255153 8:141609732-141609754 GCATCTTTGTTGCTCCTTGCAGG - Intergenic
1050988456 9:12113790-12113812 GCCTCTTCGTTGCTTGTCACTGG - Intergenic
1051168019 9:14286313-14286335 GACTCTGCGCTGCTCCTAACTGG - Intronic
1056033620 9:82581076-82581098 GCCTATTTTGTTCTCCTCACTGG + Intergenic
1056998616 9:91487335-91487357 AGCCCTTTGCTTCTCCTCACTGG - Intergenic
1057433584 9:95018719-95018741 GCCTCTTGGCTGCAGCACACAGG + Intronic
1057641752 9:96830397-96830419 GCCTCATTACTGCTCCCCATGGG - Intronic
1059190200 9:112318150-112318172 GCCTTACTGCTGCTCCTTACGGG - Intronic
1060279996 9:122209386-122209408 GCCTCCTTGCAGCTCCCCACTGG - Intronic
1060306935 9:122421986-122422008 GCCTCCTTCCTTCTCCTGACTGG - Intergenic
1061624420 9:131833352-131833374 GCCTCTTTTCAGCTCATCTCTGG + Intergenic
1061754320 9:132802291-132802313 CCTTCTTTGCTACTCCTCCCAGG + Intronic
1062456415 9:136641361-136641383 GCCCCCTTGCTGCTGCTCTCTGG - Intergenic
1062518463 9:136947523-136947545 GCCGCTAAGCTGCTCCTCTCAGG + Intronic
1186346865 X:8702779-8702801 GCCTCATTGCTTCCCATCACTGG - Intronic
1187116153 X:16353460-16353482 GCATCCTTGCTACTCCCCACTGG + Intergenic
1190322403 X:49186754-49186776 ACCTCTTGGCTCCTCCCCACTGG + Intergenic
1190478389 X:50850451-50850473 GCCTCCTTCCTTCTCCTGACTGG - Intergenic
1191739539 X:64422362-64422384 GCTGCTTTGCTGCTCCACCCTGG - Intergenic
1191925477 X:66304956-66304978 TCCTCTTTGGTGTTTCTCACAGG + Intergenic
1192198311 X:69047177-69047199 GCCTCTCTGCTCCTGCTCCCAGG + Intergenic
1194594252 X:95837498-95837520 GGCTCTGTGCTGCTCCCCACTGG + Intergenic
1201749132 Y:17413345-17413367 GCCTCCTTCCTTCTCCTGACTGG + Intergenic