ID: 1133264350

View in Genome Browser
Species Human (GRCh38)
Location 16:4574575-4574597
Sequence TCCCACTCCTTGGGAAACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 5, 3: 23, 4: 231}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133264339_1133264350 15 Left 1133264339 16:4574537-4574559 CCCAGCATTTCCCAAACTTGTTT 0: 1
1: 5
2: 28
3: 88
4: 511
Right 1133264350 16:4574575-4574597 TCCCACTCCTTGGGAAACACTGG 0: 1
1: 0
2: 5
3: 23
4: 231
1133264340_1133264350 14 Left 1133264340 16:4574538-4574560 CCAGCATTTCCCAAACTTGTTTG 0: 1
1: 3
2: 27
3: 115
4: 500
Right 1133264350 16:4574575-4574597 TCCCACTCCTTGGGAAACACTGG 0: 1
1: 0
2: 5
3: 23
4: 231
1133264342_1133264350 5 Left 1133264342 16:4574547-4574569 CCCAAACTTGTTTGCCCATGGAA 0: 1
1: 1
2: 8
3: 83
4: 291
Right 1133264350 16:4574575-4574597 TCCCACTCCTTGGGAAACACTGG 0: 1
1: 0
2: 5
3: 23
4: 231
1133264344_1133264350 -9 Left 1133264344 16:4574561-4574583 CCCATGGAACCCTTTCCCACTCC 0: 1
1: 0
2: 2
3: 12
4: 225
Right 1133264350 16:4574575-4574597 TCCCACTCCTTGGGAAACACTGG 0: 1
1: 0
2: 5
3: 23
4: 231
1133264345_1133264350 -10 Left 1133264345 16:4574562-4574584 CCATGGAACCCTTTCCCACTCCT 0: 1
1: 0
2: 1
3: 27
4: 395
Right 1133264350 16:4574575-4574597 TCCCACTCCTTGGGAAACACTGG 0: 1
1: 0
2: 5
3: 23
4: 231
1133264343_1133264350 4 Left 1133264343 16:4574548-4574570 CCAAACTTGTTTGCCCATGGAAC 0: 1
1: 0
2: 7
3: 45
4: 245
Right 1133264350 16:4574575-4574597 TCCCACTCCTTGGGAAACACTGG 0: 1
1: 0
2: 5
3: 23
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133264350 Original CRISPR TCCCACTCCTTGGGAAACAC TGG Intronic
900931394 1:5740000-5740022 TCCCCCTCCTTCAGAGACACTGG - Intergenic
901035893 1:6335790-6335812 TCCCAGTGCTTGGGAACCACAGG + Intronic
901754780 1:11434908-11434930 TCCCACTCCTGGGGGACAACTGG + Intergenic
902681109 1:18044389-18044411 TCCCACTCCTGGGGAGACTCCGG + Intergenic
902736199 1:18402822-18402844 TCCCAGTCCTTGGGTCACACAGG - Intergenic
903181366 1:21606487-21606509 TCTCACTCTCTGGGACACACAGG + Intronic
903680304 1:25092023-25092045 TCCCACTCCTCTGGGGACACTGG - Intergenic
905905462 1:41615337-41615359 TCCCTCACCTTGGGATGCACTGG + Intronic
906928074 1:50140404-50140426 TCTCTCTGCTTGGGAAACAGAGG - Intronic
907021703 1:51072511-51072533 TCCCATTCCTTGGCATCCACTGG + Intergenic
907176083 1:52523883-52523905 TGCCACACTTTGAGAAACACTGG - Intronic
907442458 1:54487747-54487769 TCCCTCTCTTTTGGAAACCCCGG - Intergenic
910502012 1:87903187-87903209 TCCCCGTCTTTAGGAAACACAGG - Intergenic
910796073 1:91099140-91099162 GGCCATTCCTTGAGAAACACTGG + Intergenic
910899339 1:92102817-92102839 TCCAATTACTTGGGAAAAACTGG - Intronic
911354087 1:96794947-96794969 TCATACTCCCTGGGTAACACTGG - Intronic
912550744 1:110483775-110483797 TCCCCCTCCTTGAGACACCCAGG + Intergenic
916433499 1:164755264-164755286 TCCCACTCCTTGGGAGGCAGAGG - Intronic
917801837 1:178578699-178578721 TCAAACTCCTATGGAAACACTGG - Intergenic
918106326 1:181418373-181418395 TCCCAATCCTTACTAAACACTGG + Intronic
919910058 1:202105773-202105795 TCCCACTCCCTCTGAAACCCAGG - Intergenic
921600616 1:217102761-217102783 TCTTACTCTTTGGGAGACACTGG + Intronic
922529061 1:226329190-226329212 TCCCAGTACTAGGCAAACACTGG + Intergenic
923451304 1:234120071-234120093 TCCCAGAACTTGGAAAACACTGG + Intronic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
1063127649 10:3149942-3149964 TCCCATTCCTTGGAGAGCACGGG - Intronic
1065340090 10:24696434-24696456 TCCCACTCATTGGCGAAAACGGG - Intronic
1068567364 10:58590868-58590890 TGCCAATCCTTAGGAAACAGTGG + Intronic
1068981644 10:63069170-63069192 TCCCACTCTTTGGGAGGCAGAGG - Intergenic
1072811904 10:98468370-98468392 TCCCACTCCTCAGGAGTCACGGG + Intronic
1073991700 10:109268805-109268827 TCCCACTCCTCAGGCTACACTGG - Intergenic
1075545539 10:123351862-123351884 GCCCCCTCACTGGGAAACACGGG + Intergenic
1076023818 10:127095757-127095779 TCCCTCTCCCTGAGAAACCCAGG + Intronic
1076771077 10:132665173-132665195 TCCCCCTTCTTTGGAAACACAGG - Intronic
1077444930 11:2586486-2586508 TCCCACTCCCTGGGAACCACAGG + Intronic
1079418612 11:20264430-20264452 TCCCACCCCCGGGGAAACAAAGG - Intergenic
1080101153 11:28461068-28461090 TCCCCCTTCTTGGGAAAAAAAGG - Intergenic
1080382178 11:31783618-31783640 CTCCACTCCTTGAAAAACACAGG + Exonic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1081484681 11:43518615-43518637 GCCCACTCTTTGAGAAACACAGG + Intergenic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1083047235 11:59747968-59747990 TCCCACCTCTTGGGAAACAGGGG - Intronic
1084153759 11:67303069-67303091 TCCCACTCCGCAGGAACCACTGG - Intergenic
1084572110 11:69966089-69966111 TGACACTGCTTGGGAAACAAAGG + Intergenic
1084810042 11:71606674-71606696 TCCAGCTACTTGGGAAACAGAGG + Intergenic
1085272091 11:75276413-75276435 TCCAACTCATTGGGAAAAAGGGG - Intronic
1089314173 11:117579397-117579419 GCCCACTCCTTGGGCACAACTGG + Intronic
1089671250 11:120058440-120058462 TCCTCCTCTTTGGGAAACCCTGG + Intergenic
1090855962 11:130609543-130609565 TCCCACTCCTGGGCTAGCACAGG - Intergenic
1092930050 12:13307360-13307382 TCCCACTCCTTGGCCATGACTGG + Intergenic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1096732466 12:53625783-53625805 TCCCACTCTTTGGGAAGCCCTGG + Intronic
1096939673 12:55328342-55328364 TCCCACACCTTGGGAGACCAAGG + Intergenic
1098356199 12:69615219-69615241 TCCCACTCTTTGGGAGACCGAGG + Intergenic
1100712523 12:97273679-97273701 CCCCACTCCTTGCAAAACAAAGG + Intergenic
1101512181 12:105403328-105403350 CCCCACCCCTTGGCAGACACAGG - Intergenic
1102177377 12:110886268-110886290 TCCCACTACTTGGGAGACTGAGG + Intronic
1102483935 12:113243464-113243486 TCCCACTCCATGGGAAAGCATGG + Intronic
1103180408 12:118906401-118906423 TGTTACACCTTGGGAAACACTGG - Intergenic
1103227274 12:119298809-119298831 TCCCACTACTTGGGAGACTGAGG - Intergenic
1104109749 12:125694020-125694042 TCCCCCTACTTGGGAAGCTCAGG + Intergenic
1105963994 13:25368865-25368887 TCTCCTTCCTTGGGAATCACCGG + Intergenic
1106019644 13:25902327-25902349 CCCAAAGCCTTGGGAAACACTGG + Intronic
1110465587 13:75797225-75797247 TCCTACTCTTTAGGAAACAGAGG - Intronic
1112723919 13:102280291-102280313 TCTCTCTCTTTGGGAAACTCTGG - Intronic
1113158877 13:107356076-107356098 ACCCACTCCTTAACAAACACAGG + Intronic
1118913277 14:70079703-70079725 CCTCAGTCCTTGAGAAACACAGG + Intronic
1119035577 14:71227846-71227868 TCCATCTCCTTGGGACACAGTGG - Intergenic
1120014207 14:79451682-79451704 TCCCACTTCTAGGGAAAGTCTGG - Intronic
1120938779 14:89925213-89925235 TACCACGCCAAGGGAAACACAGG + Intronic
1121027192 14:90625297-90625319 TCCCTCTCCTTGGGCAGCACTGG - Intronic
1122316917 14:100831187-100831209 TGCCACTCCCAGGGAAACAGAGG + Intergenic
1122940046 14:104977182-104977204 CCCCACTCCTTGGGGAAAACAGG - Intronic
1127469962 15:59282055-59282077 TTCCACACCTGGGGACACACTGG + Intronic
1128106341 15:65048059-65048081 TCCCACTACTTGGGAGGCAGAGG + Intronic
1128669645 15:69565588-69565610 TCCCTCTGCTTGGGATACATGGG + Intergenic
1129025479 15:72569190-72569212 TCCCACTACTTGGGAGACTGAGG + Intronic
1132563313 16:608755-608777 CCCCACTCCTTGGGAGGCAGAGG + Intronic
1133264350 16:4574575-4574597 TCCCACTCCTTGGGAAACACTGG + Intronic
1134307474 16:13046124-13046146 TGCCTCTCCTTGGGAAAAGCAGG + Intronic
1134817035 16:17214188-17214210 TCCCACTTTTTGGCAAACACAGG + Intronic
1135135563 16:19883974-19883996 CCCCTCTCCTTGGGGGACACAGG - Intronic
1135598658 16:23763131-23763153 TCCCACACCTTGGGAACCTCTGG + Intergenic
1135786656 16:25355801-25355823 TTCCACACCTTGGGAACCTCTGG - Intergenic
1137373440 16:47930034-47930056 GCCCACGCTTTAGGAAACACTGG - Intergenic
1137964931 16:52921385-52921407 TCCCACACTTTGGGAAACACAGG - Intergenic
1138308976 16:56007020-56007042 TCCCTCTGCTTGGGATGCACGGG - Intergenic
1138851267 16:60632636-60632658 TCAGACCCCTTGAGAAACACAGG - Intergenic
1139493630 16:67300759-67300781 TCCCACTACTTGGGAAGCTGAGG - Intronic
1139755540 16:69140215-69140237 TCCCAGTCCTTGGTAAAAATGGG + Intronic
1141458308 16:84159777-84159799 TACCTGTCCTTTGGAAACACTGG - Exonic
1141840521 16:86571430-86571452 TTCCACTCCTTGGGGAACGTGGG + Intergenic
1142559443 17:801239-801261 GCCCTCTGCTTGGGAAACGCCGG - Intronic
1143510006 17:7390210-7390232 TACCCCTCCTTGGGAACCACAGG + Exonic
1146021867 17:29286297-29286319 TCGTAAGCCTTGGGAAACACAGG + Exonic
1146652488 17:34615137-34615159 TCCTGCTCCTGGGGAAACCCAGG - Intronic
1149106585 17:52974807-52974829 TCACAATCCTTGGGAGATACTGG + Intergenic
1149395031 17:56231589-56231611 ATCCACTCCTTTGGAAACAGAGG - Intronic
1149867016 17:60156751-60156773 TCTCAGTCCTTGGGGAACTCGGG - Intronic
1152499584 17:80698866-80698888 TCCAATTCCTGGGGAAACCCAGG + Intronic
1152610273 17:81311914-81311936 CCCCGCTCCTGGGGAAAAACAGG + Exonic
1152705719 17:81842682-81842704 TCCCAGTGCTGGGGCAACACGGG - Intergenic
1153512382 18:5869739-5869761 ACCCATTGCTTAGGAAACACTGG + Intergenic
1155284313 18:24272276-24272298 ACCCGCCCCTTGGGAAACTCTGG + Intronic
1156884266 18:42115991-42116013 CCCCAGACCTTGGGAATCACTGG + Intergenic
1164555162 19:29245768-29245790 TCCCACTGCCTGGGCTACACAGG - Intergenic
1166381965 19:42359312-42359334 TCCCACTCCTTAGGAGTCACTGG + Intronic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1166900910 19:46062081-46062103 TGGAACTCCTTGGGAAAAACAGG - Intronic
1167469771 19:49669130-49669152 TCCCACTCCTTGGCAAGGACAGG + Intronic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1168416420 19:56172020-56172042 CCCCAGGCATTGGGAAACACCGG - Intergenic
926201502 2:10802855-10802877 TCCCACTCCTTGGGCTGCACTGG + Intronic
926865609 2:17354490-17354512 ACCTACTCCATTGGAAACACTGG - Intergenic
928707330 2:33964373-33964395 TCCCAATGCTTGGGAACTACTGG + Intergenic
929999837 2:46853799-46853821 TACCATTCCTTGGGATCCACCGG - Intronic
930773296 2:55149343-55149365 GACCACTCTTTGGGAACCACTGG - Intergenic
933610413 2:84428545-84428567 TCCCACTTTTTGGGGAACAGGGG - Intronic
934074954 2:88420320-88420342 CCCAACACTTTGGGAAACACAGG + Intergenic
937244498 2:120483810-120483832 TCCCTCTCCTTGGGAGACACTGG + Intergenic
939608192 2:144277944-144277966 TGCTTCTCCTTGGGAAACTCAGG - Intronic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
942251326 2:174049670-174049692 TCCCAGGCTTTGGGAAACCCTGG - Intergenic
943569249 2:189553707-189553729 TACCATTCATTTGGAAACACAGG - Intergenic
945618536 2:212105278-212105300 TACCACTCTTTGGAAAACATTGG - Intronic
945974214 2:216258240-216258262 CTCCACTCCTTGGGGCACACTGG + Exonic
947346011 2:229189813-229189835 TCCCACATTTTGGGAAACACTGG - Intronic
948463329 2:238140580-238140602 TTCCACCCCTTGATAAACACAGG - Intronic
948996398 2:241582091-241582113 TCCCAGTCCTTTGGCACCACTGG + Intergenic
949034823 2:241811585-241811607 TCCCACTCCTTGCCAACCCCAGG + Intronic
1168974820 20:1956363-1956385 GACCACACCTTGGGAAGCACTGG + Intergenic
1170264941 20:14455939-14455961 TCTCAGTCTTTGGGAAACACTGG + Intronic
1171152016 20:22835636-22835658 TCACCATCCTTGAGAAACACTGG + Intergenic
1171971054 20:31565530-31565552 TCCCTCTCCTTGTGAAGCATTGG + Intronic
1172432239 20:34901870-34901892 GACCACTCTTTGAGAAACACTGG + Intronic
1172643413 20:36455342-36455364 TCCCACTCCCTCTGAATCACAGG + Intronic
1173436835 20:43040940-43040962 TGCCACAATTTGGGAAACACTGG - Intronic
1175656726 20:60777142-60777164 GCCCATGCTTTGGGAAACACTGG - Intergenic
1176065984 20:63195313-63195335 TCCCACACCTTGAGAAACACAGG + Intergenic
1180557011 22:16586208-16586230 TCTCACTCCTTGGAACCCACTGG + Intergenic
1180968913 22:19804874-19804896 TTCCACCCCTTGGGAAACGTGGG - Intronic
1181690109 22:24554675-24554697 TCCCATGCCTTGGGAAACCGTGG - Intronic
1182853183 22:33494024-33494046 GCCCACTCCGTGGCTAACACAGG + Intronic
1182931498 22:34178415-34178437 TCCAACACCTTGGGAATCAGAGG - Intergenic
1185102108 22:48846119-48846141 TCCCAGTCCTTGGGAAGGAGGGG + Intronic
1185241531 22:49749990-49750012 GCCCACTCCGTGGGGAGCACAGG + Intergenic
949749340 3:7332931-7332953 TCCCATCACTTGAGAAACACAGG + Intronic
956151308 3:66245982-66246004 CCCCACTCCTAGGCAACCACTGG + Intronic
956811170 3:72865442-72865464 TCCAAGTACTTGGGAAGCACAGG - Intergenic
956930215 3:74035017-74035039 TCCCACCCCTTGGCTAAGACAGG + Intergenic
958860554 3:99440000-99440022 TCCCATTCCCTGGAAAACAAAGG - Intergenic
960838121 3:121928087-121928109 GCCCTCTCCTTAGGGAACACAGG + Intronic
961313410 3:126017920-126017942 TCCCACCCTCTGGGAAACAGCGG + Intronic
961333085 3:126154388-126154410 TCTCACTCCTGGGGAAAGGCTGG + Intronic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
962677437 3:137767380-137767402 ACCGACTCCTTTGGAAACAGCGG - Intergenic
962753516 3:138451571-138451593 CCCCACTCCTGGGGAAGCACAGG - Intronic
963923310 3:150925937-150925959 TCCCACTCGGTGGGAATCAAAGG - Intronic
967036162 3:185649642-185649664 CCACACTCCCTGGGACACACAGG + Intronic
967156935 3:186701794-186701816 TCTTCCTCCTTGGCAAACACAGG + Intergenic
969879315 4:10159881-10159903 CTCCATTACTTGGGAAACACTGG + Intergenic
970446393 4:16126485-16126507 TCCCAGTCCCTGGGAACCCCAGG + Intergenic
973132074 4:46660267-46660289 TCCCTCTCATTTTGAAACACAGG + Intergenic
975224872 4:71859573-71859595 TCCCCCTTCTTGGTAACCACAGG + Intergenic
975575183 4:75855555-75855577 TCCCACACTTTGGGAGACAAAGG + Intergenic
975594101 4:76031077-76031099 TCCCACACTTTGGGAAACACTGG - Intronic
976653019 4:87456338-87456360 CCCCAATCCTTAGGAAAGACAGG + Intronic
982592959 4:157338437-157338459 TCCCACTCCCTGACAAACACTGG - Intronic
983183193 4:164672326-164672348 TAACACACTTTGGGAAACACTGG + Intergenic
985637881 5:1048822-1048844 TCTTGCTCCTTGGGAAGCACCGG + Intergenic
985698908 5:1358777-1358799 TCCCACTCCCTGGGTGGCACAGG - Intergenic
986070967 5:4282217-4282239 TCCCACTACTTGGGAGACTGAGG + Intergenic
987282645 5:16426485-16426507 TCCCAGTACCTGGGTAACACAGG + Intergenic
990271195 5:54141720-54141742 TCCCACTCCCAGGCAATCACTGG + Intronic
990491111 5:56303866-56303888 TCTCAACCCTTGGGGAACACAGG + Intergenic
991524603 5:67542518-67542540 TCCCACACTCTGGGAAACCCTGG + Intergenic
992251271 5:74878104-74878126 TCTCACTGCCTGGGCAACACAGG + Intergenic
994592543 5:101790777-101790799 TCCCACCCCTTTGGAAACTTAGG + Intergenic
996409088 5:123137472-123137494 TACCACACTTTGGGAAACACTGG - Intronic
997707902 5:135975978-135976000 ACCCACTCTCTGGGAATCACGGG + Intergenic
998981462 5:147707601-147707623 TACCAATGCTAGGGAAACACTGG - Intronic
999429920 5:151517290-151517312 CCCCCATCCCTGGGAAACACTGG + Intronic
999450639 5:151675263-151675285 TCCCACTTCTTAGTAAACAGAGG + Intronic
999521115 5:152351586-152351608 TCCCTCTCCTAGGGATAAACAGG + Intergenic
1000493388 5:161945339-161945361 TCCCTCTCCTTGTGTAAAACAGG + Intergenic
1002308502 5:178298401-178298423 ACACACCCTTTGGGAAACACTGG - Intronic
1003359198 6:5408184-5408206 GCTCTCTCCTTGGGAAACATAGG + Intronic
1003396267 6:5755343-5755365 TCCCACCCCTTGAGAGACCCTGG + Intronic
1003579077 6:7322992-7323014 TCAGAATCCTTGGGAAACATGGG + Intronic
1005488524 6:26324146-26324168 TCCCCCAGCCTGGGAAACACAGG - Intergenic
1007715584 6:43854001-43854023 TCCCACTCCTTGGGAGGCTGAGG - Intergenic
1007794983 6:44339878-44339900 TGCCAATCCTGGGAAAACACTGG + Intronic
1008933522 6:56964745-56964767 TCCCAATACTTGGGAGACAGAGG - Intronic
1009716783 6:67408063-67408085 TGGAACTCCTTGGGAAAAACAGG + Intergenic
1010104069 6:72147530-72147552 TGGGACTCCTTGGGAAACAGAGG - Intronic
1011955300 6:93017989-93018011 ATCCACTGCTTGGGAAATACTGG - Intergenic
1014682624 6:124451455-124451477 TCCCACTCCTTTGAAATCAGAGG - Intronic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1016769491 6:147833068-147833090 TCCCAGTGCCTGGGAACCACTGG + Intergenic
1017176158 6:151506650-151506672 CCACACTCTTTTGGAAACACAGG + Intronic
1017513314 6:155133229-155133251 TCCCACTACTTGGGAGGCAGAGG + Intronic
1018366433 6:163124624-163124646 TCCCATTCCTGGGGAAATGCTGG - Intronic
1018548431 6:164963759-164963781 TCTCACTCCGTGTGACACACTGG + Intergenic
1019833053 7:3352855-3352877 TCCCACTCTTCGGAAAATACAGG - Intronic
1020350549 7:7214286-7214308 TGGAACTCCTTGGGAAAAACAGG - Intronic
1020369789 7:7419352-7419374 TCTCCCTCTTTGAGAAACACTGG + Intronic
1021913007 7:25405222-25405244 TCTGACACCTGGGGAAACACTGG - Intergenic
1021998299 7:26201522-26201544 TCCCTCCCCTTGGGGACCACCGG + Exonic
1022009719 7:26298440-26298462 TCCCACACCTTCGTCAACACTGG - Intronic
1022134282 7:27432506-27432528 ACACATTCCTTGGGAATCACTGG + Intergenic
1022788193 7:33660076-33660098 TCCCAGTCGTTGAGAACCACTGG - Intergenic
1023093769 7:36640157-36640179 TCCCCCTCCTTGGCAAAAGCTGG - Intronic
1026132286 7:67630415-67630437 TGCCGGTCCTTGGGAAATACTGG + Intergenic
1026979147 7:74516503-74516525 TCACACGCCCTGGGAAACATCGG + Intronic
1027645291 7:80790166-80790188 CCCAACTCCTTGGGAAACTGAGG + Intronic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1029988916 7:104945312-104945334 GCCCAGTCCCTGGGGAACACAGG - Intergenic
1033589502 7:142797611-142797633 CCCCGCTCCTGGGGAAAGACTGG + Intergenic
1034479251 7:151307296-151307318 TCCGACTCTATGGGGAACACAGG - Intergenic
1034620319 7:152451786-152451808 TCTCACTCCTTGGAACCCACTGG - Intergenic
1034953349 7:155316399-155316421 CCACACTCCTTGGGAAGCAGGGG - Intergenic
1035184183 7:157112877-157112899 AGCCACTCCTCGGGTAACACTGG - Intergenic
1035613533 8:985776-985798 TCTCACATCTGGGGAAACACTGG - Intergenic
1035731533 8:1856849-1856871 TCCCAGCCCTTGGGAAAGGCTGG + Intronic
1036937243 8:13014942-13014964 TCCCACTACTTGGGAAGCTGAGG + Intronic
1037081020 8:14786799-14786821 TTCCACTCCTTGTAAAACATGGG - Intronic
1037848945 8:22310106-22310128 TCCCACACTTTGGGGAATACTGG - Intronic
1038432982 8:27514756-27514778 TTCCTCTGCTTGGGAGACACTGG + Intronic
1039915622 8:41858437-41858459 TCTCGCTACATGGGAAACACTGG + Intronic
1040347228 8:46516581-46516603 CCCAATTTCTTGGGAAACACAGG + Intergenic
1042717759 8:71793468-71793490 TTCCACTCCTAGGGATAAACAGG - Intergenic
1044711977 8:95067298-95067320 GCCCTCTCCTTGGGACACAAAGG - Intronic
1044712329 8:95070075-95070097 GCCCTCTCCTTGGGACACAAAGG - Intronic
1047593878 8:126356624-126356646 TCCCACACTTTGGGAGACAGAGG - Intergenic
1047910780 8:129526985-129527007 GCCCACTCACTGTGAAACACTGG - Intergenic
1048209659 8:132444149-132444171 TCACACCCCTTGGGAAATAGGGG - Intronic
1049456445 8:142693414-142693436 TTCCAAGCCTTGGGACACACAGG - Intergenic
1050624068 9:7485066-7485088 TCCCACACTTTGAGAACCACTGG - Intergenic
1050724747 9:8636091-8636113 TCACACTACTTGTAAAACACAGG + Intronic
1055895828 9:81174561-81174583 TCCCACTCCTTGGGAGGCTGAGG + Intergenic
1056174822 9:84023904-84023926 TGCCAGTTCTTGGGAACCACTGG + Intergenic
1058173876 9:101715303-101715325 TCCCATTACATGGGAAATACTGG + Intronic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1059464620 9:114460058-114460080 TCCCACCCCTGGGGAAACTCAGG + Intronic
1060142115 9:121219346-121219368 TCCCACACCTTGGGAAGCCAAGG - Intronic
1061885600 9:133589757-133589779 TCCCGCCCCCTGGGAAACACTGG - Intergenic
1203574711 Un_KI270744v1:166390-166412 ACCCACTCTTTGGGGGACACAGG - Intergenic
1203654415 Un_KI270752v1:8977-8999 TCCCAGTCCTAGGGAGGCACAGG + Intergenic
1186873965 X:13798905-13798927 TCCCCCGGATTGGGAAACACTGG + Intronic
1186887158 X:13925440-13925462 TCCAGCTACTTGGGAAACAGAGG - Intronic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1192239696 X:69319380-69319402 CCCTAGTCCTTGGGAAACTCAGG + Intergenic
1192275979 X:69631440-69631462 CCCCGCTCCTTGAGAATCACTGG + Intronic
1192539118 X:71953287-71953309 TCCCACTCTCTGGGGGACACAGG - Intergenic
1198506368 X:137305031-137305053 TCCCTCTCTTTTGGAAACAAAGG + Intergenic
1198717999 X:139582960-139582982 TCCCACACTTTGGGAATCTCAGG - Intronic
1199716393 X:150510061-150510083 GCCCACCCCTTTGGGAACACTGG - Intronic
1199991560 X:152990251-152990273 TCCCAAGCCCTGGGAAACATAGG - Exonic
1200114376 X:153763716-153763738 TTCCAGTCGGTGGGAAACACTGG + Intergenic