ID: 1133268868

View in Genome Browser
Species Human (GRCh38)
Location 16:4600649-4600671
Sequence GGACCCCCATGCTGACCCAG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 147}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133268863_1133268868 7 Left 1133268863 16:4600619-4600641 CCCTGGATAGAGGGGAGGGGTCT 0: 1
1: 0
2: 3
3: 15
4: 189
Right 1133268868 16:4600649-4600671 GGACCCCCATGCTGACCCAGTGG 0: 1
1: 0
2: 0
3: 13
4: 147
1133268855_1133268868 25 Left 1133268855 16:4600601-4600623 CCAGAAAGGGTGCTGGGGCCCTG 0: 1
1: 0
2: 3
3: 33
4: 265
Right 1133268868 16:4600649-4600671 GGACCCCCATGCTGACCCAGTGG 0: 1
1: 0
2: 0
3: 13
4: 147
1133268864_1133268868 6 Left 1133268864 16:4600620-4600642 CCTGGATAGAGGGGAGGGGTCTG 0: 1
1: 0
2: 3
3: 25
4: 464
Right 1133268868 16:4600649-4600671 GGACCCCCATGCTGACCCAGTGG 0: 1
1: 0
2: 0
3: 13
4: 147
1133268854_1133268868 26 Left 1133268854 16:4600600-4600622 CCCAGAAAGGGTGCTGGGGCCCT 0: 1
1: 0
2: 1
3: 24
4: 251
Right 1133268868 16:4600649-4600671 GGACCCCCATGCTGACCCAGTGG 0: 1
1: 0
2: 0
3: 13
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133268868 Original CRISPR GGACCCCCATGCTGACCCAG TGG Exonic