ID: 1133270911

View in Genome Browser
Species Human (GRCh38)
Location 16:4610425-4610447
Sequence GCTTATACACAGAACTAGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 97}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133270896_1133270911 19 Left 1133270896 16:4610383-4610405 CCCCGCCTGCACCAGCGCCCTCG 0: 1
1: 0
2: 1
3: 16
4: 261
Right 1133270911 16:4610425-4610447 GCTTATACACAGAACTAGCTCGG 0: 1
1: 0
2: 0
3: 4
4: 97
1133270906_1133270911 2 Left 1133270906 16:4610400-4610422 CCCTCGTACACCGGGGCCAGGGG 0: 1
1: 0
2: 1
3: 2
4: 75
Right 1133270911 16:4610425-4610447 GCTTATACACAGAACTAGCTCGG 0: 1
1: 0
2: 0
3: 4
4: 97
1133270908_1133270911 1 Left 1133270908 16:4610401-4610423 CCTCGTACACCGGGGCCAGGGGC 0: 1
1: 0
2: 1
3: 10
4: 108
Right 1133270911 16:4610425-4610447 GCTTATACACAGAACTAGCTCGG 0: 1
1: 0
2: 0
3: 4
4: 97
1133270899_1133270911 14 Left 1133270899 16:4610388-4610410 CCTGCACCAGCGCCCTCGTACAC 0: 1
1: 0
2: 0
3: 5
4: 81
Right 1133270911 16:4610425-4610447 GCTTATACACAGAACTAGCTCGG 0: 1
1: 0
2: 0
3: 4
4: 97
1133270897_1133270911 18 Left 1133270897 16:4610384-4610406 CCCGCCTGCACCAGCGCCCTCGT 0: 1
1: 0
2: 2
3: 30
4: 259
Right 1133270911 16:4610425-4610447 GCTTATACACAGAACTAGCTCGG 0: 1
1: 0
2: 0
3: 4
4: 97
1133270903_1133270911 8 Left 1133270903 16:4610394-4610416 CCAGCGCCCTCGTACACCGGGGC 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1133270911 16:4610425-4610447 GCTTATACACAGAACTAGCTCGG 0: 1
1: 0
2: 0
3: 4
4: 97
1133270898_1133270911 17 Left 1133270898 16:4610385-4610407 CCGCCTGCACCAGCGCCCTCGTA 0: 1
1: 0
2: 0
3: 11
4: 123
Right 1133270911 16:4610425-4610447 GCTTATACACAGAACTAGCTCGG 0: 1
1: 0
2: 0
3: 4
4: 97
1133270909_1133270911 -8 Left 1133270909 16:4610410-4610432 CCGGGGCCAGGGGCTGCTTATAC 0: 1
1: 0
2: 1
3: 11
4: 165
Right 1133270911 16:4610425-4610447 GCTTATACACAGAACTAGCTCGG 0: 1
1: 0
2: 0
3: 4
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133270911 Original CRISPR GCTTATACACAGAACTAGCT CGG Intronic
903572824 1:24319002-24319024 ACTTATACAAAGATCTACCTGGG + Intergenic
905417757 1:37816001-37816023 GCCTATGCAGAGGACTAGCTTGG + Intronic
909208290 1:72789738-72789760 TCTTATACATAGCCCTAGCTAGG - Intergenic
911390948 1:97241832-97241854 GCTTATACACATTATAAGCTAGG - Intronic
916923963 1:169498249-169498271 ACATATACACAGACCTAGCTGGG - Intergenic
918569118 1:185967304-185967326 TCTTAAACCCAGAAATAGCTTGG + Intronic
920167608 1:204046673-204046695 GCTTATCCATAGAGCTCGCTGGG + Intergenic
1065839153 10:29686261-29686283 GCTGTCACACAGAACAAGCTGGG + Intronic
1069066073 10:63943024-63943046 GCTTATACACAAAATTGGCCTGG + Intergenic
1071832725 10:89388081-89388103 GCTTATAAACAAAACTAACATGG + Intronic
1077915967 11:6611867-6611889 GGGTATAGACAGACCTAGCTGGG - Intronic
1080197940 11:29633422-29633444 GCAGATACAAAGAAGTAGCTTGG - Intergenic
1081354230 11:42093195-42093217 GCTTATGCATTGAATTAGCTAGG - Intergenic
1085925631 11:81016841-81016863 ACTTATATAAAGAACTGGCTTGG + Intergenic
1086853690 11:91841093-91841115 GCTAAAACACAGAAATAGCTTGG + Intergenic
1087358494 11:97125552-97125574 GCTTATACACAAGATGAGCTTGG - Intergenic
1088331407 11:108656745-108656767 ACTTAAACAAAGAACTGGCTGGG + Intergenic
1089654833 11:119939761-119939783 GCTTCTCCACATAGCTAGCTGGG - Intergenic
1099051853 12:77790403-77790425 CCTTATACCCAGAACAATCTAGG - Intergenic
1100143951 12:91654322-91654344 GCTTATAAACAGAACTGACTTGG - Intergenic
1103511066 12:121474655-121474677 GCTTAGATACAAAAATAGCTGGG + Intronic
1106481894 13:30143160-30143182 GCTTGTACACAGACCCAGCAAGG + Intergenic
1106609105 13:31261564-31261586 GAATATACACACAAATAGCTAGG - Intronic
1113939068 13:114009124-114009146 GCTCAGACACAGAACAAGATGGG + Intronic
1114709621 14:24765480-24765502 GCTTATAAACAGAAGTTGGTGGG + Intergenic
1116224426 14:42130899-42130921 GTTTAAACACAGAAATAGCAAGG + Intergenic
1116700133 14:48230672-48230694 GCTAATACTAAGAACAAGCTTGG - Intergenic
1118218269 14:63830057-63830079 GCTGATACATAGAACAAGATGGG + Intergenic
1118893452 14:69927513-69927535 GCTAATACAAAAAATTAGCTGGG + Intronic
1119366931 14:74100902-74100924 GCATAAAAACAGAATTAGCTGGG - Intronic
1125364317 15:38897647-38897669 GCTTCTAGACATAAATAGCTCGG + Intergenic
1126555398 15:49982327-49982349 GTCTATACACAGCAGTAGCTAGG - Intronic
1126596448 15:50388582-50388604 GCTTATACTCTGCACTAGGTAGG - Intergenic
1133270911 16:4610425-4610447 GCTTATACACAGAACTAGCTCGG + Intronic
1135481520 16:22824590-22824612 GCTTATACACAGGGCTGGGTAGG + Intronic
1137277798 16:46948343-46948365 GCTTAAAAACAAAACAAGCTGGG - Intergenic
1158102149 18:53841505-53841527 GCTTATAAACAGGAATATCTTGG + Intergenic
1158341219 18:56468710-56468732 AATTATACACAGAAGTGGCTGGG - Intergenic
1158799810 18:60893124-60893146 ACATACACACAAAACTAGCTGGG - Intergenic
1160482625 18:79256362-79256384 TCTTATAAACAGCATTAGCTAGG + Intronic
1168022762 19:53621622-53621644 GCTAATACAAAAAATTAGCTGGG + Intergenic
925071348 2:970210-970232 GCTTATCCACACAATTAGGTAGG - Intronic
930394913 2:50809655-50809677 GATTATCCACAGAAGTAGTTGGG - Intronic
933367139 2:81367367-81367389 ATTTAAGCACAGAACTAGCTTGG + Intergenic
934877191 2:97934511-97934533 GCTTATACAAAAAATTAGATAGG + Intronic
943380355 2:187137098-187137120 GCATAGACATAGAACTAACTAGG + Intergenic
1168963661 20:1886008-1886030 GCTTTTACTCAGAACCAGATGGG - Intergenic
1169485952 20:6032857-6032879 GCTTCTATACAGAACTCCCTGGG + Intronic
1179503932 21:41827508-41827530 GCTTCTACAAAAAATTAGCTGGG - Intronic
1180556551 22:16582779-16582801 GCTTATGTACACAATTAGCTGGG + Intergenic
949273335 3:2247154-2247176 GCTTATCAACAGAATTCGCTGGG - Intronic
949432178 3:3989620-3989642 GCTTTTACACAGACCTATCATGG + Intronic
956041772 3:65152456-65152478 ACTAATATACAGAACTACCTTGG - Intergenic
957730536 3:84127881-84127903 GCTAAGACACAGAACAAGGTAGG - Intergenic
958796247 3:98709438-98709460 CATTATACACAGTACTATCTAGG + Intergenic
961404804 3:126671300-126671322 GCTAATACACAATACTAGGTGGG - Intergenic
963375238 3:144456037-144456059 GCTTATACAGAAATCTATCTAGG - Intergenic
965058074 3:163747580-163747602 GAATATATACATAACTAGCTTGG + Intergenic
966022567 3:175233653-175233675 GCTTAAGCACAGGACTAGCCAGG - Intronic
967320919 3:188194299-188194321 GGTGATACACAGAAATATCTGGG - Intronic
967723987 3:192844552-192844574 GCTTGTACACAGAAGTGGATGGG - Intronic
971864786 4:32155504-32155526 TCTTCAACACAGAACTATCTTGG + Intergenic
980610737 4:135159058-135159080 GCAAATACAGAGAACTAGTTTGG - Intergenic
980842006 4:138274868-138274890 ACTTAAACACATAATTAGCTTGG - Intergenic
983513572 4:168634048-168634070 GTTTATGCTCAGAACAAGCTCGG + Intronic
983852752 4:172602908-172602930 GCTGATACACAGAACAATATGGG + Intronic
984570278 4:181383760-181383782 GCTTTTACACTGAACGAGATGGG - Intergenic
985929804 5:3048089-3048111 GTTTAAACACAGAACTAGGCAGG - Intergenic
986619942 5:9661914-9661936 GCTGATACACAGAACTGGGAGGG - Intronic
991343286 5:65635868-65635890 ACTTATATAAAGAAATAGCTGGG - Intronic
992096511 5:73367933-73367955 GCTCATGCACAGGAGTAGCTGGG - Intergenic
998229181 5:140348499-140348521 GCTGACACACAAACCTAGCTGGG - Intergenic
999828743 5:155299125-155299147 CCTGACACACAGAACTTGCTTGG + Intergenic
1002843988 6:929829-929851 GCTAATACACAAAACTCACTTGG + Intergenic
1008557993 6:52694021-52694043 CCTTCTTCACAGGACTAGCTTGG - Intergenic
1012407997 6:98923036-98923058 CCTTCTTCACAGAACTACCTTGG + Intronic
1013341937 6:109223521-109223543 GGTTCTACACAGGCCTAGCTGGG - Intergenic
1016732058 6:147437690-147437712 GCTCAAACACAGAATTAGCCAGG - Intergenic
1017966045 6:159267170-159267192 GCATATACACAGAAATTGCTAGG - Intronic
1023581416 7:41688065-41688087 GCTTTTACTCTGAACTAGGTGGG - Exonic
1024186539 7:46953883-46953905 GCATATAGACAGATATAGCTTGG + Intergenic
1025150190 7:56541360-56541382 GCTGATACACAGAAAAGGCTGGG + Intergenic
1026373330 7:69724047-69724069 GCTTATACTCAGAAATACCATGG - Intronic
1027581215 7:79997967-79997989 GTTTCAACACAAAACTAGCTTGG - Intergenic
1029667475 7:102005124-102005146 GCTTCTACCCAGAAGTACCTGGG + Intronic
1031625172 7:123984420-123984442 GCTCTTAAACAGAACTACCTGGG + Intergenic
1038763173 8:30403629-30403651 GTGTATACACAGATTTAGCTAGG - Intronic
1042868954 8:73380308-73380330 GCTTTTACTCAGAACAAGATGGG - Intergenic
1044378942 8:91510094-91510116 GCTCATACACAGAAAAAGATAGG - Intergenic
1047805188 8:128352012-128352034 GCTTATAGGTAGAACAAGCTAGG - Intergenic
1050736488 9:8769033-8769055 GCTAACACACAGAATTAGGTGGG - Intronic
1057934959 9:99229511-99229533 GCTTGTACAAAAAACTAGCCAGG - Intronic
1186279188 X:7974521-7974543 GCTTTCTCACAGAACTACCTTGG - Intergenic
1187096888 X:16158127-16158149 CCTCAGACACAGAACTAGGTGGG - Intergenic
1187545580 X:20248641-20248663 GTTTATACAAAAAATTAGCTGGG - Intronic
1189015755 X:37094868-37094890 GTGTATACACAGATTTAGCTAGG - Intergenic
1189227781 X:39427751-39427773 GCATAAACACAGAGCCAGCTAGG + Intergenic
1189273123 X:39765679-39765701 GCTTATATACAGAACCATCAAGG + Intergenic
1202162880 Y:21953779-21953801 GCTTATACACAGAGCGAAATGGG - Intergenic
1202228476 Y:22632589-22632611 GCTTATACACAGAGCGAAATGGG + Intergenic
1202314681 Y:23563587-23563609 GCTTATACACAGAGCGAAATGGG - Intergenic
1202556120 Y:26107006-26107028 GCTTATACACAGAGCGAAATGGG + Intergenic