ID: 1133271707

View in Genome Browser
Species Human (GRCh38)
Location 16:4613738-4613760
Sequence TGTGCTGCCCAGAGGCTACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 239}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133271707_1133271719 21 Left 1133271707 16:4613738-4613760 CCAGGTAGCCTCTGGGCAGCACA 0: 1
1: 0
2: 2
3: 24
4: 239
Right 1133271719 16:4613782-4613804 ATGGGTTAGGAGAGGCCCGGGGG 0: 1
1: 0
2: 1
3: 13
4: 175
1133271707_1133271714 13 Left 1133271707 16:4613738-4613760 CCAGGTAGCCTCTGGGCAGCACA 0: 1
1: 0
2: 2
3: 24
4: 239
Right 1133271714 16:4613774-4613796 ACTGTCCTATGGGTTAGGAGAGG 0: 1
1: 0
2: 1
3: 8
4: 136
1133271707_1133271720 26 Left 1133271707 16:4613738-4613760 CCAGGTAGCCTCTGGGCAGCACA 0: 1
1: 0
2: 2
3: 24
4: 239
Right 1133271720 16:4613787-4613809 TTAGGAGAGGCCCGGGGGAGTGG 0: 1
1: 0
2: 0
3: 28
4: 373
1133271707_1133271718 20 Left 1133271707 16:4613738-4613760 CCAGGTAGCCTCTGGGCAGCACA 0: 1
1: 0
2: 2
3: 24
4: 239
Right 1133271718 16:4613781-4613803 TATGGGTTAGGAGAGGCCCGGGG 0: 1
1: 0
2: 0
3: 8
4: 91
1133271707_1133271712 3 Left 1133271707 16:4613738-4613760 CCAGGTAGCCTCTGGGCAGCACA 0: 1
1: 0
2: 2
3: 24
4: 239
Right 1133271712 16:4613764-4613786 CAGGAGCACTACTGTCCTATGGG 0: 1
1: 0
2: 0
3: 7
4: 90
1133271707_1133271716 18 Left 1133271707 16:4613738-4613760 CCAGGTAGCCTCTGGGCAGCACA 0: 1
1: 0
2: 2
3: 24
4: 239
Right 1133271716 16:4613779-4613801 CCTATGGGTTAGGAGAGGCCCGG 0: 1
1: 0
2: 0
3: 15
4: 157
1133271707_1133271711 2 Left 1133271707 16:4613738-4613760 CCAGGTAGCCTCTGGGCAGCACA 0: 1
1: 0
2: 2
3: 24
4: 239
Right 1133271711 16:4613763-4613785 CCAGGAGCACTACTGTCCTATGG 0: 1
1: 0
2: 3
3: 29
4: 167
1133271707_1133271721 27 Left 1133271707 16:4613738-4613760 CCAGGTAGCCTCTGGGCAGCACA 0: 1
1: 0
2: 2
3: 24
4: 239
Right 1133271721 16:4613788-4613810 TAGGAGAGGCCCGGGGGAGTGGG 0: 1
1: 0
2: 0
3: 13
4: 264
1133271707_1133271713 8 Left 1133271707 16:4613738-4613760 CCAGGTAGCCTCTGGGCAGCACA 0: 1
1: 0
2: 2
3: 24
4: 239
Right 1133271713 16:4613769-4613791 GCACTACTGTCCTATGGGTTAGG 0: 1
1: 0
2: 0
3: 7
4: 77
1133271707_1133271717 19 Left 1133271707 16:4613738-4613760 CCAGGTAGCCTCTGGGCAGCACA 0: 1
1: 0
2: 2
3: 24
4: 239
Right 1133271717 16:4613780-4613802 CTATGGGTTAGGAGAGGCCCGGG 0: 1
1: 0
2: 1
3: 10
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133271707 Original CRISPR TGTGCTGCCCAGAGGCTACC TGG (reversed) Intronic
900565871 1:3331629-3331651 TTTGCTGCCCAGAGGAATCCTGG + Intronic
901149939 1:7094692-7094714 TGTGCTACACGGAGGCTCCCAGG + Intronic
901699566 1:11037808-11037830 TGCGCTGCGCAGAGGAAACCAGG + Exonic
904823796 1:33261839-33261861 TCTGCTACCCAGAGGCCAACAGG + Intronic
905467485 1:38166443-38166465 TGTCTTGCCCAGAGGCATCCTGG + Intergenic
905524626 1:38626867-38626889 TGTCCTGCACATAGGCCACCAGG + Intergenic
907745880 1:57213063-57213085 TGTGCTGCCCAGGGCCCAGCTGG + Intronic
908216426 1:61958694-61958716 TGTGATCCCCAGGGGTTACCTGG + Intronic
910243684 1:85115884-85115906 TGTGCTGACCAGTTCCTACCAGG + Intronic
910505653 1:87947452-87947474 TGTGATTACCGGAGGCTACCAGG + Intergenic
913489810 1:119368406-119368428 TGTCCTGCCCATGGGCTCCCAGG + Intergenic
915595602 1:156894791-156894813 TGTGCTGGCCTGAGGTTCCCAGG + Intronic
916107500 1:161442070-161442092 TGCGCTGCCCAGAGGCGTCCTGG + Intergenic
916109084 1:161449488-161449510 TGCGCTGCCCAGAGGCGTCCTGG + Intergenic
916110672 1:161456869-161456891 TGCGCTGCCCAGAGGCGTCCTGG + Intergenic
916112257 1:161464279-161464301 TGCGCTGCCCAGAGGCGTCCTGG + Intergenic
916113844 1:161471660-161471682 TGCGCTGCCCAGAGGCGTCCTGG + Intergenic
919090819 1:192977275-192977297 TGTGCTGCCCGGTTGCTAACAGG - Intergenic
919615250 1:199799268-199799290 TGTGCAGCCCAGTTGCTAACAGG - Intergenic
919749191 1:201025968-201025990 TCTGCTGCTCAGAGGCTAGATGG + Intergenic
920045673 1:203130582-203130604 TGTGCAGCCCAGCAGCAACCTGG - Intronic
920227041 1:204446592-204446614 TGTGCTGCTGAGAGGCCTCCTGG + Intronic
921645274 1:217607631-217607653 TGTTGTGACCAGAGGCTTCCAGG + Intronic
921703180 1:218290371-218290393 TGTTCTGACCAGAGGCTCACAGG - Intronic
922925000 1:229341413-229341435 TTTCCTGCCCAGAGGCTTGCAGG - Intronic
1062978938 10:1705745-1705767 TGTGCTGCTCTGAGGGTTCCAGG + Intronic
1064970031 10:21055925-21055947 TGGGCTGCCCTGAGGCTACACGG + Intronic
1065630631 10:27677200-27677222 TGTGCTGCACACAGGAAACCTGG + Intronic
1067454478 10:46408017-46408039 TGTCCTCCCCAGTGGCTACCAGG + Intergenic
1067632724 10:47976615-47976637 TGTCCTCCCCAGTGGCTACCAGG - Intergenic
1069302454 10:66925754-66925776 TGTGCTGCCCAGAGTTTTTCTGG - Intronic
1069401571 10:68053201-68053223 TGTTCTGACCAGAGGCTTGCAGG - Intronic
1069878218 10:71576073-71576095 GGGGCTGCCCAGAGGCCCCCTGG - Intronic
1070922458 10:80196685-80196707 AGTGCTGCCCTGAGGCTGGCTGG - Intronic
1072610073 10:97011894-97011916 AGTGCTCTCCAGAGGCTTCCTGG - Intronic
1075542473 10:123326727-123326749 TGTTGTGCCCAGAGGCTGGCAGG + Intergenic
1076656799 10:132029681-132029703 TGTGCTTCACAGGGGCCACCTGG - Intergenic
1076877064 10:133221129-133221151 TCTGCAGCACAGAGGCTGCCCGG + Intronic
1076939205 10:133590493-133590515 GGGGCTGCCCAGAGGGCACCAGG + Intergenic
1077192752 11:1262312-1262334 TGGCCTTCCCAGAGGCTTCCTGG - Intergenic
1080408170 11:31998483-31998505 GGTGCTGCCCAGCCTCTACCTGG - Intronic
1081695861 11:45108658-45108680 TGTGGTGCCCAGAGGCACCAGGG + Intronic
1083665436 11:64271668-64271690 TGTGCTGCCCAGAGGTTGGGGGG + Exonic
1084530887 11:69727144-69727166 GGTGCTGCCCAGGAGCTCCCGGG + Intergenic
1085196132 11:74672923-74672945 TGTGCTGCCCAGAGAAACCCAGG + Intergenic
1086087023 11:82966037-82966059 TGTGCTGCACAGAGGCAAGCAGG - Intronic
1088747645 11:112817746-112817768 TGAGCAGCTCAGAGGCTCCCAGG - Intergenic
1089190393 11:116649237-116649259 TGTGCTGCCCTGTGGCTCCAAGG + Intergenic
1089338994 11:117744949-117744971 CGTGCTGCCCAGAGGGTAGGTGG + Intronic
1089340813 11:117756153-117756175 TGTGGGGCACAGAGGCTGCCTGG + Intronic
1089780341 11:120869328-120869350 TGTGAAGCCCAGAGCCTACGGGG + Intronic
1090307226 11:125702066-125702088 AGACCTGCCCAGAGGCTGCCTGG + Intergenic
1091589720 12:1836054-1836076 CGTGCTGCCCAGAGGCTCCCAGG + Exonic
1091794457 12:3289769-3289791 TTTGCAGCCCAGAGACTACCAGG + Intergenic
1092016701 12:5165387-5165409 TCTGCTGCCCACAGACTGCCTGG + Intergenic
1093308202 12:17544820-17544842 TGTGCTCCCCAGAGCCTACGAGG - Intergenic
1093457920 12:19382734-19382756 TGTGATGCCCTGAGCCTCCCTGG - Intergenic
1097036242 12:56126345-56126367 TCTGCTGCCCAGGTGCCACCTGG - Exonic
1099696434 12:86027189-86027211 TGTGCTTCCCAGAGGTCTCCAGG - Intronic
1099826234 12:87780599-87780621 TGTGCTGCACAGCTGCTGCCAGG + Intergenic
1101837295 12:108304382-108304404 TCTGCTGCCCAGATGGTCCCCGG - Intronic
1103700524 12:122846756-122846778 GGGGCGGCCCAGAGGCTGCCTGG + Intronic
1104492189 12:129203776-129203798 TCTGCTGCCCATATGCTCCCTGG - Intronic
1104864812 12:131946915-131946937 GGTGCTGCCCAGTGGCAACACGG - Intergenic
1104924315 12:132306077-132306099 TGTGGTCCCCACAGGCTCCCAGG - Intronic
1104984730 12:132590199-132590221 TGGGCGGCCCAGAGGCTGCATGG + Intergenic
1105544660 13:21342697-21342719 TGTGCTGGCCAGAGGCCAAGTGG - Intergenic
1106076251 13:26463927-26463949 TGTGCTGCCAAGAGGCTTGCTGG - Intergenic
1106464663 13:30002287-30002309 TGTGATTCCCAGAGGCTGGCTGG + Intergenic
1106575535 13:30970983-30971005 GGTGCTGCCCTGAGGGAACCAGG - Intronic
1113248806 13:108428660-108428682 TGGACTGCCCAGAGGCTAAAAGG + Intergenic
1114648624 14:24269482-24269504 TGTGCTGCTCAAAGGTAACCAGG - Exonic
1115202569 14:30870476-30870498 TGTGCTGCCCAGTTGCCAACAGG - Intergenic
1117140563 14:52786742-52786764 TGTGCTGCACAGAAGCCCCCTGG - Intronic
1117233869 14:53751532-53751554 TGTGCTGCACAGCTGCTGCCAGG - Intergenic
1117453790 14:55877715-55877737 TCTGTTGCTGAGAGGCTACCTGG + Intergenic
1117550619 14:56832547-56832569 TTTGCTGCCCAGTGCCCACCAGG - Intergenic
1121731365 14:96189402-96189424 CGGGCTGCCCAGAGCCTCCCAGG - Intergenic
1122345683 14:101058344-101058366 TGTGCTGGCTAGAGGCTCCAAGG - Intergenic
1122930233 14:104929777-104929799 TGAGCTGCCCAGAGGGATCCTGG + Intronic
1123631161 15:22260447-22260469 TGTGCTGCGCAGAGGGTCCTAGG + Intergenic
1123996890 15:25725032-25725054 TGTGCTGCCCAGTTCCTAACAGG - Intronic
1124171761 15:27380722-27380744 TGTGGTGCTCAGGGGCTACGGGG + Intronic
1124635546 15:31362402-31362424 TGTGCTGGGCAGTGGCTTCCAGG - Intronic
1125031224 15:35078222-35078244 TGCTCAGCCCAGAGGCCACCTGG - Intergenic
1127930667 15:63595210-63595232 TGTGCTGGTCAGAGGCTGCGTGG + Intergenic
1129376651 15:75137989-75138011 TGTGCTGCCTGGAGGCAGCCAGG - Intergenic
1129657110 15:77531632-77531654 TGCTCAGCCCAGAGGCAACCGGG + Intergenic
1132333480 15:101028202-101028224 TGTGGTGACCAGAGGCTCGCAGG - Intronic
1132582037 16:689217-689239 CGTGCTGCTCAGTGGCTCCCAGG - Exonic
1132687680 16:1169118-1169140 TGTGCATCCCAGAGCCTGCCTGG + Intronic
1132890197 16:2199950-2199972 TGTGCCGCCCAGAGGCCCCACGG + Intergenic
1133271707 16:4613738-4613760 TGTGCTGCCCAGAGGCTACCTGG - Intronic
1134331452 16:13254850-13254872 GGTGTTGCCCAGAGGCGACGTGG + Intergenic
1134623634 16:15708572-15708594 TGTGCTGCCCAGAGGCAGGAAGG + Intronic
1135256009 16:20942147-20942169 AGTGCTGCCCTGAAGCTACCTGG - Intronic
1135762607 16:25149100-25149122 TGGGCTGGCCAGAGGCAACAAGG + Intronic
1138601872 16:58060418-58060440 TGTGATGCCAAGTGGCCACCAGG + Intergenic
1139937881 16:70584297-70584319 TGAGCTTCCCAGGGGCTGCCTGG + Intronic
1141275515 16:82584302-82584324 TGGGCTGCCAAGAGGCTCACAGG - Intergenic
1141627292 16:85268029-85268051 GGCACTGCCCAGAGGCTGCCAGG + Intergenic
1142195315 16:88736851-88736873 TGTTCTGCCCATAGCCCACCGGG - Intronic
1143351354 17:6290651-6290673 GATGCTGCCCAGAGGTTATCAGG + Intergenic
1144082098 17:11772788-11772810 TCTCCTGTCCAGAGGCAACCAGG + Intronic
1144729206 17:17517061-17517083 TGTGCTGCGGGGAGGCCACCAGG + Intronic
1146289208 17:31596137-31596159 TCTGCTGGACAGAGTCTACCAGG + Intergenic
1146479468 17:33193370-33193392 TGTGCTGCCATCAGGCTGCCTGG + Intronic
1147322646 17:39655761-39655783 TGTGTTGCCCAGTGGTTACAAGG + Intronic
1148092209 17:45029430-45029452 TCTGCTACCCAGAAGCTTCCCGG - Intronic
1150266868 17:63837713-63837735 TGTGCTGCTCAGGCCCTACCTGG - Intronic
1150777717 17:68094902-68094924 AGTGTTGCCAAGAGGGTACCAGG + Intergenic
1151889625 17:76944455-76944477 TGTGGGGCTCAGAGGCTCCCAGG + Intronic
1152719036 17:81913840-81913862 TGGGCTGCCCTGAAGCTACATGG - Exonic
1153357109 18:4149573-4149595 TGTGCAGCCCAGTTCCTACCAGG - Intronic
1155971978 18:32091977-32091999 TGCGCTGCCTACAGCCTACCCGG - Exonic
1156432861 18:37094244-37094266 TGTGTGGCCCAGTGGCTAACAGG + Intronic
1156514316 18:37667208-37667230 TGAGCTGCCCAGAGTCGTCCTGG - Intergenic
1156825303 18:41424050-41424072 TGTGCTGCTCAGAGGCAAAATGG - Intergenic
1158177469 18:54673567-54673589 TGTGCGGCCCAGTTCCTACCAGG - Intergenic
1160371819 18:78378489-78378511 TGTGCTGCTCAGAAGGTAGCCGG + Intergenic
1160625168 18:80199189-80199211 TGTTGTGACCAGAGGCTAACAGG - Intronic
1161971971 19:7587206-7587228 TTTGCTGCCCAGACTCTCCCTGG - Intergenic
1162276414 19:9658998-9659020 TGTGCTGCCCAGAGACCAATGGG - Intronic
1162801758 19:13115260-13115282 TGTGATGCCCAGAACCTACCGGG + Exonic
1163235315 19:16026258-16026280 TGTGCTGCCCAGAGGCTTCGAGG + Intergenic
1163444386 19:17338214-17338236 TGCGCGGTCCAGAGGCTCCCCGG - Exonic
1163709475 19:18837779-18837801 TGTGACTCCCACAGGCTACCAGG - Intronic
1166546943 19:43639643-43639665 TCTGCGGCCCCGAGGCTGCCGGG + Intronic
1166678345 19:44753336-44753358 GGTGCTTGCCAGAGGCCACCCGG + Intronic
1167433980 19:49468596-49468618 TCTGCTGCCCTGAGGCTACGGGG - Intronic
1167611628 19:50510589-50510611 TGTGCTGCCAGGAGACTGCCAGG - Intronic
928183766 2:29090810-29090832 TGTGATGCCCAGAGGCACACAGG + Intergenic
928189948 2:29154880-29154902 ACTTCTGCCCAGAGGCTACATGG + Intronic
928317230 2:30255701-30255723 TGTGGTGCTCTGAGGATACCCGG - Intronic
929589149 2:43133991-43134013 GCTGCTGCCCAGGGCCTACCAGG - Intergenic
929824567 2:45300094-45300116 TGTGCTGCCAAGAGTATAACAGG - Intergenic
934758937 2:96842828-96842850 TCATCTGCCCTGAGGCTACCTGG - Intronic
935788801 2:106571947-106571969 ACTGCTGCCCACAGGATACCAGG - Intergenic
936460261 2:112709146-112709168 TGTGCTGCCCAGAACCCCCCAGG + Intergenic
937953650 2:127407382-127407404 CCTGCTGGCCAGAGGCTTCCTGG - Intergenic
937968977 2:127535512-127535534 CATGCTGCCCGGAGGCCACCAGG - Intergenic
938628212 2:133135242-133135264 TGTGATGACCAGGTGCTACCAGG + Intronic
940290802 2:152075854-152075876 AGTGCTGCCCACAGTCTCCCTGG + Intronic
941325743 2:164111632-164111654 TGTGCGGCCCAGGTCCTACCAGG + Intergenic
942496718 2:176547704-176547726 AGTGCTGCCCAGAGTCCACTGGG - Intergenic
942929559 2:181473180-181473202 TGTGCAGCCCAGTTCCTACCAGG - Intronic
943818868 2:192292749-192292771 TGTGCGGCCCAGTGCCTAACAGG + Intergenic
946972644 2:225112328-225112350 TGAGATGGCCAGATGCTACCAGG - Intergenic
947422399 2:229952753-229952775 AGTGTTGCCAAGAGGGTACCAGG + Intronic
947534974 2:230934609-230934631 ACTCCTGCCCAGAGGTTACCAGG - Intronic
948489420 2:238302944-238302966 TCTGATGCCCAGAGGCGCCCAGG + Intergenic
1172098637 20:32472962-32472984 CCTGCTGCCCAGAGGCTGGCTGG - Intronic
1172497774 20:35401110-35401132 TGTTGTGACCAGAGGCTTCCAGG - Intronic
1173008335 20:39157968-39157990 TGTGCTGCACAGAGCACACCTGG - Intergenic
1173948260 20:46968747-46968769 TTTGCTGCCCAGAGGACACCTGG - Intronic
1174116661 20:48230982-48231004 GGTGCAGCCCACAGGCAACCTGG - Intergenic
1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG + Intronic
1175886925 20:62297356-62297378 TGGGGTGCCCGGAGGCCACCAGG - Intergenic
1176882738 21:14216539-14216561 AGGGCTTCCCAGAGGCTGCCTGG + Intronic
1179234015 21:39529184-39529206 TCTGCAGCCCAGAGGCCCCCAGG + Intergenic
1180163153 21:46006957-46006979 TGTGCAGCCCAGGGGTGACCCGG - Intergenic
1180198666 21:46212172-46212194 TGAGCTCCCCAGAGGCTCCCCGG - Intronic
1180625437 22:17190789-17190811 CGTTCTGCTCAGAGGCTCCCTGG - Intronic
1180975754 22:19847179-19847201 TGTGCTGACGACAGCCTACCTGG - Exonic
1181308492 22:21930743-21930765 TGTACTGACTAGAGGCTGCCTGG - Intronic
1183265760 22:36824167-36824189 AGTGCTGCCCAGAGGAACCCTGG + Intergenic
1184430453 22:44439076-44439098 TGTAATGCCCACAGGATACCTGG + Intergenic
950171130 3:10839710-10839732 TGCAATGCCCAGAGGCTACTGGG - Intronic
950487010 3:13279865-13279887 AGGGCTGCCCAGAGGCTAGGTGG - Intergenic
951613687 3:24520175-24520197 TGCTCTGGCCAGAGGCTTCCTGG + Intergenic
952162977 3:30714275-30714297 TGTGCTGCCCAGTTCCTAACAGG - Intergenic
952489679 3:33855946-33855968 TGTGCAGCCCAGTGCCTAACAGG - Intronic
952636968 3:35544679-35544701 GATGCAGCCCAGATGCTACCTGG - Intergenic
952936130 3:38399734-38399756 TGTGCTTGCCAAAGGGTACCTGG + Intronic
952969163 3:38640008-38640030 TATGCAGCCCAGATGCTCCCAGG + Intronic
953860863 3:46543132-46543154 TGTGGGGCCCAGAGTCTTCCTGG + Intronic
955733154 3:62008888-62008910 TGTGCGGCCCAGATCCTAACAGG + Intronic
956190731 3:66605755-66605777 TCTGATGTCCAAAGGCTACCAGG - Intergenic
956704060 3:71984107-71984129 TGTGATGCCCAGAGGAGACTGGG + Intergenic
958042205 3:88240415-88240437 TCTGATGCCCAGAAGCTAGCGGG + Intergenic
959709715 3:109373320-109373342 TGTTCTTCCTAGAGGCAACCAGG + Intergenic
960366196 3:116775830-116775852 TGTTGTGACCAGAGGCTTCCGGG + Intronic
961539063 3:127588282-127588304 TGTGTTTCCCACAGGCTCCCAGG + Intronic
961568887 3:127784391-127784413 GGTGCTGCTCAGAGGCTAAGTGG + Intronic
961621262 3:128226853-128226875 TGTGGTGCACAGAGGGTAGCTGG + Intronic
961942249 3:130650231-130650253 TGTGGTGCCAAGAGGCCAACTGG - Intronic
962574647 3:136745658-136745680 TGTGCAGCCCAGTTTCTACCAGG + Intronic
962842595 3:139249423-139249445 TGTGCAGCCCAGTGCCTAACAGG - Intronic
964286019 3:155119304-155119326 TATGATGCCCACTGGCTACCTGG - Intronic
968591576 4:1462318-1462340 TGAGCTGGCCCGAGGCTACCGGG + Intergenic
968871750 4:3246046-3246068 TGGGCTGTCCAGAGGGTACAGGG - Intronic
969876823 4:10141593-10141615 TGTGCTGCCTCGTGGCCACCAGG + Intergenic
970242714 4:14026072-14026094 TGTCCTGCCCAGAGTCAGCCAGG - Intergenic
971235768 4:24840891-24840913 TGTTGTGACCAGAGGCTTCCAGG + Intronic
971483729 4:27138678-27138700 TGTGCAGCCCAGTTCCTACCAGG - Intergenic
972622572 4:40762679-40762701 TGTGCTGCCCAGTTCCTAACAGG - Intronic
973784166 4:54319510-54319532 CTTTCTGCCCAAAGGCTACCTGG - Intergenic
977373491 4:96170418-96170440 TGTCCCGCCCAGAGACCACCTGG - Intergenic
978419442 4:108514531-108514553 TGTGCTGCCCAGTTCCTAACAGG + Intergenic
978846422 4:113278395-113278417 TTAGCTGCCCTGAAGCTACCAGG - Intronic
984191959 4:176616477-176616499 TGTGCTTCCCAGGGGCTATTTGG - Intergenic
984933576 4:184869918-184869940 TGTGCTGCCCTATGGGTACCGGG - Intergenic
985485790 5:147443-147465 AGAGCTGACCAGAGGTTACCTGG + Intronic
985692576 5:1321700-1321722 TGTGCTGCCCACAGCTGACCTGG - Intronic
987089988 5:14501870-14501892 TGTGCTTCCCAGGGGCTGCCTGG + Intronic
987816117 5:22902247-22902269 TGTGCTCCCCAGAGCCGAGCAGG - Intergenic
988135922 5:27171749-27171771 TGTGCGGCCCAGCGCCTAACAGG - Intergenic
990361767 5:55027956-55027978 TTTTCTGCCCACAGGGTACCTGG - Intronic
994043704 5:95285006-95285028 GGTGCTGCCCAGAGGGCGCCGGG - Intergenic
997658474 5:135572702-135572724 TGTGGTGGCCAGAAGCTCCCTGG + Intronic
999461141 5:151758483-151758505 TGTGCAGCCGAGAAGCAACCCGG + Intronic
999871737 5:155758521-155758543 TGTGCAGCCCAGTTGCTAACAGG - Intergenic
1003406957 6:5833859-5833881 TGTGCTGGCCAGAGGCCAAGTGG + Intergenic
1003560312 6:7174431-7174453 TGTGCTTCCAGGACGCTACCCGG + Intronic
1005898168 6:30195858-30195880 TGTGATCCCCAGAGGCTCCCGGG + Intronic
1006063173 6:31441152-31441174 TGTGTGGCCCTGAGGCTCCCGGG + Intergenic
1006067740 6:31474510-31474532 TGAGCTGCCCAAAAGCCACCAGG - Intergenic
1006385341 6:33727630-33727652 TGTGGTGCTCAGAGGGTCCCTGG - Intronic
1008397431 6:51025252-51025274 TGTGCTGCGGAGAGGCTCCTTGG - Intergenic
1009473312 6:64055976-64055998 TATGCTGCCCAGAGGCCCCTCGG + Intronic
1010141541 6:72620413-72620435 TCTGCTGCCCAGAGGCTTGGGGG + Intergenic
1011162111 6:84403057-84403079 TGTGCTGCCCAGCTGGTAACTGG - Intergenic
1012905248 6:105056658-105056680 TGTGCTGCACACATGCAACCTGG + Intronic
1013474975 6:110498795-110498817 TGTGATGCACTGAAGCTACCTGG + Intergenic
1016441108 6:144084529-144084551 TGTGCTGCCCAGTTCCTAACAGG - Intergenic
1019652656 7:2168816-2168838 CGTGGGGCCCAGAGGCCACCGGG + Intronic
1023537269 7:41226550-41226572 TGTGCAGCACAGAGGTTACCAGG + Intergenic
1023820106 7:43975864-43975886 TGTGCTGGGCAGGGGCTCCCTGG + Intergenic
1029748384 7:102529317-102529339 TGTGCTGGGCAGGGGCTCCCTGG + Intergenic
1029766331 7:102628404-102628426 TGTGCTGGGCAGGGGCTCCCTGG + Intronic
1031135801 7:117882778-117882800 TGTGCTGCCCAGTTCCTAACAGG + Intergenic
1031490399 7:122380825-122380847 TGTGCTCCCCAGAGGATAAATGG + Intronic
1032939022 7:136767531-136767553 TGTGCTGCACAGCCCCTACCAGG - Intergenic
1035081847 7:156222662-156222684 GGTGCTGCCTAGAAGCTACCTGG + Intergenic
1035543068 8:457196-457218 TGGGCGGGACAGAGGCTACCTGG - Intronic
1041648034 8:60273677-60273699 TGTGTGGCCCAGAGACTAACAGG + Intronic
1041727767 8:61033649-61033671 TGTTCTGCCCAAAAGCTCCCAGG - Intergenic
1042499008 8:69488882-69488904 TGCGGTGCCCTGAGGCTCCCCGG + Intronic
1047526657 8:125639732-125639754 TGTTCTGACCAGAGGCTCACAGG + Intergenic
1048481059 8:134793683-134793705 TGTGCAGCCCAGTGCCTAACAGG + Intergenic
1055805093 9:80084024-80084046 TGTGCGGCCCAGTGCCTAACAGG + Intergenic
1056690918 9:88808112-88808134 TGAGCAGTCCAGAGGCAACCTGG - Intergenic
1056993472 9:91432098-91432120 TGTCTTTCCCAGGGGCTACCGGG + Intergenic
1057230202 9:93317286-93317308 TGTGTGGCCTAGAGGCTATCAGG + Intronic
1057439137 9:95069776-95069798 TGTGCTGCTCAACTGCTACCAGG - Intronic
1057702848 9:97376267-97376289 TGTCCTGCCCAGAGACCAGCTGG + Intronic
1059151730 9:111955279-111955301 TGTGCTGCCCAGCTCCTAACAGG + Intergenic
1060850354 9:126869643-126869665 GGTCCTTCCCAGAAGCTACCTGG + Intronic
1062281413 9:135753590-135753612 TGTGCTGACAACAGGCTCCCAGG - Intronic
1062289659 9:135788857-135788879 TGAGCTCCCCTGAGGCTGCCAGG - Intronic
1186514173 X:10153933-10153955 AGTGCTGTCCAGAGGGTCCCAGG + Intergenic
1186660015 X:11660193-11660215 TGTGATGCCCAGGGGCTCCTTGG + Intronic
1189369730 X:40418094-40418116 TGTGCTGGACAAAGGCTACATGG + Intergenic
1191900141 X:66032495-66032517 TGTGCTGCTCAGAGCCAACCTGG + Exonic
1193794138 X:85852485-85852507 TGTGCTGCCCAGTTTCTAACAGG - Intergenic
1194743038 X:97598020-97598042 TTTGCTGACCACAGACTACCGGG + Intronic
1195625304 X:107000215-107000237 TGTACGGCCCAGAGGCAGCCCGG - Exonic
1195922376 X:109996388-109996410 TGTGCTGCCCAGTTCCTAACAGG + Intergenic
1199271117 X:145883591-145883613 TGTGCGGCCCAGTTGCTACCAGG + Intergenic
1200685001 Y:6250218-6250240 TGTGCTGACCAGAGTCTATACGG - Intergenic
1200995847 Y:9382076-9382098 TGTGCTGACCAGAGTCTATACGG - Intergenic
1200998511 Y:9402428-9402450 TGTGCTGACCAGAGTCTATACGG - Intergenic
1201001021 Y:9470958-9470980 TGTGCTGACCAGAGTCTATACGG - Intronic
1201003688 Y:9491286-9491308 TGTGCTGACCAGAGTCTATACGG - Intergenic
1201006344 Y:9511567-9511589 TGTGCTGACCAGAGTCTATACGG - Intergenic
1201693345 Y:16794167-16794189 TGTGCTGCCCAGTTTCTAACAGG - Intergenic