ID: 1133272031

View in Genome Browser
Species Human (GRCh38)
Location 16:4614977-4614999
Sequence GCCGGGCGCCCCGGGGGAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 547
Summary {0: 1, 1: 0, 2: 6, 3: 41, 4: 499}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133272018_1133272031 18 Left 1133272018 16:4614936-4614958 CCGGCGCCGCGGCATGCTGGGAT 0: 1
1: 0
2: 1
3: 4
4: 69
Right 1133272031 16:4614977-4614999 GCCGGGCGCCCCGGGGGAGCGGG 0: 1
1: 0
2: 6
3: 41
4: 499
1133272019_1133272031 12 Left 1133272019 16:4614942-4614964 CCGCGGCATGCTGGGATATGTAG 0: 1
1: 0
2: 0
3: 25
4: 114
Right 1133272031 16:4614977-4614999 GCCGGGCGCCCCGGGGGAGCGGG 0: 1
1: 0
2: 6
3: 41
4: 499
1133272014_1133272031 28 Left 1133272014 16:4614926-4614948 CCTCGCTCCGCCGGCGCCGCGGC 0: 1
1: 1
2: 4
3: 108
4: 710
Right 1133272031 16:4614977-4614999 GCCGGGCGCCCCGGGGGAGCGGG 0: 1
1: 0
2: 6
3: 41
4: 499
1133272015_1133272031 21 Left 1133272015 16:4614933-4614955 CCGCCGGCGCCGCGGCATGCTGG 0: 1
1: 0
2: 0
3: 6
4: 131
Right 1133272031 16:4614977-4614999 GCCGGGCGCCCCGGGGGAGCGGG 0: 1
1: 0
2: 6
3: 41
4: 499

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133272031 Original CRISPR GCCGGGCGCCCCGGGGGAGC GGG Intronic
900136612 1:1120355-1120377 GGCGGGCACCCCAGGGGTGCGGG + Intergenic
900226473 1:1535600-1535622 GCCGTGCGCGCCTGGAGAGCCGG - Exonic
900233479 1:1574712-1574734 GCCCGGCGCCCAGGGTGGGCGGG - Exonic
900244921 1:1632335-1632357 GCTGGGGGCCCCGGCGGTGCCGG + Exonic
900283912 1:1890496-1890518 GGCCGGGGCCCCGGGGGCGCGGG - Intronic
900294159 1:1940266-1940288 GCTGGGCGCTCCTGGGTAGCAGG - Intronic
900297189 1:1957719-1957741 GCCGGGCTCCCAGGCTGAGCAGG + Intronic
900396796 1:2456370-2456392 GCGGGGCGGCCCTGGGGGGCGGG + Intronic
901811076 1:11766995-11767017 GGAGGGGGCCCCGAGGGAGCGGG + Exonic
902377845 1:16038423-16038445 CCCAGGGGTCCCGGGGGAGCTGG + Intergenic
902586195 1:17439809-17439831 GCCGGGCGGGGCGGGGGCGCCGG - Intergenic
903115581 1:21176450-21176472 GCCGGGGGCAGCGGGGGGGCGGG + Intronic
903263304 1:22142758-22142780 GCCAGGCGGCGCGGGGCAGCGGG - Intronic
903738176 1:25543570-25543592 GTCGGACGCCGCGGCGGAGCTGG + Exonic
904307409 1:29599082-29599104 CCCGGGCACCCCTGGGCAGCAGG + Intergenic
904396332 1:30224865-30224887 CCCGGGCACCCCTGGGCAGCAGG - Intergenic
904431914 1:30469776-30469798 GCCAGGAGCCCCAGGAGAGCAGG + Intergenic
904542063 1:31239808-31239830 GCCAGCCGCCCCGGGGCAGGAGG - Intergenic
904672890 1:32179598-32179620 GGCGGGCGCCCCGGCAGGGCGGG - Intergenic
905132224 1:35769749-35769771 CCCGGGCGCCTCGGGTCAGCGGG + Intronic
905819743 1:40980056-40980078 GCCGGGCGGCGCTGGGGAGAGGG + Intronic
905867064 1:41382225-41382247 GCTGGGTGCGCCGGGGGAGCTGG + Exonic
907051099 1:51330403-51330425 GCTGGGAGGCCCGGGGGCGCGGG - Intronic
908127087 1:61043008-61043030 GCCGAGCGCCCTAGGGGAGAGGG + Intronic
908523366 1:64966047-64966069 GCCGTGCGCGCTGGGGGAGGGGG + Intronic
908534895 1:65067603-65067625 CCCGGGACCCCCGGGGGCGCAGG - Intergenic
909392925 1:75136437-75136459 CCCGGGCGCCGCGGGCGGGCTGG - Intronic
911208739 1:95117913-95117935 GCGGGGCGCCCGGGCGGCGCGGG - Exonic
912391736 1:109307502-109307524 GCCCGCTGCCCCCGGGGAGCGGG - Intergenic
912928008 1:113930019-113930041 GCTGGGCGCTCCAGGAGAGCCGG - Intronic
915213328 1:154325565-154325587 GGCCGAGGCCCCGGGGGAGCGGG + Intronic
915559229 1:156676767-156676789 GCGGGGCGGCGCGGGGCAGCGGG + Exonic
915916315 1:159943062-159943084 GCCGGCCGGCCGGGGGCAGCAGG + Exonic
916108658 1:161447952-161447974 GCCCGGCGCCCGGTGGGAGGCGG - Intergenic
916110246 1:161455333-161455355 GCCCGGCGCCCGGTGGGAGGCGG - Intergenic
916111831 1:161462743-161462765 GCCCGGCGCCCGGTGGGAGGCGG - Intergenic
916113418 1:161470124-161470146 GCCCGGCGCCCGGTGGGAGGCGG - Intergenic
917966678 1:180183230-180183252 GAGGGCTGCCCCGGGGGAGCTGG - Intronic
918218715 1:182416030-182416052 TCCCTGGGCCCCGGGGGAGCAGG + Intergenic
922925128 1:229342153-229342175 GCGCGGGGCCCCGGAGGAGCAGG - Exonic
923565595 1:235073801-235073823 GCCGCACCCCCCGGAGGAGCAGG + Intergenic
923673981 1:236064785-236064807 GCCGGGGGCGCCCGTGGAGCCGG - Intronic
924172543 1:241357119-241357141 GCGAGGCGGCCCAGGGGAGCGGG - Exonic
924289596 1:242524334-242524356 GCCGGGCGCGGAGGGCGAGCGGG + Exonic
924570888 1:245236782-245236804 GCCGTGAGCCCCGTGGGGGCTGG + Intronic
1064146465 10:12829985-12830007 GCCCTGCGTCTCGGGGGAGCAGG - Exonic
1065019794 10:21494845-21494867 GCCGCGCGCCCCGGGGTTGGAGG + Exonic
1065520617 10:26567396-26567418 CCAGGGCACCCCGGCGGAGCAGG + Exonic
1065925918 10:30433926-30433948 TCTGGGCGCCCGGGCGGAGCTGG - Exonic
1067060799 10:43077032-43077054 GCCGGCTGCGCCGGAGGAGCGGG - Exonic
1067561693 10:47309005-47309027 GCCGGCAGCCCCAGGGAAGCCGG + Intronic
1067711663 10:48655684-48655706 AACGGGCGCGCCGTGGGAGCTGG + Intronic
1068900955 10:62268732-62268754 GCCGGGGGCGCAGGAGGAGCCGG + Intergenic
1070742255 10:78910912-78910934 ATCAGGAGCCCCGGGGGAGCAGG - Intergenic
1070768628 10:79070077-79070099 GGCGGTGGCCCCGGGGGAGTGGG + Intronic
1071332232 10:84571527-84571549 ACCGGGCGCCCTGGAGGAGGGGG - Intergenic
1072283779 10:93894105-93894127 CCCGGGCGCCACTGAGGAGCCGG + Exonic
1072679866 10:97498874-97498896 GCCTGGTGCCCCGAGCGAGCCGG + Exonic
1073287763 10:102398837-102398859 GCCGGGGGCTACGGAGGAGCTGG + Exonic
1073509771 10:104035518-104035540 CCAGGGGGCCCCGGGGGACCAGG + Exonic
1073878348 10:107950867-107950889 ACCGGGCGCCCTGGAGCAGCGGG - Intergenic
1074377422 10:112951373-112951395 GCCGGGCGCCCCGACCGGGCCGG - Intronic
1075796482 10:125123673-125123695 CCCCGGGGCCCCTGGGGAGCCGG - Intronic
1076371689 10:129959619-129959641 CCCAGGCGCCCGCGGGGAGCAGG + Intronic
1076404005 10:130200659-130200681 GCTGGGCTCCCCAGGGGCGCTGG - Intergenic
1076721757 10:132396266-132396288 GCCGGGCGCCTGGGGGAAGGGGG + Intergenic
1076877889 10:133225544-133225566 GCCCTGGGCCCTGGGGGAGCAGG - Exonic
1076947995 10:133665010-133665032 AACGGAGGCCCCGGGGGAGCTGG + Intergenic
1076948985 10:133668320-133668342 AACGGAGGCCCCGGGGGAGCTGG + Intronic
1076949969 10:133671619-133671641 AACGGAGGCCCCGGGGGAGCTGG + Exonic
1076950953 10:133674918-133674940 AACGGAGGCCCCGGGGGAGCTGG + Intergenic
1076951943 10:133678228-133678250 AACGGAGGCCCCGGGGGAGCTGG + Intergenic
1076952932 10:133681538-133681560 AACGGAGGCCCCGGGGGAGCTGG + Intergenic
1076953916 10:133684837-133684859 AACGGAGGCCCCGGGGGAGCTGG + Intergenic
1076954900 10:133741189-133741211 AACGGAGGCCCCGGGGGAGCTGG + Intergenic
1076955889 10:133744499-133744521 AACGGAGGCCCCGGGGGAGCTGG + Intergenic
1076956879 10:133747809-133747831 AACGGAGGCCCCGGGGGAGCTGG + Intergenic
1076957866 10:133751118-133751140 AACGGAGGCCCCGGGGGAGCTGG + Intergenic
1076958851 10:133754417-133754439 AACGGAGGCCCCGGGGGAGCTGG + Intergenic
1076959840 10:133757727-133757749 AACGGAGGCCCCGGGGGAGCTGG + Intergenic
1076960824 10:133761026-133761048 AACGGAGGCCCCGGGGGAGCTGG + Intergenic
1077282940 11:1753762-1753784 GCCGCACGCCCCAGGTGAGCGGG - Intronic
1077480565 11:2812576-2812598 GCCGGGAGCCCCTGGGGACGGGG - Intronic
1077541400 11:3148163-3148185 GCCGGGACTCCCCGGGGAGCAGG + Intronic
1077602029 11:3580882-3580904 TCCGGGGGTCCCGGGGGCGCAGG - Intergenic
1079035044 11:17013912-17013934 GCGGGGCGCCCGGCGGGAACGGG + Intronic
1083272883 11:61580904-61580926 GCCGGGCGACCCCCGGGGGCGGG + Intronic
1083301910 11:61744024-61744046 GCCGGCCTCCCGCGGGGAGCTGG + Exonic
1083317742 11:61827125-61827147 GCCGGGCGTCCTGGGGGAAATGG - Intronic
1083962159 11:66020619-66020641 ACCAGGCGCCTAGGGGGAGCAGG + Exonic
1083997003 11:66277751-66277773 GCCGTGTGCCCCGCGGGAGTTGG - Intergenic
1084070152 11:66728431-66728453 CCCGGGCCTCCCGCGGGAGCCGG - Intronic
1084086445 11:66857308-66857330 GCCGGGCGCAGCGCGGGGGCCGG + Intronic
1084180498 11:67443402-67443424 ACCGGGGGCACCGGGGGCGCAGG + Exonic
1084485473 11:69445310-69445332 GCTGGGCGGCCTGGGGCAGCCGG + Intergenic
1084546757 11:69818619-69818641 GCGGGGCCCCGCGGGGGAGGCGG - Intronic
1086888318 11:92227029-92227051 GGAGGGCGCCCAGGGGGAGGGGG + Intergenic
1087141269 11:94768254-94768276 GCCGGGCGCCACGGCGGGGGTGG + Intronic
1087672765 11:101127585-101127607 GCAGGCCGTCCCGCGGGAGCAGG + Exonic
1089537413 11:119169105-119169127 GCAGGGCGGGCCGGGGGAGGAGG + Exonic
1092143561 12:6200190-6200212 GTCGGGCTCCGCGGGGCAGCTGG + Intronic
1092219056 12:6700569-6700591 GCCGGGCTCCCCGCGGGTGGGGG + Intronic
1092256254 12:6928106-6928128 TCCGGGCGGCCAGGGGGAGGCGG + Intronic
1095951520 12:47784307-47784329 GCCCAGGGCCCCGGAGGAGCGGG + Intronic
1096089713 12:48890872-48890894 GCCGGGCGCTGAAGGGGAGCCGG - Intergenic
1096622175 12:52871819-52871841 GCTGGTCTCCTCGGGGGAGCTGG - Intergenic
1096700624 12:53380493-53380515 GCCGCCCGCCCCGGGGGAGGGGG + Intronic
1096803376 12:54126288-54126310 GCCGGGCGGGCCCGGGGAACTGG - Intergenic
1097245356 12:57604929-57604951 GGAGGGGGCGCCGGGGGAGCGGG - Intronic
1097990261 12:65825594-65825616 GGCGGGCGGCCCGGGGAAGGCGG + Intronic
1099890121 12:88580193-88580215 GCCCGGTGCCCCGGGGAAGCCGG - Intronic
1101966896 12:109287846-109287868 GCTGGGCACCCGGGGGGAGCGGG + Exonic
1102111949 12:110371559-110371581 GCCAGGCCTCCCTGGGGAGCTGG - Intergenic
1103698619 12:122835876-122835898 CCCGAGCGCCCGGCGGGAGCGGG - Intronic
1103809498 12:123602208-123602230 GCTGGGCGCGCTGCGGGAGCTGG + Exonic
1104021262 12:124993877-124993899 CCCGGGCGCGCAGGGGGCGCGGG + Exonic
1104684505 12:130776049-130776071 GCCGGGCTCCTCAGGGCAGCAGG - Intergenic
1104829489 12:131740123-131740145 GCAGGGTGGCCCGGGGTAGCTGG + Intronic
1104854306 12:131894902-131894924 GGCGGGCGGGCCGGGGGCGCGGG - Exonic
1106592716 13:31111018-31111040 GCTGGGTGTCCCGGGGTAGCTGG + Intergenic
1110705937 13:78602175-78602197 GGCGGCGGCCCCGGGGGAGGCGG - Exonic
1112011407 13:95296733-95296755 GCCGGGCACCAGGGGGCAGCAGG + Intronic
1112336662 13:98522294-98522316 ACCGGGCACCCCTGGGGAGAAGG - Intronic
1112494773 13:99896073-99896095 TCCGCGCGCACCGGGGGCGCGGG - Exonic
1113566420 13:111322284-111322306 GCCTGGGGCCCCGAGGGAACGGG + Intronic
1113640561 13:111954016-111954038 GATGGACGCCCCGGGGGTGCTGG + Intergenic
1113656123 13:112068579-112068601 GTCGGGCGCCCTGGGCGCGCTGG + Exonic
1113874191 13:113584551-113584573 GCTGCGCGCCCTGGGAGAGCGGG - Intergenic
1113904421 13:113812711-113812733 GCCGGGCACACCTGGGGAGACGG + Exonic
1113906314 13:113820873-113820895 GGCGGGCTCCACGGGGGGGCAGG + Exonic
1113950622 13:114069478-114069500 GCCGGGAGACTCGGGGGACCAGG + Intronic
1114270769 14:21098548-21098570 GCTGGGAGCCGCGCGGGAGCCGG + Exonic
1116862171 14:50003463-50003485 GGCGGGGCCCCCGGGGGCGCGGG + Intronic
1117315354 14:54566833-54566855 GCGGCGCGGCGCGGGGGAGCCGG + Intergenic
1117392059 14:55271634-55271656 GCCCCGCGCCCCGGGAGCGCAGG - Intronic
1119759577 14:77141246-77141268 GCCGGTCGCCAGGGGGGCGCGGG + Intronic
1122081817 14:99272055-99272077 GCCGCGGGCCCGGGGGGAGCGGG + Intergenic
1122290091 14:100676089-100676111 GCCGGGCGCTCCAAGGGGGCTGG + Intergenic
1122408093 14:101512268-101512290 GCCGGGGGTCCCCCGGGAGCAGG - Intergenic
1122470924 14:101965189-101965211 GCGGGGCGCCCTGGGGGCTCCGG - Intronic
1122629122 14:103099335-103099357 GCCGAGGGCCCTGGGGGAGCAGG + Intergenic
1122666420 14:103333696-103333718 GTCGGGCGTCCCGGGAGAACGGG + Intronic
1202853801 14_GL000225v1_random:37529-37551 AACGGAGGCCCCGGGGGAGCTGG + Intergenic
1202859360 14_GL000225v1_random:72038-72060 AACGGAGGCCCCGGGGGAGCTGG - Intergenic
1124618002 15:31256499-31256521 CCCGGGCTCCCCAGGGCAGCTGG - Intergenic
1127293738 15:57592081-57592103 GCTGGGCGCCCCGGGCGTCCTGG - Exonic
1127588389 15:60398512-60398534 CCCGGGCGCCCCCCGGGAACTGG - Intronic
1127606487 15:60592359-60592381 CCCGGGCGCCCCGCCGGGGCCGG - Intronic
1128228623 15:66019611-66019633 GCCAGGCCCCCTGGAGGAGCCGG - Intronic
1129162113 15:73752850-73752872 GCCGGGGGCCCCGGCCGGGCTGG + Intergenic
1129483164 15:75843606-75843628 GCCGGGCGCGGAAGGGGAGCCGG - Exonic
1129772653 15:78212708-78212730 GCAGGGCGGTCCGGTGGAGCCGG - Intronic
1130040930 15:80404620-80404642 GCCGGGCGCCCCCGGGGGCGCGG + Intronic
1130604805 15:85306556-85306578 GCCGGGTGCCCCGGCTGTGCAGG + Intergenic
1132609307 16:807407-807429 GCCCGGCGGCCAGAGGGAGCGGG - Intronic
1132657149 16:1046087-1046109 GCTGGGTGGCCCAGGGGAGCCGG + Intergenic
1132803868 16:1766825-1766847 GCCGGGCGGCGCGGGGGAACGGG + Intronic
1132947125 16:2537941-2537963 GCCCGGCGCCGCGCGGGGGCGGG + Intergenic
1133072247 16:3254395-3254417 GGGGGGCGCCCCGGGGCAGAAGG - Exonic
1133272031 16:4614977-4614999 GCCGGGCGCCCCGGGGGAGCGGG + Intronic
1136003562 16:27313833-27313855 GCCGGGCGCGCCGGGCGGGGCGG + Intronic
1136110844 16:28063021-28063043 CCGCGCCGCCCCGGGGGAGCCGG + Intronic
1136129739 16:28212037-28212059 GCGGGGCGAGCGGGGGGAGCGGG + Intergenic
1136419506 16:30123125-30123147 CCCGGGGGTCCCGGGGGAGGTGG - Exonic
1136541631 16:30930489-30930511 GCCAGGCGGCCCGGGGCAGGGGG - Exonic
1137027512 16:35492560-35492582 GCCGGACACCCCTGGGGAGCAGG + Intergenic
1139546706 16:67653114-67653136 GCCGGGGGCCCAGGGGCGGCAGG - Exonic
1140442628 16:74999265-74999287 GCCGCCCGCCCCGCGGGAGGAGG - Exonic
1141694141 16:85612009-85612031 GGCGGCCGCCCAGGGGGTGCTGG + Intronic
1142120351 16:88383698-88383720 GGCGGGCGGCCCGGAGGAGGCGG - Intergenic
1142279485 16:89140268-89140290 GCCAGGTGCCCCGGGGTAACTGG + Intronic
1142403587 16:89873800-89873822 GTCCGGCGTCCCGGGGGCGCAGG + Exonic
1142852621 17:2711553-2711575 GCCGGGCGCGGCCGGTGAGCGGG - Intronic
1142858868 17:2749313-2749335 GCCAGCCCTCCCGGGGGAGCTGG + Intergenic
1142878154 17:2864746-2864768 GCGGGGCGCCCTGTGGGAGCTGG + Intronic
1142899258 17:3002329-3002351 GCAGGGCTTCCCGGAGGAGCAGG + Intronic
1142978391 17:3658299-3658321 CCCGGGAGCCCAGCGGGAGCGGG + Intronic
1143099922 17:4499262-4499284 GCCGGGGGTGCCGGGGGTGCCGG - Exonic
1143321232 17:6070461-6070483 GCCTGGCTCCCCGGGGCTGCTGG - Intronic
1143487441 17:7262526-7262548 CCCGCGCGCCCCGGGAGCGCGGG + Intronic
1145265440 17:21377602-21377624 TCCGGGTGCCCTGGGGGAGCGGG + Intronic
1147150353 17:38510509-38510531 GCCGGGCGGCTCCGGGGCGCGGG - Exonic
1147168643 17:38605813-38605835 GGCGGGCGGGCCGGGGGCGCGGG + Exonic
1147313515 17:39608030-39608052 GCGGCGGGTCCCGGGGGAGCCGG - Intronic
1147645027 17:42028191-42028213 GAGGGGCTCCCCGGAGGAGCCGG - Exonic
1147879761 17:43646107-43646129 GCGGGGCGCGCCCGGGGAGCAGG + Intronic
1148051464 17:44771993-44772015 GCTGGGGGCACAGGGGGAGCTGG - Intronic
1148080981 17:44967715-44967737 GCCGGGCCCTCCGGGGCTGCCGG - Exonic
1148081033 17:44967832-44967854 GCAGGGCCCCCAGGGGAAGCCGG - Exonic
1148240401 17:45996441-45996463 GCCGGGAGTGCCTGGGGAGCCGG - Exonic
1148491014 17:48024061-48024083 TGCGGGCGCCACGTGGGAGCTGG + Intergenic
1148608008 17:48944741-48944763 GCCGGGCGGCCCGCGGGCCCAGG - Exonic
1149461717 17:56834323-56834345 GCCGGGCCGCGCGTGGGAGCGGG + Intronic
1149865784 17:60150226-60150248 GCCGGGGGCCGCGAGGGTGCGGG + Intronic
1150003133 17:61454511-61454533 GACGGCCGCCCCGGGCCAGCCGG + Intronic
1150133131 17:62680000-62680022 GCCGGGCCCCCAGTCGGAGCCGG + Intronic
1150643689 17:66965493-66965515 GCCGGCACCCCCGGGGGAGGTGG + Intronic
1151598964 17:75094733-75094755 GCAGGGAGTCCCGGGAGAGCTGG - Intronic
1151882983 17:76905944-76905966 GGCCGGTGCCCCGGGGGGGCGGG + Intronic
1151930398 17:77228342-77228364 GCCGGGCGAGACGGGGCAGCAGG - Intergenic
1151938869 17:77280942-77280964 GCCGGGCACCGCGGCGGCGCCGG - Intronic
1152068583 17:78124427-78124449 GTTGGGGGCCCCAGGGGAGCTGG + Intronic
1152229613 17:79107898-79107920 CCAGGGCACCCCGCGGGAGCTGG - Intronic
1152588887 17:81201418-81201440 GCCGCTTGCCCCTGGGGAGCTGG - Intronic
1152648564 17:81481585-81481607 GCGGGCCGGCCCGGGGGAGGGGG + Intergenic
1152654876 17:81514816-81514838 GCCGGGCTTCCCGGCGGAGGCGG - Intronic
1152720670 17:81922446-81922468 GCCCGGCGCCCCTGGGGTACAGG + Exonic
1152798419 17:82320055-82320077 GCCGAGGGTCCTGGGGGAGCCGG + Intergenic
1152965848 18:112509-112531 AACGGAGGCCCCGGGGGAGCTGG - Intergenic
1153227000 18:2906974-2906996 GCCGGGCCCCCCGCAGGCGCAGG + Exonic
1153822065 18:8840537-8840559 GTCAGGAGCCCCTGGGGAGCAGG - Intergenic
1155277167 18:24199377-24199399 GCTGGGGGAGCCGGGGGAGCTGG - Intronic
1156088754 18:33440562-33440584 GGCGGGCGGCCAGGGGGAGTGGG + Intronic
1156214030 18:34977749-34977771 GCAGGGAGCCCCGGGAGCGCAGG + Intronic
1156502067 18:37566297-37566319 GCCCGGCGGCCGCGGGGAGCGGG + Intergenic
1157515078 18:48305064-48305086 GCCCCGCGCACCTGGGGAGCAGG - Intronic
1158579915 18:58671874-58671896 GCCGGGCGCGCGGGTCGAGCGGG + Intronic
1160163267 18:76491396-76491418 GCGGGGCGGGCGGGGGGAGCCGG - Intronic
1160242255 18:77132465-77132487 GACCGGAGCCCCGCGGGAGCCGG - Intronic
1160453354 18:78979803-78979825 GCCCGGCGCGCCGGCGGAGACGG + Intergenic
1160566164 18:79787993-79788015 GAAGGCCGCCCCGGGAGAGCGGG + Intergenic
1160725438 19:616137-616159 GGCGGGCGCGCCCGGGGGGCTGG - Exonic
1160909223 19:1467214-1467236 GGCGGGGGCGCCGGGGGCGCCGG + Exonic
1161052753 19:2173483-2173505 GCAGGGCGTCCTCGGGGAGCAGG + Intronic
1161083186 19:2321653-2321675 GCCGGGGGCGCGGGGGGTGCAGG - Exonic
1161309396 19:3585661-3585683 GCCGGGGGCTCCGAGGGCGCGGG - Exonic
1161374716 19:3933521-3933543 GGAGGCCGCCCCGGGGGAGGCGG - Exonic
1161387978 19:4007175-4007197 GCCGGGCGCCCCCAGCCAGCTGG + Intergenic
1161438876 19:4279548-4279570 GGCGGGCTCCCCAGGGGCGCGGG - Exonic
1161478357 19:4498533-4498555 GCCAAGGGCCCTGGGGGAGCTGG + Intronic
1161911573 19:7198261-7198283 GCCCGGCGCACCCGGGGGGCGGG - Intronic
1161939736 19:7395015-7395037 GCGGGGCGCTCCCGGGGACCTGG - Intronic
1162030766 19:7916410-7916432 GCCGGGCGCCGCGGGGAACGGGG - Exonic
1162321023 19:9970628-9970650 GCCGGGGGGCCCGGGGGCGCCGG + Exonic
1162398646 19:10432005-10432027 GCCGTGCGCCCCCGGGGAAACGG - Intronic
1162914170 19:13865450-13865472 GCCGGGCGGGCCGGGGGCACGGG + Intronic
1162929881 19:13952561-13952583 GGCGGCGGCCCCGGGGGAGCCGG + Exonic
1163636147 19:18437988-18438010 GCTGGGGGCCCGGGGTGAGCAGG + Exonic
1163695304 19:18760762-18760784 GAGGGGGGTCCCGGGGGAGCAGG - Intronic
1163791023 19:19306150-19306172 GCTGTGGGCCCCGGGGGAGCTGG + Intronic
1164645807 19:29858225-29858247 GACGGGCACCCCGGGGGTGGAGG - Intergenic
1165058606 19:33194385-33194407 GCGGGGCGGCCCGGGGACGCCGG + Intronic
1165058754 19:33194821-33194843 GCCGGGCGCCCGGGCGCAGCTGG + Exonic
1165639408 19:37371236-37371258 GCCGGGCCCCGGGCGGGAGCGGG + Intronic
1165851428 19:38852165-38852187 GCCGGGAGCGCGGGGGGTGCGGG - Intronic
1166106729 19:40601332-40601354 GCCGGGCCCCTCGGGCGGGCTGG + Intronic
1166373184 19:42313602-42313624 TCCGGGAGCCTCGGGGGAGTGGG + Intronic
1166765599 19:45251152-45251174 GCCGGGGGCTCCGGGGGCTCCGG - Intronic
1167040604 19:47020778-47020800 GGCGGGCGGCGCGGGGGAGGCGG + Intronic
1167071901 19:47226683-47226705 GCCCAGCGCCCCGGGGGCTCTGG - Exonic
1167080779 19:47274950-47274972 GCCGAGAGCCCCGGAGGCGCGGG + Exonic
1167643781 19:50695247-50695269 GCCGGGGGGCGCGGGGGCGCGGG + Intronic
1168076343 19:53982589-53982611 GCCGGGGGCGCCGGGGGCGGCGG + Exonic
1168110555 19:54189436-54189458 GGCGGGCGCCCAGAAGGAGCAGG - Exonic
1168307220 19:55442325-55442347 GCCGGGGGCCGCGGGGGCGAGGG - Exonic
1168307259 19:55442403-55442425 GCCGGGGGCGCTGGGGGTGCGGG - Exonic
1168307264 19:55442412-55442434 GCTGGGGGCGCCGGGGGCGCTGG - Exonic
1168311794 19:55464434-55464456 GCCGGGTGCGCCGGGGCTGCAGG + Intergenic
925069716 2:956567-956589 GGCCGGGGCCCTGGGGGAGCGGG - Intronic
925278949 2:2669635-2669657 GCCAAGCGGCCTGGGGGAGCTGG + Intergenic
926095620 2:10079618-10079640 GCCGCGGGCCCGAGGGGAGCCGG + Intronic
927156740 2:20225143-20225165 GCCGGGAGACCTGGCGGAGCTGG - Intronic
927713987 2:25341304-25341326 CCGCGGCGGCCCGGGGGAGCGGG - Intronic
927720385 2:25378389-25378411 TGCAGGGGCCCCGGGGGAGCGGG + Intronic
927809547 2:26173643-26173665 GCGGGGGGCCCAGGGGCAGCGGG - Intronic
928093767 2:28392157-28392179 AGCGGGCGCCCCGGGCGCGCAGG - Intergenic
929492281 2:42407610-42407632 GCGGGGCTCCCTGGAGGAGCAGG - Intronic
929997240 2:46836388-46836410 GCAGGGCTCTCCTGGGGAGCTGG - Intronic
932191048 2:69741895-69741917 ACCGGGCGGGCCTGGGGAGCAGG + Intronic
932231343 2:70086880-70086902 ACCGGCCGCCGCCGGGGAGCAGG + Intergenic
932593730 2:73081585-73081607 GGCCGGAGCCCAGGGGGAGCAGG + Intronic
934098199 2:88627019-88627041 GCCGGCAGCCGCGGGAGAGCAGG - Exonic
934765807 2:96879424-96879446 GCCTGGCGCCCTGGGAGGGCCGG - Intronic
935619806 2:105119158-105119180 GCCGGGGACCACGGGAGAGCCGG - Intergenic
936509378 2:113132931-113132953 GCCGGGAGCCCTGGGGCAGGGGG - Exonic
937203729 2:120223005-120223027 GCCGAGCGTCGCGAGGGAGCAGG - Exonic
942116776 2:172735869-172735891 GCCAGGCGTCCGGGAGGAGCGGG + Exonic
942451085 2:176108167-176108189 CCCGGGGGCCGCGGGGGAGGGGG + Intronic
942458174 2:176151922-176151944 GGCGGAGGCGCCGGGGGAGCTGG - Exonic
942460563 2:176165420-176165442 GCCGGCGGGCCCGGGGAAGCGGG + Intronic
946306503 2:218859666-218859688 GCCGTGCGCCCCGGGGCGGCTGG - Intergenic
946309256 2:218873646-218873668 ACCGCGCGTGCCGGGGGAGCCGG - Exonic
946431134 2:219627887-219627909 GCGGGGAGCCCTGGGGGAGGAGG - Intronic
948481788 2:238254901-238254923 GCCCAGAGACCCGGGGGAGCTGG + Intronic
948645461 2:239401191-239401213 GCCAGGCGCCCGGGGCGGGCGGG - Intronic
948824806 2:240568945-240568967 GCCGGGCGCCTCGGGGAAGGCGG - Exonic
948954005 2:241272924-241272946 GCTGGGCGGCCCGGGGCGGCGGG - Intronic
1169195998 20:3682200-3682222 GGCGCGCGCCATGGGGGAGCCGG + Exonic
1170567357 20:17614673-17614695 GCCGGGAGCCCCGGGGAGGCAGG - Intronic
1170596098 20:17806950-17806972 CCCAGCCGCCCCGGGGGGGCAGG + Intergenic
1171191289 20:23161444-23161466 GCCAGGCCTCCTGGGGGAGCTGG - Intergenic
1171346351 20:24469312-24469334 GGCGCGGGCCCCGGGGGAGGAGG - Exonic
1172245609 20:33443443-33443465 GCCCGGCGCTCCGCGGGAGCAGG - Exonic
1172714268 20:36951362-36951384 GCCAGGCGCCCTGAGGGAGGGGG - Intronic
1174380712 20:50153735-50153757 GCCGGGCGCGGCGGCGGCGCGGG + Intergenic
1174402956 20:50285736-50285758 GCCCGGAGTCCCGGGGGACCAGG - Intergenic
1174467765 20:50731007-50731029 GGCGCGAGCCCCGGCGGAGCCGG + Intergenic
1175428814 20:58889013-58889035 GCCGCGCACCCTGGGGGTGCAGG - Intronic
1175997207 20:62817203-62817225 GCCGGGCACCCCGGAGTGGCGGG - Intronic
1175997331 20:62817589-62817611 CCCGGGCGGCCCTGGGGGGCCGG - Exonic
1176048076 20:63102868-63102890 GCGGGCCGCTCCGGGGAAGCGGG + Intergenic
1176074271 20:63241378-63241400 GCCGGCCGCCTGGGGGGTGCTGG + Exonic
1176281625 20:64316745-64316767 GCGGGGCGCGGCGGGGGCGCGGG + Intergenic
1176385845 21:6138230-6138252 CCTGGGGGCCCCGGAGGAGCGGG + Intergenic
1176428852 21:6564192-6564214 GCCTGGCTCCCCTGGGGTGCAGG + Intergenic
1177792572 21:25735804-25735826 GCCTGGAGCCCGGGGGGACCGGG + Intronic
1179175492 21:39005077-39005099 GGCGGGGGGCCCGGGGGGGCAGG + Intergenic
1179209488 21:39313364-39313386 GCCGGGGGAGCCCGGGGAGCCGG + Intronic
1179539330 21:42073989-42074011 GCTAGGTGCCACGGGGGAGCTGG + Intronic
1179704342 21:43172508-43172530 GCCTGGCTCCCCTGGGGTGCAGG + Exonic
1179737628 21:43400022-43400044 CCTGGGGGCCCCGGAGGAGCGGG - Intergenic
1179960227 21:44763859-44763881 GCAGGGTGCCCCGGGTGTGCTGG - Intergenic
1179960336 21:44764222-44764244 GCCGGGTGTCCCGGGTGTGCTGG - Intergenic
1179960364 21:44764308-44764330 GCCGGGTGTCCCGGGTGTGCTGG - Intergenic
1179989516 21:44939946-44939968 GCCGGGAGCCCCGCGGCCGCCGG - Intergenic
1180037323 21:45256551-45256573 GCAGGGAGCCCCTCGGGAGCAGG - Intergenic
1180844876 22:18975536-18975558 ACTGGGCGCCCCGTGGGTGCGGG - Intergenic
1180949381 22:19714393-19714415 CCAGGGCGGCCCGGGGGGGCGGG - Intergenic
1180949407 22:19714449-19714471 GCCGGGCGCGCGGGCGGAGCGGG + Exonic
1180951579 22:19722885-19722907 GCTGGGTGACCCGCGGGAGCAGG - Exonic
1181056585 22:20263173-20263195 ACTGGGCGCCCCGTGGGTGCGGG + Intronic
1181917537 22:26292800-26292822 GCCTGGCCCACCGGGGGACCCGG + Exonic
1182664152 22:31944970-31944992 GCGGGGCGCCCAGCGGGAGCGGG - Intronic
1182831114 22:33305266-33305288 GCCTGGCGCCCTGGGGTAGTAGG - Intronic
1183075559 22:35424413-35424435 GGCGGGCGCCCAGAGGCAGCAGG - Exonic
1183301448 22:37061002-37061024 ACCGGGGGCCCCGGGGCTGCTGG + Intronic
1183389066 22:37533624-37533646 GCCAGGGGCCCCGGGGAAGGAGG + Intergenic
1183393796 22:37560561-37560583 TCCGCGAGCCCCGGGGGCGCGGG - Exonic
1183411726 22:37658893-37658915 GCCGGGCGCCCCGGAGCTGCTGG + Exonic
1183546287 22:38456043-38456065 GCCGCGGGCCCCGCGGGAGGGGG - Intergenic
1183578217 22:38706023-38706045 CCTGGCCGCCCCCGGGGAGCTGG - Exonic
1183640062 22:39087228-39087250 GACAGGTGCCCTGGGGGAGCAGG - Intronic
1183743142 22:39679348-39679370 GCCAGGGGCGCCCGGGGAGCCGG - Exonic
1183939576 22:41285838-41285860 GCCGAGCGCCCCAGGGGTGGCGG - Intronic
1184120037 22:42444159-42444181 GCCGGGCGGCTCGTGGGAGGAGG + Intergenic
1184130204 22:42513029-42513051 ACAGCGCGCCCCGGGGAAGCTGG + Intronic
1184140380 22:42574852-42574874 ACAGCGCGCCCCGGGGAAGCTGG + Intergenic
1184280784 22:43436330-43436352 GCGGGACGCCCCTGGGGAGGCGG - Intronic
1184653630 22:45930603-45930625 GCCGGGGGCTGCTGGGGAGCAGG - Intronic
1184796830 22:46737876-46737898 GCCGGGGGCCCTGGGAGCGCAGG - Intronic
1185055325 22:48576043-48576065 GCCGGGCGGCGCGGGGGGGGGGG - Intronic
949414275 3:3799440-3799462 GCGGGGCGCACCGCGGGCGCCGG + Exonic
950159166 3:10746509-10746531 GCCCAGCACCCCGTGGGAGCTGG + Intergenic
950584009 3:13880159-13880181 GGCGGGCGCTCCGGGGAGGCGGG - Intergenic
951543926 3:23806899-23806921 GCGGGGCGCCACGGCGGGGCAGG - Intronic
952011231 3:28903196-28903218 ACCGGGCGCCGCGGAGCAGCGGG + Intergenic
952966858 3:38626380-38626402 GCTGGGCGCCATGGGGGACCTGG - Intronic
953027365 3:39152959-39152981 GCCGGGCGCCCCCGGCCGGCGGG - Intronic
953925938 3:46982439-46982461 GCCGGGCCCCCAGGGGGAGGGGG - Intronic
954151815 3:48661736-48661758 GCCGGGAGTCCCGGGGGACGCGG + Exonic
954212947 3:49108575-49108597 GCCTGGCATCCCGGGGGTGCTGG + Intronic
954796021 3:53161679-53161701 GACGGGCCCCTCGGAGGAGCGGG - Intronic
955161393 3:56468188-56468210 CACGGGCGCCCCGAGGGAGCCGG + Intronic
955161433 3:56468310-56468332 CCCGGGCGGCCAGGAGGAGCAGG + Exonic
956631028 3:71316494-71316516 GCCGGGCCCCACGTGGGACCCGG - Intronic
961210240 3:125119993-125120015 GCCTGACGGCCTGGGGGAGCTGG + Intronic
961322132 3:126083760-126083782 GCTGGGGGTCGCGGGGGAGCCGG - Intronic
961434721 3:126909084-126909106 GCTGGGCGCCACGGGAGAGAAGG - Intronic
961545325 3:127629225-127629247 GCCGGGCGGCCCGCAGCAGCCGG - Exonic
961683075 3:128611875-128611897 GCTGGGAGCCCTGGGGGAGCAGG - Intergenic
962750999 3:138434815-138434837 GCTGGGGGCCCCGGGGGCGCAGG - Exonic
963732661 3:148987717-148987739 GCCGGGCCGGCCGGGCGAGCGGG - Intergenic
963733037 3:148991318-148991340 GGCAGGCGCCCCGGGGAAGTAGG + Intergenic
963870531 3:150409733-150409755 GCCGGGTGCTCCGGGGGCGGGGG - Exonic
967858277 3:194134355-194134377 GGCGGGCGCCCGGGAGGAGGCGG - Intergenic
967930439 3:194686800-194686822 GGAGGGCGCCCCGGCGCAGCTGG - Exonic
968186951 3:196639615-196639637 GTGGGGCGGGCCGGGGGAGCGGG - Intergenic
968284274 3:197499021-197499043 GGCGGGCGCCCGGGGAGCGCGGG + Intergenic
968522583 4:1040733-1040755 GCCTAGTGCCCCTGGGGAGCAGG + Intergenic
968728762 4:2260124-2260146 GCCTCAGGCCCCGGGGGAGCGGG + Intronic
968904765 4:3446095-3446117 GCCTGGCGCCCCGGGGAGGCTGG - Exonic
972740407 4:41881900-41881922 GCAGGGCGCCCAGGGGGCGGGGG - Intergenic
973764250 4:54149338-54149360 GCCGGGCGCCGCGGAGCAGGGGG + Intronic
973820650 4:54658894-54658916 GCCGCGCGCCCCGGGGCGGCTGG + Intronic
975616495 4:76252172-76252194 TCCAGGCGCCCCGGGGCATCTGG - Intronic
975710808 4:77158045-77158067 GCTGGGCGCCCCGGGCGGGCGGG + Intronic
978576711 4:110196768-110196790 GCCGCGCGCACCGGCGGGGCAGG - Intronic
979122866 4:116926069-116926091 GCGGGGCCGCCCTGGGGAGCGGG - Intergenic
980930151 4:139177044-139177066 GCCGAGCGTCCGGAGGGAGCCGG + Exonic
982460935 4:155667730-155667752 GCGGGGCGCGCCGGGGCCGCTGG + Intronic
983649779 4:170026466-170026488 GCCGGGCGGCGCGGAGGCGCGGG + Intronic
984146352 4:176065950-176065972 CCCGGGCGCCCTGAGCGAGCAGG + Intronic
984639260 4:182144525-182144547 GCCGCGCGGCCCGGGGACGCGGG - Intronic
984639443 4:182145065-182145087 GCTGGGCGCCCAGTGGGGGCGGG + Intronic
985173203 4:187174189-187174211 GCAGGCAGCCCCGGAGGAGCAGG - Intergenic
985451452 4:190065818-190065840 AACGGAGGCCCCGGGGGAGCTGG + Intergenic
985452441 4:190069110-190069132 AACGGAGGCCCCGGGGGAGCTGG + Intergenic
985453426 4:190072407-190072429 AACGGAGGCCCCGGGGGAGCTGG + Exonic
985454416 4:190075700-190075722 AACGGAGGCCCCGGGGGAGCTGG + Exonic
985455404 4:190078993-190079015 AACGGAGGCCCCGGGGGAGCTGG + Exonic
985456389 4:190082287-190082309 AACGGAGGCCCCGGGGGAGCTGG + Exonic
985457376 4:190085587-190085609 AACGGAGGCCCCGGGGGAGCTGG + Intergenic
985458363 4:190088880-190088902 AACGGAGGCCCCGGGGGAGCTGG + Exonic
985459352 4:190092180-190092202 AACGGAGGCCCCGGGGGAGCTGG + Exonic
985463604 4:190174949-190174971 AACGGAGGCCCCGGGGGAGCTGG + Exonic
985696663 5:1344855-1344877 GGCGGGCGGGCCGGGGGCGCCGG - Exonic
985985272 5:3510623-3510645 GCCGTGAGCCCCGGGAGACCAGG + Intergenic
986321288 5:6633989-6634011 GGGGGACGCCCCGGGGGATCTGG - Intronic
990581895 5:57173809-57173831 GTCGGGCGCCTGGGGGGAGGGGG - Intergenic
991587380 5:68215177-68215199 GCCTGGCGCTCCGGGGGTGAAGG - Intergenic
992249893 5:74866311-74866333 GCCGGGCGTCCGGGGCGAGCGGG - Intronic
992591099 5:78295900-78295922 GCCGGCCGCCCCAGGGAAGGCGG + Intergenic
993901130 5:93584880-93584902 GCCGGGCGCCCCGGGGTCGCAGG - Exonic
997512936 5:134465835-134465857 TCCGGGCGCCTCTGGGAAGCTGG + Intergenic
998227268 5:140336601-140336623 GCCCTGCACCCAGGGGGAGCTGG - Intronic
1002334670 5:178469594-178469616 GCTGGGCTCCCCCGGGCAGCTGG + Intronic
1003052245 6:2790610-2790632 GCAGGGAGCCCTGGGAGAGCAGG + Intergenic
1003139351 6:3457327-3457349 GCCGGGCGGGGCGGGGGAGGAGG + Intergenic
1003426005 6:5998945-5998967 GGTGGGCGCGCGGGGGGAGCTGG + Exonic
1006083528 6:31580994-31581016 GCCGGGCGCCCCCTGGCGGCGGG - Exonic
1006294509 6:33164169-33164191 GCAGGGCACCCAGGGGGAGCAGG - Intronic
1006474844 6:34247139-34247161 GCCGGTCCACCCTGGGGAGCAGG + Exonic
1006580108 6:35072241-35072263 CCCGGGCGTCCTGGGAGAGCAGG - Intronic
1006665210 6:35688647-35688669 GCCGCGTGTCGCGGGGGAGCGGG - Intronic
1006932608 6:37697041-37697063 GCCGGGCGCGCCGAGGCACCCGG - Exonic
1007368884 6:41413378-41413400 ATCGGGTGCCCCTGGGGAGCGGG - Intergenic
1007383290 6:41504140-41504162 CCCGGGCGCCCCGGGGGTGAGGG - Intergenic
1009431729 6:63572914-63572936 GCCGGGCCCCTCGGGGCTGCGGG + Intronic
1011128944 6:84034493-84034515 GCGGGGCGGGCGGGGGGAGCGGG - Intronic
1012465773 6:99515236-99515258 GCCCGGCGCCCCCAGGGATCAGG + Exonic
1013452272 6:110295475-110295497 GTCAGACGCCCTGGGGGAGCTGG - Intronic
1013575741 6:111482717-111482739 GCCGGGCGCGGGGCGGGAGCGGG - Intronic
1014079544 6:117270884-117270906 GCCGGGCGCCCCGAGGCGGCTGG - Exonic
1015496933 6:133891827-133891849 GGCGCGCTCCCGGGGGGAGCGGG + Exonic
1017006206 6:150029446-150029468 GCAGGGAGCCCTGGGGGTGCTGG - Intergenic
1017672246 6:156778741-156778763 GCCGGGGGCCCCGGCGGCGGCGG - Exonic
1019266483 7:120029-120051 GCCAGGAGCCCCTGAGGAGCAGG + Intergenic
1019323282 7:425166-425188 AGCGGCCGCCCCTGGGGAGCGGG - Intergenic
1019360384 7:601746-601768 GCCGGGCCCCCTGCGGGAACCGG - Intronic
1019398588 7:837115-837137 GCCAGGCCCCCTGGGGCAGCAGG + Intronic
1019409073 7:898798-898820 GCCGGGCTGCCCTGAGGAGCAGG + Exonic
1019465508 7:1185925-1185947 GCAGGGCCCCCGTGGGGAGCAGG - Intergenic
1019479470 7:1259974-1259996 GCCTGGGGCCCAGGGGCAGCAGG - Intergenic
1019556287 7:1633193-1633215 GCTGGGAGACCCAGGGGAGCGGG + Intergenic
1019592036 7:1840341-1840363 GCAGTGCGCCCCGGGGTATCTGG + Intronic
1020023476 7:4883168-4883190 GCGGGGCGCAGCGGGGGAGCGGG - Intronic
1020253008 7:6484207-6484229 GCGGGGCACCCTGGGAGAGCGGG + Exonic
1021717008 7:23469827-23469849 GCCCGGCGCGCTGGGGGAGCGGG - Intronic
1021719263 7:23490479-23490501 GCCGGAGGCCCCGGGGGCCCTGG + Intergenic
1023043244 7:36190900-36190922 GCCGGGCATTCCGGGGGTGCTGG - Intronic
1023810325 7:43906519-43906541 GCCGGCAGCCGCGGGGGCGCAGG + Intronic
1025833481 7:65075109-65075131 GCCGGCCACGCCGGGGGCGCTGG + Intergenic
1026665465 7:72336887-72336909 CCCGGGGGCGCCGAGGGAGCCGG - Intronic
1029467677 7:100736591-100736613 CCCGGGGGCCCCGGTGGAGCCGG - Exonic
1029640477 7:101816579-101816601 GCCGGGGGCGCGGGGCGAGCGGG - Intronic
1029693300 7:102196713-102196735 GCCCCGCAACCCGGGGGAGCAGG + Exonic
1032020716 7:128405978-128406000 GCCGGGCGGGCCGGGGGCGGGGG + Intronic
1032239428 7:130149511-130149533 CCCGGCCGCCCCGGGGGAGCAGG - Intergenic
1034276892 7:149827793-149827815 GCAGGTGGCCCCGGGGGAGCTGG + Intergenic
1034445930 7:151114517-151114539 GCGGCGCGGCGCGGGGGAGCCGG - Intronic
1034475100 7:151277076-151277098 GGCCGGGGTCCCGGGGGAGCAGG - Intronic
1034911670 7:155002985-155003007 GCCGGGCGCCGCGGGGGCCGGGG - Exonic
1034993399 7:155562281-155562303 GCCGGGCACCCGGGTGGAGCTGG + Intergenic
1035266309 7:157691941-157691963 GCGCGGCGCCCCCGCGGAGCTGG + Intronic
1036173116 8:6509462-6509484 GCAGGGGGCCCCGGGGGGGATGG + Intronic
1039050047 8:33484735-33484757 GCCGGGGGACTCGGAGGAGCGGG + Exonic
1041696468 8:60741946-60741968 GCAGGGGGCCCCGACGGAGCCGG - Exonic
1046547218 8:115667974-115667996 ACCGGGCGCAGCGGAGGAGCTGG - Intronic
1048848699 8:138623731-138623753 GCCGGGTCCCCCTGGAGAGCCGG - Exonic
1049408639 8:142462723-142462745 GCCGGGTGGCCTGGGGGAGGGGG + Intronic
1049419473 8:142510570-142510592 GGCGCGGGCCCCGGAGGAGCTGG + Intronic
1049446037 8:142632129-142632151 CCTGGGCCCCCCTGGGGAGCTGG - Intergenic
1049803122 8:144527277-144527299 GCGTGGAGTCCCGGGGGAGCGGG + Exonic
1053121215 9:35548472-35548494 GCTGGGCTCCCTGGGAGAGCAGG - Exonic
1053586464 9:39464225-39464247 GCCGGGCCCCGCGGGGTTGCGGG - Intergenic
1054579842 9:66901008-66901030 GCCGGGCCCCGCGGGGTTGCGGG + Intronic
1054870555 9:70044287-70044309 GCCGGACCCCCGGGGGCAGCAGG - Intronic
1056604587 9:88076408-88076430 GCGTGGCGCCCCGGAGGTGCAGG + Intergenic
1057187588 9:93065578-93065600 GCCTGGCGGCCCTGGGGAGGGGG + Intronic
1057577437 9:96254731-96254753 ACCGGGCTCCCCAGGAGAGCTGG + Intronic
1057869875 9:98709225-98709247 GCCGTGCGCGCCGGGGGAGGGGG + Intergenic
1059208450 9:112487381-112487403 GCGGGGCGGCCCGGGGCAGGCGG - Intronic
1060558354 9:124521865-124521887 GCTGGGGGCCCCGAGGGAGCTGG + Exonic
1060695651 9:125707032-125707054 GCCGGGAGGCGTGGGGGAGCCGG - Exonic
1060722845 9:125989944-125989966 TCCGGGGGCCCCTGGGAAGCAGG + Intergenic
1060743851 9:126117068-126117090 TCCGGGCCCTCCTGGGGAGCAGG + Intergenic
1060796185 9:126514377-126514399 GCCGGGCGCCCCCGCGCGGCCGG - Intergenic
1060952267 9:127612018-127612040 GCCGCGCGCGCCCGGGGCGCAGG - Intergenic
1061710878 9:132486944-132486966 GCCGGGCTGCCCCGGGGAGCGGG + Intronic
1061817846 9:133207080-133207102 GCCGGGCACCGCTGGGCAGCCGG - Intronic
1061828441 9:133275546-133275568 CCCCGCCTCCCCGGGGGAGCAGG - Intergenic
1062084509 9:134641847-134641869 GCGGAGCGCCCACGGGGAGCGGG + Exonic
1062491823 9:136808450-136808472 GCCGGGCGCTCCGGGAGCGGGGG + Intronic
1062501809 9:136855007-136855029 GACGGGGGCCCGGGGGGCGCCGG - Exonic
1062626021 9:137441777-137441799 GACGGGCGCCGCGGGGCTGCAGG - Intronic
1185505922 X:632155-632177 GCGAGGGGCCCCGGGGAAGCTGG + Intronic
1185605296 X:1365365-1365387 GCCGGGTGCGCGGGGTGAGCCGG + Intronic
1185605334 X:1365482-1365504 GCCGGGTGCGCGGGGTGAGCCGG + Intronic
1185605359 X:1365554-1365576 GCCGGGTGCGCGGGGTGAGCGGG + Intronic
1185605368 X:1365581-1365603 GCCGGGTGCGCGGGGTGAGCGGG + Intronic
1185605378 X:1365617-1365639 GCCGGGTGAGCCGGGTGAGCCGG + Intronic
1185605385 X:1365635-1365657 GCCGGGTGCGCGGGGTGAGCCGG + Intronic
1185605392 X:1365653-1365675 GCCGGGTGCGCGGGGTGAGCGGG + Intronic
1185605410 X:1365707-1365729 GCCGGGTGCGCGGGGTGAGCGGG + Intronic
1185605428 X:1365761-1365783 GCCGGGTGCGCGGGGTGAGCGGG + Intronic
1185605439 X:1365797-1365819 GCCGGGTGCCCCGGGTGAGCGGG + Intronic
1185605454 X:1365833-1365855 GCCGGGTGCGCGGGGTGAGCGGG + Intronic
1185605468 X:1365878-1365900 GCCGGGTGCGCGGGGTGAGCCGG + Intronic
1185605474 X:1365896-1365918 GCCGGGTGCGCGGGGTGAGCCGG + Intronic
1185605503 X:1365982-1366004 GCCGGGTGCGCGGGGTGAGCGGG + Intronic
1185605511 X:1366009-1366031 GCCGGGTGCCCCGGGTGAGCGGG + Intronic
1185605526 X:1366045-1366067 GCCGGGTGCGCGGGGTGAGCGGG + Intronic
1185605573 X:1366198-1366220 GCCGGGTGCGCGGGGTGAGCGGG + Intronic
1185605590 X:1366252-1366274 GCCGGGTGCGCGGGGTGAGCCGG + Intronic
1185605600 X:1366279-1366301 GCCGGGTGCGCGGGGTGAGCGGG + Intronic
1185605614 X:1366324-1366346 GCCGGGTGCGCGGGGTGAGCCGG + Intronic
1185605621 X:1366342-1366364 GCCGGGTGCGCGGGGTGAGCGGG + Intronic
1185605633 X:1366378-1366400 GCCGGGTGCGCGGGGTGAGCGGG + Intronic
1185605657 X:1366450-1366472 GCCGGGTGCGCGGGGTGAGCGGG + Intronic
1185605668 X:1366486-1366508 GCCGGGTGCCCCGGGTGAGCGGG + Intronic
1185605685 X:1366531-1366553 GCCGGGTGCGCGGGGTGAGCCGG + Intronic
1185605691 X:1366549-1366571 GCCGGGTGCGCGGGGTGAGCCGG + Intronic
1185605717 X:1366628-1366650 GCCGGGTGCGCGGGGTGAGCGGG + Intronic
1185605725 X:1366655-1366677 GCCGGGTGCCCCGGGTGAGCGGG + Intronic
1185605740 X:1366691-1366713 GCCGGGTGCGCGGGGTGAGCGGG + Intronic
1185605785 X:1366844-1366866 GCCGGGTGCGCGGGGTGAGCGGG + Intronic
1185605803 X:1366898-1366920 GCCGGGTGCGCGGGGTGAGCGGG + Intronic
1185605826 X:1366970-1366992 GCCGGGTGCGCGGGGTGAGCCGG + Intronic
1185605833 X:1366988-1367010 GCCGGGTGCGCGGGGTGAGCGGG + Intronic
1185605851 X:1367042-1367064 GCCGGGTGCGCGGGGTGAGCGGG + Intronic
1185605860 X:1367069-1367091 GCCGGGTGCGCGGGGTGAGCGGG + Intronic
1185605869 X:1367096-1367118 GCCGGGTGCGCGGGGTGAGCGGG + Intronic
1185605881 X:1367132-1367154 GCCGGGTGCGCGGGGTGAGCGGG + Intronic
1185605893 X:1367168-1367190 GCCGGGTGCGCGGGGTGAGCGGG + Intronic
1185605899 X:1367186-1367208 GCGGGGTGCGCCGGGTGAGCGGG + Intronic
1185605919 X:1367249-1367271 GCCGGGTGCGCGGGGTGAGCCGG + Intronic
1185605926 X:1367267-1367289 GCCGGGTGCGCGGGGTGAGCGGG + Intronic
1185605944 X:1367321-1367343 GCCGGGTGCGCGGGGTGAGCGGG + Intronic
1185605962 X:1367375-1367397 GCCGGGTGCGCGGGGTGAGCGGG + Intronic
1185605983 X:1367438-1367460 GCCGGGTGCGCGGGGTGAGCGGG + Intronic
1185606000 X:1367492-1367514 GCCGGGTGCGCGGGGTGAGCCGG + Intronic
1185606023 X:1367564-1367586 GCCGGGTGCGCGGGGTGAGCGGG + Intronic
1185606032 X:1367591-1367613 GCCGGGTGCGCGGGGTGAGCGGG + Intronic
1185606043 X:1367627-1367649 GCGGGGTGCGCCGGGTGAGCCGG + Intronic
1185606049 X:1367645-1367667 GCCGGGTGCGCGGGGTGAGCCGG + Intronic
1185606056 X:1367663-1367685 GCCGGGTGCGCGGGGTGAGCGGG + Intronic
1185606068 X:1367699-1367721 GCCGGGTGCGCGGGGTGAGCGGG + Intronic
1185606074 X:1367717-1367739 GCGGGGTGCGCCGGGTGAGCGGG + Intronic
1185606086 X:1367753-1367775 GCGGGGTGCGCCGGGTGAGCGGG + Intronic
1185606097 X:1367789-1367811 GCGGGGTGCGCCGGGTGAGCGGG + Intronic
1188881861 X:35499553-35499575 GCGGGGGGAGCCGGGGGAGCGGG - Intergenic
1189659345 X:43279771-43279793 GCCGGGCGGGCCGGGGGCGGGGG + Intergenic
1196888576 X:120270792-120270814 GCAGGGAGGCCCGGGGGTGCTGG - Intronic
1200155436 X:153972420-153972442 GAGGCGCGCCGCGGGGGAGCCGG + Exonic
1200162755 X:154017854-154017876 GCCGGGTGCTGCTGGGGAGCTGG + Intronic
1201178285 Y:11322727-11322749 AACGGAGGCCCCGGGGGAGCTGG + Intergenic
1201179869 Y:11333500-11333522 AACGGAGGCCCCGGGGGAGCTGG + Intergenic