ID: 1133273518

View in Genome Browser
Species Human (GRCh38)
Location 16:4623397-4623419
Sequence CTTGGGAAGCCAAATGAGTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 185}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133273518_1133273519 -7 Left 1133273518 16:4623397-4623419 CCGTACTCATTTGGCTTCCCAAG 0: 1
1: 0
2: 1
3: 11
4: 185
Right 1133273519 16:4623413-4623435 TCCCAAGTTCCCCTGACAAGAGG 0: 1
1: 1
2: 0
3: 5
4: 146
1133273518_1133273527 16 Left 1133273518 16:4623397-4623419 CCGTACTCATTTGGCTTCCCAAG 0: 1
1: 0
2: 1
3: 11
4: 185
Right 1133273527 16:4623436-4623458 AAGTCTGAGGCCAGGTGCAGTGG 0: 1
1: 23
2: 204
3: 1246
4: 5869
1133273518_1133273524 3 Left 1133273518 16:4623397-4623419 CCGTACTCATTTGGCTTCCCAAG 0: 1
1: 0
2: 1
3: 11
4: 185
Right 1133273524 16:4623423-4623445 CCCTGACAAGAGGAAGTCTGAGG 0: 1
1: 0
2: 1
3: 27
4: 178
1133273518_1133273526 8 Left 1133273518 16:4623397-4623419 CCGTACTCATTTGGCTTCCCAAG 0: 1
1: 0
2: 1
3: 11
4: 185
Right 1133273526 16:4623428-4623450 ACAAGAGGAAGTCTGAGGCCAGG 0: 1
1: 0
2: 2
3: 37
4: 424

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133273518 Original CRISPR CTTGGGAAGCCAAATGAGTA CGG (reversed) Intronic
900040094 1:453469-453491 CTTGGGAAGGGAAATGCCTATGG + Intergenic
900430448 1:2599130-2599152 CTGGTGAAGCCAAATGGGTCTGG - Intronic
903038846 1:20513240-20513262 TTTGGGAAGCCAAAGCAGGAGGG + Intergenic
906433119 1:45772228-45772250 CTTGGGAAGCCCAAGGTGGATGG - Intergenic
908612073 1:65873289-65873311 CTCGGGAAGTAAGATGAGTAGGG + Intronic
908851770 1:68384067-68384089 CTAAGGAAGCCAAAGGAGTCTGG + Intergenic
910643748 1:89491179-89491201 CTTGGGAAGCACAAGGAGTCAGG + Intergenic
911859941 1:102933898-102933920 CTTGGGAAGCAAAAGGGGTCAGG - Intronic
914801956 1:150968513-150968535 CTGGGGAAGGGATATGAGTAAGG + Intronic
915999843 1:160605391-160605413 CTTGGGAAGCCCCATCTGTAGGG - Intergenic
917047156 1:170873697-170873719 CATGGTAAGCCAAAAAAGTAAGG - Intergenic
917098435 1:171422921-171422943 CTTGGGAATCTAAAGGAGGAAGG + Intergenic
918198371 1:182243917-182243939 CTTGTGAAGCCAAATGCAGAAGG - Intergenic
918325511 1:183406292-183406314 CTTGTGAAGCCGAAAGAGAAGGG + Intronic
919846649 1:201647180-201647202 CTTGGGAGGCCATTTGAGGATGG + Intronic
920954713 1:210607859-210607881 CTTGGGGAGGAAAATGAGCAGGG - Intronic
921495858 1:215840739-215840761 CTTGGTAAAGCAAATGAATAAGG + Intronic
922170469 1:223150339-223150361 CTTGGGAAGCTGAGTGAGGAGGG - Intergenic
924008985 1:239643702-239643724 CTTGGGAAGCGCAAGGAGTCAGG - Intronic
924797904 1:247305835-247305857 TTTGGGAAGCCAAAGCAGAAAGG + Intronic
1065905279 10:30245485-30245507 TTTGGGAGGCCAAGGGAGTAGGG + Intergenic
1068158658 10:53235173-53235195 CTTGGGCCTCCAAATCAGTAAGG - Intergenic
1069357840 10:67608102-67608124 TTTGAGAGGCCAAATGAGTTAGG + Intronic
1071500266 10:86198431-86198453 CTTGGGAAGCCAAGGAAGAATGG + Intronic
1074089440 10:110234638-110234660 CTTTGGAAGTCAGATGAGTTAGG + Intronic
1075914036 10:126150588-126150610 CTTGGGAAGTCAAAGGAGACAGG - Intronic
1078417954 11:11180983-11181005 CTTGGGGAGGCAAAGGAGAAAGG - Intergenic
1081439372 11:43063459-43063481 ATTGGCAAGCCAACTGATTATGG - Intergenic
1082060733 11:47857923-47857945 CTTGGCAGGCAAAATGAGGAAGG - Intergenic
1083172678 11:60932199-60932221 CTTGGGGACCCACATGAGGAAGG - Intronic
1084912973 11:72406188-72406210 CTTGGGCAGGAAAATGAGAAAGG + Intronic
1085716299 11:78876668-78876690 CTTGGACAGCCAGATGTGTAAGG - Intronic
1087934065 11:104011768-104011790 TTTGTGAAGATAAATGAGTATGG + Intronic
1088009436 11:104981570-104981592 CTGGGGAAGCTATCTGAGTAGGG + Intergenic
1089037270 11:115407760-115407782 CTTGGGAAGCCAAGGAAGGAGGG + Intronic
1090093001 11:123715924-123715946 CTTGGGAAGGAAAAGGAGTGTGG - Intergenic
1090509844 11:127363358-127363380 CTTGGGAAGCCCAAGGGGTCAGG + Intergenic
1091021602 11:132104995-132105017 CATGGGAAGCCAAATGAGGAGGG + Intronic
1091825803 12:3511853-3511875 CTTAGGAAGCCAAAGAAGGATGG - Intronic
1092677382 12:10936199-10936221 CTGGGGAAGACAAACCAGTAAGG + Intronic
1092734970 12:11573266-11573288 TTTGGGAAGCCAAAGCAGGAGGG - Intergenic
1093430449 12:19079458-19079480 CTTGCGAAGCCAAATTAACAAGG - Intergenic
1094785959 12:33848325-33848347 CTTGGGAAGCACAAGGAGTCAGG + Intergenic
1097824476 12:64160611-64160633 CTTGTGAAGACAAAGGGGTAAGG - Exonic
1099234036 12:80060951-80060973 CTTGGAAAGCAAAATGAATGCGG + Intergenic
1101475510 12:105043198-105043220 CTTCTGAAGGCAAATGAGCAAGG - Intronic
1102274951 12:111574663-111574685 TTTGGGAAGCCAAGGGAGGAGGG - Intronic
1106794471 13:33190197-33190219 CTTTGGAAGGCCAATGAGGAAGG + Intronic
1107100598 13:36586768-36586790 TTTAGGAAGCCAAATGAAGAAGG - Intergenic
1113423204 13:110186049-110186071 CGGGGAAAGCCAAATGGGTAAGG + Intronic
1114828190 14:26106606-26106628 CTTGGGAAGCCCAAGGGGTCAGG + Intergenic
1115719877 14:36148472-36148494 CTTGGGAAGCCCAAGGGGTCAGG - Intergenic
1116281876 14:42918442-42918464 CTTGGGAAGCCTCATGATCATGG - Intergenic
1120636876 14:86964156-86964178 CTGGGGAAGCCTCATGAGCATGG - Intergenic
1120878728 14:89398088-89398110 TTGGGGAAGCCAAAGGAGAAGGG - Intronic
1121501225 14:94439962-94439984 CTTGGGAAGCCAGTTGAGGCAGG - Intergenic
1202876612 14_KI270722v1_random:8679-8701 CTTGGGAAGCACAATGGGTCAGG + Intergenic
1123587885 15:21775137-21775159 TTTGGGAGGCCAAATGGGGAGGG - Intergenic
1123624523 15:22217702-22217724 TTTGGGAGGCCAAATGGGGAGGG - Intergenic
1129223556 15:74150621-74150643 CTTGGGAGGCCGAATGAGGCAGG - Intergenic
1130751392 15:86716813-86716835 ATTGGGAATCCAAATGAGGTGGG + Intronic
1131719045 15:95147212-95147234 CTGGAGAAGCCCAAAGAGTAGGG + Intergenic
1132205353 15:99982713-99982735 CTTGGGAAGCCACATGAAATTGG - Intronic
1132441811 15:101874149-101874171 CTTGGGAAGGGAAATGCCTACGG - Intergenic
1133273518 16:4623397-4623419 CTTGGGAAGCCAAATGAGTACGG - Intronic
1134390209 16:13812952-13812974 CTTGGGAAGCTTAAAGAGCAGGG + Intergenic
1139489954 16:67280688-67280710 CTTGGGAAGGGAAATGACTTGGG - Intronic
1140402585 16:74683698-74683720 CTTGGGAATCCAGTTGAGTGAGG - Intronic
1140514208 16:75530440-75530462 CTTGGGAAGTCCAATGGGTAGGG - Exonic
1141979974 16:87544136-87544158 CTTGGGAACGCAAATGAGGTTGG - Intergenic
1143389440 17:6551630-6551652 TTTGGGAAGCCAAAGCAGGAAGG + Intronic
1143527724 17:7482152-7482174 CCTGGTAAGCCATATGAGAAAGG - Exonic
1143603000 17:7961404-7961426 CTTGGAAAGGTAAATGAGGAAGG + Intergenic
1144032715 17:11336589-11336611 CTTGCGAAGGCAGATGAGGAGGG + Intronic
1145060029 17:19727425-19727447 CTTGGGAAGGCAAAGGGGTGAGG - Intergenic
1145359287 17:22198932-22198954 TTTGGGATGCCACATGAGGAAGG - Intergenic
1146957834 17:36947117-36947139 CTTGGGAAGCCATTTTAGCAAGG - Intergenic
1148667154 17:49383311-49383333 CTTGGGAATCCAGATGGGTTGGG - Intronic
1148986725 17:51628951-51628973 TTTGGGAAACCTAGTGAGTATGG + Intergenic
1149060191 17:52412527-52412549 CTTGGGAAGCAAAACAAGTCAGG + Intergenic
1149810324 17:59663218-59663240 ATTGGGCAGCTGAATGAGTAAGG + Intronic
1150518884 17:65845471-65845493 CTTGGGCAGCTAAGTTAGTATGG + Intronic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1153229126 18:2920142-2920164 CCTGGGAAGGCAAAGGAGGATGG + Exonic
1156368150 18:36448545-36448567 CTTGGGAAGCCAAGTCAGCCTGG - Intronic
1157090415 18:44630331-44630353 ATTGGGAAGACAAAAGAGAAGGG - Intergenic
1158541139 18:58355481-58355503 CTTGCGAATCCCAATGAGTCAGG + Intronic
1160179991 18:76625637-76625659 CTTGTGCATCCAAATCAGTAAGG - Intergenic
1165723245 19:38094491-38094513 TTTGGGAAGCCAAAGGAGGAGGG - Intronic
1167105330 19:47427146-47427168 TTTGGGAAGCCAAAGCAGAAGGG - Intergenic
1167111352 19:47463748-47463770 TTTGGGAAGCCAAATGCATAGGG + Intronic
1168509227 19:56961416-56961438 CTTGGCAAGCCCGATGGGTAGGG - Intergenic
925081802 2:1075249-1075271 CTTGGGATGCAAAGTGAGTGGGG + Intronic
925699355 2:6618074-6618096 AGTGGGAAGGGAAATGAGTAAGG + Intergenic
926203290 2:10816712-10816734 CTTGGGAAGCAAAATAACTGCGG - Intronic
926253010 2:11166529-11166551 CTTGGGAGAGCAAATAAGTAGGG + Intronic
926490393 2:13519084-13519106 TGTGAGAATCCAAATGAGTAGGG - Intergenic
926783199 2:16494579-16494601 GCTGAGAAGACAAATGAGTAAGG - Intergenic
929692476 2:44086398-44086420 TTTGGGAAGCCAAAGGTGGAAGG - Intergenic
931723056 2:65081349-65081371 CTAGGGAAGCCACATCAGTGCGG - Intronic
932608289 2:73178514-73178536 CTTGGGAGGCTAAGGGAGTATGG + Intergenic
935837571 2:107072185-107072207 CTTGGGATGCCACATGAGTTTGG + Intergenic
939164787 2:138628763-138628785 TTTGGGAAGACAAATGAGAAGGG - Intergenic
939900182 2:147842186-147842208 TTTGGGAAGGAAAATGAGAAAGG - Intergenic
940401917 2:153257261-153257283 CTTGGGAAGCCCAAGGGGTCAGG - Intergenic
940983174 2:160025031-160025053 CTTGGGAAGCAGAACCAGTATGG - Intronic
941775087 2:169384682-169384704 ATTGAGGAGCCAAATGAGTAAGG - Intergenic
941903931 2:170703313-170703335 CTTGGGAAGACAAATTGGTTTGG - Intergenic
942004634 2:171685714-171685736 CTTGGGAAGAGAAAAGAATATGG - Intergenic
942254524 2:174082733-174082755 TTTGGAAAGCCAAATCAGTTAGG + Intronic
944223291 2:197323785-197323807 CTTGGGAGGTGAAGTGAGTAAGG - Intergenic
1169803219 20:9532661-9532683 CTTGGCAAACCACATGGGTATGG + Intergenic
1170363737 20:15577156-15577178 CTTCTGAAGACAAAGGAGTAGGG - Intronic
1171154860 20:22862590-22862612 TGTGTGAAGCCAAAGGAGTAAGG - Intergenic
1171325211 20:24285109-24285131 CTTAGGAATCCAAATGAGGGAGG - Intergenic
1173334609 20:42102326-42102348 CAGGGGCAGCCAAATGAGCAGGG - Intronic
1174721592 20:52818728-52818750 ATTAGGAAGCCAAGTGAATATGG - Intergenic
1175538706 20:59734498-59734520 CTTGGGAAGCCAATGCAGGAGGG - Intronic
1179473822 21:41630941-41630963 CTTGGGGTGCCAAATGCGTCTGG + Intergenic
1180504965 22:15985899-15985921 CTTGGGAAGCCCAAGGGGTCAGG - Intergenic
1180519471 22:16183915-16183937 CTTGGGAAGCGCAAGGGGTAAGG + Intergenic
1180898753 22:19356186-19356208 CTTGGGCCCCCAAAAGAGTAGGG + Intronic
1184488554 22:44796017-44796039 CCTGGGAAGCCAGGTGAGGAGGG - Intronic
1185091456 22:48777933-48777955 CTTTGGAAACCAAGTGAGTGTGG + Intronic
1185205123 22:49533421-49533443 ATTTGGAAGTCAAATGAGTGGGG + Intronic
1203333695 22_KI270739v1_random:36147-36169 CTTGGGAAGCCCAAGGGGTCAGG + Intergenic
950991955 3:17449117-17449139 CCTGGGAAGCCCAAGGAGTTGGG + Intronic
952028481 3:29111896-29111918 CTTGGGAAGCCCAAGGGGTCAGG - Intergenic
952534879 3:34298615-34298637 CTTGGGAAGTCAGATAAGAATGG - Intergenic
955258532 3:57360252-57360274 TTGGGGGAGCCAAAGGAGTAGGG - Intronic
962748683 3:138416952-138416974 CTTGGGAAGACAAGTAAGTTTGG - Intergenic
969056509 4:4405962-4405984 GTTGGGAAGCCACATCAGTTTGG - Intronic
969130745 4:4989574-4989596 CTTGTGAAGCCAAAAGAGGTGGG + Intergenic
970777356 4:19691515-19691537 CTTTGGCAGCCAAAGCAGTATGG + Intergenic
973155253 4:46943691-46943713 CTGGGTAAGCCAAGTGAATATGG - Intronic
973704141 4:53564827-53564849 CTTGGGAAGCGCAAGGAGTCAGG + Intronic
973802320 4:54491660-54491682 CTTGAGAAGAAAAATGAGTGGGG + Intergenic
974787436 4:66637343-66637365 GTTAGGAAGGCAAATGAGTTTGG + Intergenic
977676862 4:99757647-99757669 CTTAGGAAGAAAAAGGAGTAGGG - Intergenic
982988289 4:162238386-162238408 CATGAGAAGCCAAATGAGGGAGG - Intergenic
983018567 4:162645624-162645646 CTTAGGAAGGCAAAAAAGTACGG - Intergenic
983594273 4:169448862-169448884 CCTGGGAAGCGCAATGAGTCGGG + Intronic
985546098 5:509956-509978 CCTGGGAAGCCAGCTGAGTGTGG - Intronic
987182682 5:15384620-15384642 CATCGGAAGCCTAATGAGTGTGG - Intergenic
988373656 5:30405325-30405347 AATGGGAAACCAAAAGAGTATGG + Intergenic
990153877 5:52852111-52852133 CTTGGGAAGCCACAAGAGCAAGG + Intronic
992296620 5:75333197-75333219 CTTGGGAAGCTAGCTGAGTCAGG + Intergenic
993197877 5:84773554-84773576 CTTGGGAAGCCATTTAAGTCTGG - Intergenic
995614598 5:113946820-113946842 ATTGAGAAGCCAAAGGAGAAAGG - Intergenic
995647209 5:114326428-114326450 ATTGGGAAGGCAAAAGAGTGTGG + Intergenic
996289922 5:121840626-121840648 CTTGGGAAGCAAACAGGGTAGGG - Intergenic
996755195 5:126927668-126927690 CCTGGGAAGCCAAGTGTGTAAGG + Intronic
1001219138 5:169884143-169884165 CTTGGAAAAACAAATGAGTTAGG + Exonic
1002733753 5:181365474-181365496 CTTGGGAAGGGAAATGCCTATGG - Intergenic
1003852179 6:10236456-10236478 CCTGGGAAGCGAAATGATTCAGG + Intergenic
1004485717 6:16064699-16064721 CTTAGGAAAGCAGATGAGTACGG - Intergenic
1007290950 6:40786260-40786282 CTTGGGGGCCCAAATGAGGATGG + Intergenic
1008928744 6:56914911-56914933 CTAAGGAAGGCAAATGAGGAAGG + Intronic
1011165882 6:84445340-84445362 CTTGTGAAACCACATTAGTATGG - Intergenic
1012140915 6:95625573-95625595 CTTGGGAAACCAAATGTTTAGGG - Intergenic
1012204778 6:96447740-96447762 TTTTGAAAGGCAAATGAGTAAGG + Intergenic
1018870151 6:167776597-167776619 ATTGGGAAGAGAAATGTGTATGG - Intergenic
1020884659 7:13806462-13806484 CTTGGGAAGCCCAAGGGGTCAGG + Intergenic
1022376145 7:29813216-29813238 TTTGGGGACCCACATGAGTAAGG - Intronic
1027304462 7:76877872-76877894 GTTGGTATGCCAAATAAGTATGG - Intergenic
1029451947 7:100646412-100646434 CTTGGGAAGCCACAGGGGCAGGG + Intronic
1029516539 7:101026956-101026978 TTTGGGAAGCCAAGTGGGGAGGG - Intronic
1033192700 7:139296574-139296596 CTTGGAAAGCCAACAGAATATGG - Intronic
1035273676 7:157734706-157734728 ATTTCGAAGCCAAATGAGAATGG - Intronic
1035509768 8:168815-168837 CTTGGGAAGGGAAATGCCTATGG + Intergenic
1038335135 8:26639995-26640017 CTTGGAAAGGCAAAGGAGAATGG + Intronic
1038361148 8:26878737-26878759 CTTGGGAGTCCAAAGAAGTAAGG - Intergenic
1041998640 8:64093834-64093856 TTTGGGAAGCCAAGTAAGCAAGG + Intergenic
1042420152 8:68578902-68578924 ATTGGAAAGCAAAAGGAGTATGG - Intronic
1043072670 8:75658480-75658502 CTTTGGAAGCCAAATAAGTTAGG + Intergenic
1045265454 8:100614941-100614963 CTGGGGAAGCAAAGTGAGAATGG + Intronic
1045429810 8:102103076-102103098 TTGGGGAAACCAGATGAGTAAGG + Intronic
1045607076 8:103789080-103789102 CTTGGGAAGCGCAATGGGTCAGG - Intronic
1046322196 8:112594201-112594223 CTTGGGAAGCCCAAGGGGTCAGG + Intronic
1046767701 8:118088135-118088157 CTTGGGAACTCAAATCAGCAAGG + Intronic
1047231992 8:123005406-123005428 CTTTGGAAACCCAAGGAGTAAGG - Intergenic
1047887446 8:129267530-129267552 CTGGGGATACCAAATGAGTCTGG - Intergenic
1047959794 8:130002853-130002875 TTTGGGAAGCCAAGCGAGGAGGG + Intronic
1048960389 8:139572094-139572116 CTCAGGAAGTCAAATGAGTCTGG + Intergenic
1052870073 9:33496706-33496728 CTTGGGAACCTAAATGAGTTAGG - Intergenic
1053714525 9:40873784-40873806 CTTGGGAAGCTCAAGGAGTCAGG + Intergenic
1055853542 9:80659918-80659940 CTTGGGAAGCCCAAGGGGTCAGG - Intergenic
1056292337 9:85156532-85156554 CTTAGGAATCCAAGTGAGGAAGG - Intergenic
1059489542 9:114655797-114655819 CTTGGAAAGCAAAATGACAAAGG - Intergenic
1060759042 9:126233396-126233418 CTTGGGAAGCCAAGGGAGCGGGG - Intergenic
1061644393 9:131988718-131988740 CTTGGGAGGCCAAAGGGGGAAGG - Intronic
1186140883 X:6572299-6572321 CTTGGGAAGCCAAAGTGGGAGGG + Intergenic
1189165540 X:38857419-38857441 TTTGGGAAACAAAATGAGGAGGG - Intergenic
1191969220 X:66794965-66794987 CCTGGGAAGCCCAAGGGGTAAGG - Intergenic
1192289467 X:69777688-69777710 CTTGTGATGCCATATGAGTTGGG + Intronic
1193003014 X:76583765-76583787 CTTGGGAAGCACAAGGAGTCAGG - Intergenic
1193590706 X:83385230-83385252 CTTAGGAAGCCAAATCTCTAGGG + Intergenic
1195796593 X:108655111-108655133 CTTGAGAAGCCAAGTGCCTAAGG - Intronic