ID: 1133277244

View in Genome Browser
Species Human (GRCh38)
Location 16:4646462-4646484
Sequence GGGCTTGCCTGGGCATGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 467
Summary {0: 1, 1: 1, 2: 2, 3: 32, 4: 431}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133277230_1133277244 24 Left 1133277230 16:4646415-4646437 CCTGTCTCAAAAAAAAAAAAAGC 0: 38
1: 1245
2: 18051
3: 25150
4: 43895
Right 1133277244 16:4646462-4646484 GGGCTTGCCTGGGCATGGAGGGG 0: 1
1: 1
2: 2
3: 32
4: 431
1133277229_1133277244 25 Left 1133277229 16:4646414-4646436 CCCTGTCTCAAAAAAAAAAAAAG 0: 781
1: 15625
2: 21086
3: 49277
4: 165965
Right 1133277244 16:4646462-4646484 GGGCTTGCCTGGGCATGGAGGGG 0: 1
1: 1
2: 2
3: 32
4: 431

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133277244 Original CRISPR GGGCTTGCCTGGGCATGGAG GGG Intronic
900124439 1:1063209-1063231 GGCCCTGGCTGGGCATGGACAGG + Intergenic
900310010 1:2029062-2029084 GGGCTGGGCTGGGCAGGGATGGG + Intronic
900340606 1:2187085-2187107 GGGCCTGCGTGGGCGTGGTGCGG + Intronic
900347067 1:2215022-2215044 TGGCTGGCCTGGGCCTGGTGAGG - Intergenic
900388145 1:2419965-2419987 GGGGTTGCCTGGGGGTGGGGGGG - Intergenic
900423208 1:2564597-2564619 GGGCCTCCCTGTGCATGGACCGG + Intronic
900568400 1:3346614-3346636 GGGCCTGGCTGGCCATCGAGAGG - Intronic
900773858 1:4566918-4566940 GGGCTTGCACTGGCATGAAGAGG + Intergenic
900911152 1:5597816-5597838 GGGCTTCCCAAGGCAAGGAGGGG + Intergenic
901054339 1:6441767-6441789 GGGGCAGCCTGGCCATGGAGGGG + Intronic
901069467 1:6509927-6509949 GGCCTTGCCTGGGGACGGGGAGG - Intronic
901381159 1:8875451-8875473 GGGCTGGCATGGGAATGGAAAGG + Intronic
901756910 1:11446947-11446969 GGGCATGCCTGGGGGAGGAGTGG - Intergenic
902304653 1:15526856-15526878 GCGCTCGCCTGGGCCTGGGGAGG - Exonic
902396273 1:16133823-16133845 GGGCAGGGCTGGGCCTGGAGCGG + Intronic
902479969 1:16706567-16706589 GGGGCAGCCTGGCCATGGAGTGG - Intergenic
903168707 1:21538784-21538806 GGGCTTGCAGTGGCAGGGAGGGG - Intronic
903660202 1:24972466-24972488 GGACTTGCCTGGGCTTGCATAGG + Intergenic
904079504 1:27863081-27863103 TGGCTTGGCAGGGCAGGGAGGGG - Intergenic
904329289 1:29747445-29747467 GGGCAGCCCTGGGCAGGGAGAGG - Intergenic
904371189 1:30048482-30048504 GGGCAGCCCTGGGCAGGGAGAGG - Intergenic
904465347 1:30704431-30704453 GGGCTGGGCTGGGCTGGGAGAGG - Intergenic
904636292 1:31884130-31884152 GGGCTTTGCAGGGCAGGGAGAGG + Intergenic
904756415 1:32770981-32771003 GGCCTTGCCTGGGGAAGCAGGGG - Exonic
905172100 1:36115388-36115410 GGGCTGGGCTGGGCAGGGAGGGG + Intronic
905883463 1:41479201-41479223 GGGCTTCCCTGGGCAGTGCGAGG + Exonic
906294863 1:44643467-44643489 GGGCTTGGTTGTGCATGCAGTGG + Intronic
906684966 1:47757380-47757402 GGGATGGGCTGGGCTTGGAGGGG - Intergenic
907089242 1:51709301-51709323 GGGCTTGCATGGGGAAGCAGTGG - Intronic
907400043 1:54219493-54219515 AGGCTTGGCTGGGGCTGGAGTGG + Intronic
907420292 1:54342525-54342547 GGCCTTGCCTGGGAATGGGAGGG - Intronic
908807604 1:67947169-67947191 GCGATTGGCTGAGCATGGAGAGG + Intergenic
909695625 1:78465358-78465380 GGGTTTAGCTGGGGATGGAGTGG + Intronic
909792172 1:79693392-79693414 GGGCTGGAGTGGACATGGAGTGG + Intergenic
909953284 1:81746376-81746398 AGGATTGCCTGAGCCTGGAGAGG - Intronic
912143309 1:106758544-106758566 GGGATTGGCTGGGCAGGAAGGGG - Intergenic
913162691 1:116159351-116159373 AGGCTTGCCTGGGCACTGGGAGG - Intergenic
914912876 1:151801328-151801350 GGGCTTGGCTGGGCAGGGCTGGG - Exonic
915489202 1:156242104-156242126 GGGCATGCCTGACCATGGTGCGG - Exonic
915680636 1:157578822-157578844 GGACTCTCCTGGGCCTGGAGCGG + Exonic
915699914 1:157782096-157782118 GTTCTTTCCTGGGAATGGAGTGG - Intergenic
915902243 1:159855287-159855309 GGGATTGCAGGGGCCTGGAGGGG - Exonic
915954091 1:160208636-160208658 GGTCTGGCCTGGCCATGGTGGGG - Intronic
918328397 1:183432254-183432276 AGGGTTAGCTGGGCATGGAGCGG + Intergenic
918925601 1:190782078-190782100 AGATCTGCCTGGGCATGGAGTGG - Intergenic
919584270 1:199416550-199416572 AGATCTGCCTGGGCATGGAGTGG - Intergenic
920367495 1:205455788-205455810 GGGCTTGGCTGGGCGAAGAGGGG - Intronic
920694787 1:208174158-208174180 CCACTTGCCTGGTCATGGAGGGG + Intronic
920969971 1:210734752-210734774 GGGCTTCCTAGGGCCTGGAGAGG + Intronic
922455130 1:225768271-225768293 GGACTTGTCTGAGCAGGGAGTGG + Intergenic
922535994 1:226381427-226381449 AGGCTGGCCTGGCCATGGAGTGG - Intronic
922674766 1:227543429-227543451 AGGCTGGCCTGGCCATGGACTGG + Intergenic
923633305 1:235670095-235670117 GGGCATGTCTGGGCATATAGAGG - Intronic
924052545 1:240092840-240092862 GGGCCTTCCTGGGCCTGGACCGG + Exonic
924674281 1:246159795-246159817 GGGCTCGCCAGGTCCTGGAGTGG + Intronic
1062799683 10:369836-369858 GGGATTCCCTGGGAATGTAGAGG - Intronic
1063698082 10:8356958-8356980 GCATTTGCCTAGGCATGGAGGGG + Intergenic
1064011870 10:11742323-11742345 GGGCGTGCCGGGGCGGGGAGGGG + Intergenic
1064130041 10:12701467-12701489 GGGCTGGCCTGGGGATGGGGAGG + Intronic
1064620282 10:17208630-17208652 GGCCTTGCCTGGGTGTAGAGGGG - Intergenic
1065352006 10:24804151-24804173 GGGCTTTCCTGGGCGGGGCGTGG - Intergenic
1065788921 10:29242100-29242122 GAACATGCCAGGGCATGGAGTGG + Intergenic
1066224388 10:33368175-33368197 GGGCTTGGCTGGGCTTGGCTGGG + Intergenic
1067433041 10:46256498-46256520 GTGCTGGCCTGTGTATGGAGAGG + Intergenic
1067707577 10:48621626-48621648 GGGCATGTTGGGGCATGGAGTGG + Intronic
1067740420 10:48891195-48891217 GGGATGGCCTGGGACTGGAGTGG + Intronic
1067751957 10:48977576-48977598 GGGATGGCCTGGGCTTGGTGGGG + Intronic
1067776129 10:49166064-49166086 GGGCTGGTCTGGGCCGGGAGAGG - Intronic
1067837518 10:49650813-49650835 TGGCTTCAGTGGGCATGGAGGGG + Intronic
1069854551 10:71432768-71432790 GGGCTGGACTCGGGATGGAGAGG + Intronic
1069959841 10:72073174-72073196 GGGCTGGACTGGGAACGGAGTGG - Intronic
1070764206 10:79047268-79047290 GGGCTACCCTGGGCATGGGGAGG + Intergenic
1071385551 10:85116626-85116648 GTGGTTGCCTGGGGATGGGGAGG - Intergenic
1072034489 10:91551883-91551905 GGGCTTCCATGGGGAAGGAGAGG + Intergenic
1073390838 10:103175468-103175490 GGGGTTGGCTGGGCAGGCAGAGG - Intronic
1074149027 10:110741816-110741838 GGGCTCTCCTGGGGAGGGAGGGG - Intronic
1074269937 10:111944304-111944326 GTGCTTCCCTGGGCAGGGGGAGG - Intergenic
1074779104 10:116787820-116787842 TGGAGTGCCTGGTCATGGAGGGG + Intergenic
1074815898 10:117140508-117140530 GGGCCTCCTTGGGCAGGGAGGGG + Intergenic
1076168710 10:128302793-128302815 GGGCTGGGATGGGAATGGAGAGG - Intergenic
1076530322 10:131140605-131140627 TGGCTTTCCTGGGCACGAAGAGG + Intronic
1076709088 10:132321289-132321311 GGGCTTGGCTGGGCTTGGCTGGG - Intronic
1077155319 11:1088500-1088522 GGGCTGGCCGGGCCATGGTGGGG + Intergenic
1077574864 11:3375174-3375196 GGGCATGTCTGGGCAGGGAGAGG + Intronic
1078989594 11:16633012-16633034 GGATCTGCCTGGGCATGAAGTGG + Intronic
1079363821 11:19792016-19792038 GGACTGTCCTGGGCATGGTGGGG + Intronic
1080125308 11:28727002-28727024 AGGCTTGACTAGGCCTGGAGAGG - Intergenic
1081847112 11:46248666-46248688 GGGGTTGACTGAGAATGGAGGGG - Intergenic
1081925695 11:46826553-46826575 GTGCTTGTTTGGGCATGCAGTGG - Intronic
1082114362 11:48312280-48312302 GGGCTTCTCTGGGGCTGGAGTGG + Intergenic
1083428331 11:62601160-62601182 GGGCTCCCCGGGGCACGGAGTGG - Intronic
1083660355 11:64249186-64249208 GGGTGTGCCTGGGCATGGCGCGG - Intergenic
1084150832 11:67287204-67287226 GGGCTTTGCTGGGCATGGCTGGG + Intergenic
1084467926 11:69337687-69337709 GTGCTTTAGTGGGCATGGAGTGG + Intronic
1085205506 11:74729829-74729851 GAGATTGGCTGGGCATGGGGAGG + Intronic
1085271599 11:75273220-75273242 ACGCTGGCCTGGGCAGGGAGAGG - Intronic
1085299352 11:75449409-75449431 GGGGTGGCCTGGGGATGGGGTGG - Intronic
1085299831 11:75451325-75451347 GGGCGTGCCTGGGCCTGTGGGGG + Intronic
1085510702 11:77086712-77086734 GGGGTAGCCAGGGGATGGAGTGG - Intronic
1086755589 11:90558091-90558113 AGATTTGCCTGGGCATGGAATGG - Intergenic
1087562073 11:99802954-99802976 AGACCTGCCTAGGCATGGAGTGG + Intronic
1088521684 11:110708709-110708731 GTGGTTGCCTGGGAATGGGGAGG + Intronic
1089067158 11:115670675-115670697 GGGCCTGCCTGGGCTTGGCAGGG + Intergenic
1089325900 11:117656785-117656807 GCCCTGGCCTGGGCATGGACTGG - Intronic
1089387861 11:118079724-118079746 GGGCTTGGCTGGGCTTGGCTGGG + Intronic
1090632356 11:128661009-128661031 GGGAATGCCTGGGGGTGGAGTGG - Intergenic
1091300046 11:134501960-134501982 GGGCTGGGCTGGGCAGGGATGGG + Intergenic
1091778677 12:3200497-3200519 GGGCTGGGCTGGGCTGGGAGAGG + Intronic
1091795285 12:3294488-3294510 GAGCCAGCCTGGGCAGGGAGGGG - Intergenic
1093800476 12:23366364-23366386 GGGCAAGAGTGGGCATGGAGAGG - Intergenic
1094807458 12:34107096-34107118 AGGCTGGCCTGGCCATGGACTGG - Intergenic
1095212518 12:39510263-39510285 TGGCATGCCTGGGCACTGAGGGG - Intergenic
1095626264 12:44318537-44318559 AGATTTGCCTGGGCATGAAGTGG + Intronic
1095945525 12:47751347-47751369 GGGCTGGGCTGGGCAGTGAGGGG - Intronic
1096528836 12:52231016-52231038 GTGCTGGCCTGTGAATGGAGAGG + Intergenic
1096624397 12:52885041-52885063 GGGCCTGCCTTGGGGTGGAGAGG - Intergenic
1096774102 12:53953960-53953982 GGGCTTGACTGGGCTGAGAGGGG - Intergenic
1098584663 12:72141821-72141843 AGGCTTGCCTGGGGCAGGAGAGG + Intronic
1101788102 12:107903814-107903836 GGGCGTGGCTGGGCGTGGATGGG - Intergenic
1102486040 12:113258004-113258026 GTGGTTGCCTGGGCATGGATGGG + Intronic
1102716009 12:114973481-114973503 GTGTTTGCCTGGGACTGGAGTGG + Intergenic
1103229168 12:119313745-119313767 GAGCTTACATGGGCATGGAGGGG - Intergenic
1103543294 12:121681178-121681200 GTGCTTGCCAGGGACTGGAGAGG + Intergenic
1103727423 12:123005018-123005040 TGTCTTCCCTGGGCATGGAGGGG + Intronic
1103884677 12:124191555-124191577 GGGAGAGCCTGGGCATGCAGGGG - Intronic
1104717659 12:131026661-131026683 GGGCTGGCCTGGGCATTGCAGGG + Intronic
1104894964 12:132159542-132159564 GGGTGTGGCTGGGCGTGGAGGGG + Intergenic
1105529295 13:21203757-21203779 GGGCATGCGTGGGCTTGGTGGGG - Intergenic
1105574805 13:21640446-21640468 GGGCTCTCCTGGGCAAGGACAGG - Intergenic
1106512362 13:30422314-30422336 GGGCTGGGCTGGGCTGGGAGGGG - Intergenic
1107158507 13:37197990-37198012 GGGTGTGCCTAGGCATGGAGTGG + Intergenic
1107585262 13:41840302-41840324 GGGCCTGTCTGGGGATGGCGGGG + Intronic
1108453412 13:50589185-50589207 GGGCTTGCCTGAGCATCTTGAGG + Intronic
1110638235 13:77791004-77791026 AGATCTGCCTGGGCATGGAGTGG - Intergenic
1111513774 13:89299744-89299766 GTGTTTGCCTGGGCATGAAGCGG + Intergenic
1112487584 13:99834081-99834103 GGGCATGGCTGAGCATGCAGTGG + Intronic
1112599181 13:100838567-100838589 GGGCATGGCTGGGAGTGGAGTGG + Intergenic
1112620217 13:101047156-101047178 GGGCTTCCCTTGGCTAGGAGAGG + Intergenic
1114525757 14:23366116-23366138 GGACTCGCCTGGGCTGGGAGTGG + Intergenic
1114665339 14:24374277-24374299 TGGCTGGGCTGGGCATGGAGGGG - Intronic
1115842242 14:37484994-37485016 GGGCTTGTCAGGGGGTGGAGGGG - Intronic
1116962262 14:50978445-50978467 GGCCTTGCATGGGCAAGGAATGG - Intronic
1117279017 14:54219570-54219592 GGGCCGGCCTGGGCAGGGAGCGG + Intergenic
1119535855 14:75401999-75402021 GGGCTTGCCTGGTCTCAGAGTGG - Intergenic
1119545424 14:75468219-75468241 GGGCTGGCCTGTGCATTGAAGGG + Intronic
1121306028 14:92907524-92907546 ATGGTTGCCTGGGGATGGAGAGG - Intergenic
1121417098 14:93787384-93787406 GGGCTGGCCTTGGAATGGAAAGG - Intronic
1122322539 14:100864024-100864046 GGGCTTTCCTGGGCAGGGATAGG + Intergenic
1122371292 14:101230171-101230193 CGGCTGGTCTGGTCATGGAGAGG - Intergenic
1124350835 15:28954531-28954553 GGGGGTGCCTGTGCATGGTGGGG - Intronic
1124372623 15:29112062-29112084 GAGCTTCACTGGGCATGGTGGGG - Intronic
1126099656 15:45111686-45111708 GGGCCTGGCAGGGCCTGGAGGGG - Intronic
1126103875 15:45135351-45135373 GGGCCTGGCAGGGCCTGGAGGGG + Intronic
1128233810 15:66053663-66053685 GGCCCTGGCTGGGAATGGAGAGG - Intronic
1128693227 15:69741335-69741357 GGGCTGGGCTGGGGTTGGAGTGG + Intergenic
1128743373 15:70097739-70097761 GGGTTTGCCGGGGCGCGGAGAGG - Exonic
1129705559 15:77792206-77792228 GGGCCAGCCTGGGAATGGGGCGG - Intronic
1131376627 15:91929705-91929727 GTGGTTGCCAGGGCCTGGAGAGG - Intronic
1132318633 15:100909038-100909060 GGGTTTGCACGCGCATGGAGGGG - Intronic
1132696492 16:1204463-1204485 GGGCTGGCCTGGCCACGGGGTGG + Intronic
1132874568 16:2130616-2130638 GGGCTGGCCAGGCCACGGAGGGG - Intronic
1133277244 16:4646462-4646484 GGGCTTGCCTGGGCATGGAGGGG + Intronic
1133424507 16:5676079-5676101 GGGCCTGCTGGGGCATTGAGGGG + Intergenic
1134237507 16:12478814-12478836 AGGGAGGCCTGGGCATGGAGGGG + Intronic
1134553512 16:15149449-15149471 GGGCTGGCCAGGCCACGGAGGGG - Intergenic
1135597950 16:23757416-23757438 GGGGTTGCCTGGGAATGATGGGG + Intronic
1136065217 16:27754058-27754080 GGACTTACCTGGGCATAGGGTGG + Intronic
1136083966 16:27871236-27871258 GGGCTGGCCTGTGCATTGTGGGG - Intronic
1136871593 16:33812414-33812436 GGTCTTGCATGGGCACTGAGTGG - Intergenic
1137705549 16:50533370-50533392 GGGCTTGACTGGGCTTGGTAGGG + Intergenic
1138067474 16:53957064-53957086 GGGTTGGCCTGGGCATAGATAGG + Intronic
1138596046 16:58029493-58029515 GGTCTTGACAGAGCATGGAGAGG - Intronic
1140074683 16:71686598-71686620 GTGATTGCCAGGGCATGGTGGGG - Intronic
1141899074 16:86978643-86978665 GGGCTCCCCTGGGCTTTGAGAGG - Intergenic
1142223053 16:88864716-88864738 GTGCTTGGCTGGGCCTGGACAGG - Intronic
1142429421 16:90018521-90018543 GGGCTTGGCTGGGCAGGTGGAGG + Intronic
1203100579 16_KI270728v1_random:1303644-1303666 GGTCTTGCATGGGCACTGAGTGG + Intergenic
1142767181 17:2071518-2071540 GGGCTTCCCTGGGTGTGGGGTGG + Intronic
1142940537 17:3376857-3376879 TGGCTTCCCTGGGCTTGGACTGG + Intergenic
1143400238 17:6638657-6638679 GGCAGTGCCTGGGCTTGGAGAGG - Intronic
1143620866 17:8079665-8079687 GGGCTTGCCTGGGACTGGCGCGG + Intronic
1146173494 17:30650240-30650262 GGGCTGGGCTGGGCTTGGATGGG + Intergenic
1146376015 17:32295165-32295187 GGGGGTGCCTGGCCCTGGAGTGG + Intronic
1146639147 17:34527066-34527088 GGGCATTCTGGGGCATGGAGAGG - Intergenic
1147538294 17:41335050-41335072 GGGCTTGCCTGGACCTTGTGGGG + Intergenic
1147742810 17:42678342-42678364 GGGCTGGGCTGGGCGGGGAGGGG + Intergenic
1147759368 17:42787694-42787716 GGGCCTGCCTAAGCAAGGAGGGG - Intronic
1148486831 17:47996164-47996186 TTGCTTCCCTGGGGATGGAGGGG + Intergenic
1149446537 17:56717671-56717693 GGGCTTGCCTGGGCATGTTCTGG - Intergenic
1149477818 17:56978032-56978054 GGGCCTGAATGGGCATGGGGCGG - Intergenic
1150008932 17:61487261-61487283 GGGCTTGCCGGGGGATGGCATGG - Intergenic
1150240339 17:63626679-63626701 ATGTTTGCCTGGGCATGGACAGG + Intronic
1150292078 17:63987904-63987926 GGGCTTCCCTGGGCCTGGCCTGG + Intergenic
1150389707 17:64783283-64783305 GCGCTTGGCTGAGGATGGAGAGG + Intergenic
1150439350 17:65178898-65178920 GGGCTTAGGTGGGCAGGGAGAGG - Intronic
1151824762 17:76518076-76518098 GGGCCTGCCTGGGAAGGGGGAGG - Intergenic
1151890975 17:76950091-76950113 GGGGTTGCCTGGAGAGGGAGCGG - Exonic
1152048547 17:77955233-77955255 GGAAGTGACTGGGCATGGAGAGG + Intergenic
1152212468 17:79009700-79009722 GGGCTTGGCTGGGCTTGGCTGGG + Exonic
1152212471 17:79009710-79009732 GGGCTTGGCTGGGCTTGGCTGGG + Exonic
1152381660 17:79945374-79945396 GAGCCTTCCTGGCCATGGAGCGG - Intronic
1152595968 17:81237812-81237834 GGGCTTGCCTGGGCCTTGTTTGG - Intronic
1153114376 18:1636725-1636747 GTGGTTGTCTGGCCATGGAGTGG + Intergenic
1156327145 18:36085114-36085136 GGTCTTGCCTGGCCATGCAAGGG - Intergenic
1156391431 18:36654098-36654120 GGACTTGCCTTGGCAGGGTGTGG - Intronic
1156886455 18:42141169-42141191 AGATCTGCCTGGGCATGGAGTGG - Intergenic
1157515529 18:48308416-48308438 TGGCCAGCCTGGGCATGGGGTGG - Intronic
1157639040 18:49194039-49194061 TGACGTGCCAGGGCATGGAGTGG + Intronic
1157724907 18:49956898-49956920 GTGGTTGCCTGGGGCTGGAGGGG + Intronic
1157940347 18:51921712-51921734 AGATCTGCCTGGGCATGGAGTGG - Intergenic
1158944769 18:62438571-62438593 CGGCACGCCTGGGCTTGGAGCGG - Intergenic
1160538687 18:79609071-79609093 GGGGTTTCCTGGACTTGGAGGGG + Intergenic
1160771710 19:835043-835065 GGCCCTGCCTGGGTTTGGAGAGG + Intergenic
1160785953 19:900400-900422 TGGCTTGTGTGGGCCTGGAGTGG - Intronic
1160797532 19:952886-952908 GGGCCTGCCTGGGGACTGAGTGG + Intronic
1161006633 19:1940587-1940609 TGGCTTTCCTGGGCGAGGAGGGG - Intergenic
1161036867 19:2089886-2089908 GGGCTGCCCCTGGCATGGAGTGG - Intronic
1162085995 19:8249442-8249464 GAGCTTGCCTGATAATGGAGTGG - Intronic
1162104791 19:8363946-8363968 AGGCCTGCCTGAGCCTGGAGCGG + Intronic
1162136368 19:8557825-8557847 GGACTGGCCTGGGCCTGGGGAGG - Intronic
1162158158 19:8693998-8694020 GGGTGTGTGTGGGCATGGAGGGG + Intergenic
1163384877 19:16993433-16993455 GGGCTGACGTGGGGATGGAGGGG + Exonic
1163499057 19:17664712-17664734 TGGCTTCCCTGGCCAGGGAGGGG - Intronic
1163669861 19:18620995-18621017 GGGCTTGTCTGGGGCTGGGGAGG + Exonic
1164570979 19:29374127-29374149 GGGCTTGTCTGGGCCAGGCGCGG - Intergenic
1164733579 19:30524035-30524057 TGGCTGGCCTGGGCACGGGGTGG - Intronic
1165135564 19:33666248-33666270 GGGCTTCCACGGGCATGGAGGGG - Intronic
1165754235 19:38282817-38282839 TGGCCTGCCTGGGCAGAGAGTGG + Intronic
1166357012 19:42233253-42233275 GGGCTGGGCTGGGCAGGGGGTGG - Intronic
1166372468 19:42309901-42309923 GGCCCTGCCTGGGCTTGGGGAGG - Exonic
1167610708 19:50506569-50506591 GGGCCTGTGTGGGCAGGGAGGGG + Exonic
1167990689 19:53358301-53358323 GGGCTGGGCTGGGCAGGGCGGGG - Intergenic
1168052801 19:53842191-53842213 GGGCTGGCCTGGGACTGCAGAGG + Intergenic
1168317220 19:55489561-55489583 TGGCTTGCCGGGGCAACGAGGGG + Exonic
925113127 2:1353193-1353215 TGGCTGTCCTGGGGATGGAGGGG - Intronic
925118085 2:1397436-1397458 GGGCTTGCCTGGGGAGGGAATGG - Intronic
925131730 2:1498445-1498467 GGAGCTGCCTGGGCATGGATAGG + Intronic
925516991 2:4693548-4693570 GTGATGGCCTGAGCATGGAGAGG + Intergenic
925768449 2:7259718-7259740 AGATCTGCCTGGGCATGGAGTGG - Intergenic
925840410 2:7986597-7986619 TGGCATGCCTTGGCATGTAGTGG + Intergenic
925990253 2:9249072-9249094 TGGCTGGGCTGGGCATGTAGGGG + Intronic
926289477 2:11517151-11517173 GGGCCAGCCTGGCCTTGGAGGGG - Intergenic
926388209 2:12359722-12359744 GGGCTTGCTTGGGGAGAGAGAGG - Intergenic
927670781 2:25067223-25067245 GGGGGTGCCTAGGGATGGAGAGG - Intronic
927717179 2:25360335-25360357 TGGTTTGCCTGGTCAAGGAGGGG - Intergenic
929090785 2:38215307-38215329 GGGATGGCGTGGGCATGGACAGG - Intergenic
929537496 2:42792728-42792750 GCGCTCGCCAGGGCCTGGAGTGG - Intergenic
929587575 2:43126075-43126097 GGGCTGGCCTGTGCATCGTGGGG + Intergenic
929963929 2:46519484-46519506 GGCCCTGTCTGGGCATGAAGAGG - Exonic
930023362 2:47014711-47014733 GGGCTTGGCTGGGCCTGCTGGGG - Intronic
930210809 2:48635092-48635114 AGATCTGCCTGGGCATGGAGTGG + Intronic
932572697 2:72946224-72946246 GGGCCTGCCTTGGGATGAAGGGG - Intronic
933336746 2:80968125-80968147 AGGTCTGCCTGGGCATGGAGTGG - Intergenic
933979820 2:87540503-87540525 GGGCTTGCCCAGGCAAAGAGTGG - Intergenic
934558330 2:95299221-95299243 TGGCTGGCCTGGCCAGGGAGGGG + Intronic
934657539 2:96123908-96123930 GGGCTTCCCTGGACAGGGACTGG + Exonic
934989649 2:98912405-98912427 GGTCATGCCTGGGGATCGAGTGG - Intronic
935641171 2:105291748-105291770 GGGATTGCCTGGGCCGGGTGCGG + Intronic
935794416 2:106627697-106627719 GAGCTTGACTGTGCATGGAAAGG - Intergenic
936314000 2:111410288-111410310 GGGCTTGCCCAGGCAAAGAGTGG + Intergenic
936746230 2:115579974-115579996 GGGCCTGCCAGGGGGTGGAGTGG - Intronic
937121723 2:119445158-119445180 GGGTCTGCCTGGCCATGGATGGG - Intronic
937136505 2:119558230-119558252 GGGCCCGCCTGAGGATGGAGAGG - Intronic
937272639 2:120663107-120663129 GGGCTTGTCTGGGCCTGGGGAGG - Intergenic
937743322 2:125381513-125381535 AGGCTTGCCTGGGGAAGGATGGG + Intergenic
937861821 2:126717422-126717444 GCGGTTGACTGGGAATGGAGAGG - Intergenic
938140427 2:128790491-128790513 GGGCTGGCCTCTGCAGGGAGCGG + Intergenic
938639768 2:133266474-133266496 GGGCGCGCCTGGGCGGGGAGTGG + Intronic
938981852 2:136534672-136534694 GGGCTTGGCTGGGGTTGGTGGGG - Intergenic
939179602 2:138788739-138788761 GGGCCTGCCCGGGCTGGGAGTGG - Intergenic
945199534 2:207267356-207267378 GGGCTTGCCTTGGACTGCAGTGG - Intergenic
945482979 2:210364197-210364219 AGATCTGCCTGGGCATGGAGTGG + Intergenic
945844712 2:214930395-214930417 GGGCTTCCCTGCCCATTGAGAGG + Intergenic
946772214 2:223100421-223100443 GAGCTTACCAGGGCATGGGGAGG - Intronic
947225922 2:227839919-227839941 GGGTTTCCCTTGGCAAGGAGAGG + Intergenic
947739638 2:232479241-232479263 GGCCCTGCCTGATCATGGAGGGG - Intergenic
948599754 2:239101516-239101538 GGGGTTGCAGGGGCAAGGAGAGG - Intronic
948816550 2:240513254-240513276 GGGCCTGGCAGGGCAGGGAGAGG - Intronic
949026543 2:241769002-241769024 GGGCAGGCCTGGACATGGAACGG + Intergenic
1169060445 20:2656903-2656925 GGGCTTTGCTGGGTGTGGAGTGG + Intronic
1169324271 20:4662533-4662555 GCGGTTGCCTGGGGATGGGGTGG + Intergenic
1169370332 20:5023994-5024016 GGGCTTGCCAGGGACTGGTGGGG - Intergenic
1169912012 20:10654747-10654769 GTGCGTGTCTGGGCAGGGAGAGG + Intronic
1170810647 20:19671580-19671602 GGGCTTGACTGGGCAGGGAGTGG + Intronic
1171244107 20:23595821-23595843 CGCTTTGCCTGGGCATGGTGTGG + Intergenic
1172242629 20:33423469-33423491 GGGCTTGGCTGGGGAGGGTGGGG - Intronic
1172799180 20:37564363-37564385 GGGGTTGCCTGGGGAAGGGGTGG + Intergenic
1173582097 20:44154657-44154679 GGGCCTGCCTGGGTGTGAAGAGG + Intronic
1174546604 20:51330605-51330627 GGGCTCAACTGGGCCTGGAGGGG - Intergenic
1175655199 20:60763860-60763882 GGGCCAGCCTGGGCATCAAGTGG + Intergenic
1175725130 20:61312900-61312922 GAGCTTGCCTGGGATTGCAGGGG + Intronic
1176171060 20:63696553-63696575 GGGGCTGCCTGGGGAGGGAGGGG + Intronic
1176235657 20:64052365-64052387 GGGCTGGCCTGGGCACTGAGTGG + Intronic
1177296904 21:19187581-19187603 GGGCTTGCATGAGGAAGGAGTGG + Intergenic
1179379847 21:40888350-40888372 GAGCTTGCCTGTCCAGGGAGTGG + Intergenic
1179520297 21:41939365-41939387 GGGCTGGTCTGGACAGGGAGTGG - Intronic
1180086583 21:45510424-45510446 GGCCTGGCCTGAGCCTGGAGGGG - Intronic
1180195332 21:46190504-46190526 GAGCTTGCCTGCGTATGGGGTGG - Exonic
1180670486 22:17548930-17548952 GGGCTTCCCTGGGGATGGAGAGG - Exonic
1180710077 22:17833436-17833458 GAGCCTGCCTGGGCAGAGAGAGG - Intronic
1181370080 22:22408935-22408957 GAGCATTCCTGGGCAGGGAGAGG + Intergenic
1181672545 22:24432460-24432482 GGGAGAGCCTGGGCAGGGAGGGG + Intronic
1181761490 22:25061845-25061867 GGTCTTGCCTGGGCATGCGCAGG - Intronic
1182081719 22:27534004-27534026 TGGCTTGGCTGGGTAGGGAGAGG - Intergenic
1182357075 22:29727073-29727095 GGTCTGGCCTGGACCTGGAGGGG + Intronic
1182599023 22:31445212-31445234 GTGCTTCACTGGGCAGGGAGCGG + Intronic
1182697292 22:32205908-32205930 GGGCTGGACTGCCCATGGAGAGG + Intergenic
1183273536 22:36877026-36877048 GGGTTTGACTGGGCACAGAGTGG - Intronic
1183500296 22:38174873-38174895 GAGCTTCCCTGGGCATGGCGAGG - Intronic
1183545045 22:38450900-38450922 GGGCTTCCCTGGGGAAAGAGTGG - Intronic
1183587666 22:38762438-38762460 GGACTTGGGTGGGCATGGGGTGG - Intronic
1183940027 22:41288777-41288799 GGGCTTGTCGGGGCTTGGTGGGG + Intergenic
1184035023 22:41914173-41914195 GGGCGCGCCTGGGACTGGAGAGG - Exonic
1184042598 22:41952864-41952886 GGGCCTGGCTGGGCCTGGATAGG + Intergenic
1184148799 22:42626960-42626982 ATGCTGGCCTGGACATGGAGGGG - Intronic
1184173444 22:42772669-42772691 TGGGTTGCCTGTGCCTGGAGAGG - Intergenic
1184467475 22:44677272-44677294 GGGGACGCCTGGGCGTGGAGAGG + Intronic
1185001093 22:48246416-48246438 GGTCTTTCCTGGGTCTGGAGGGG - Intergenic
950537136 3:13585146-13585168 GGGCATGGCTGGGCTTTGAGTGG + Intronic
950716110 3:14848804-14848826 GAGCTGGCCTTGGCAAGGAGAGG + Intronic
951284345 3:20790910-20790932 AAACCTGCCTGGGCATGGAGTGG - Intergenic
953881393 3:46693195-46693217 GTGTGTGCCTGGGCAGGGAGAGG - Intronic
954197638 3:49006004-49006026 TGGCTGGCCTGGCCATAGAGTGG + Intronic
954291158 3:49650792-49650814 GGGCTGGCCTTGGCAGGCAGGGG - Exonic
954407623 3:50354257-50354279 GGGCCTGCCAGGGCCCGGAGTGG - Intronic
954605800 3:51908207-51908229 AGGCTGGTCTGGGCATGGAAGGG + Intergenic
954924562 3:54220964-54220986 GGCCTTGGGTGGGAATGGAGGGG + Intronic
955118471 3:56031022-56031044 GGGCTAGCCTGGTGATTGAGTGG - Intronic
955647482 3:61155421-61155443 GGTGTTGACTAGGCATGGAGAGG - Intronic
956030836 3:65035868-65035890 GGGCTGGGATGGGCATGGAGTGG - Intergenic
957171819 3:76746806-76746828 GGGCTTGTCAGAGGATGGAGTGG - Intronic
959013437 3:101106114-101106136 GTGCTTGCCAGGGTCTGGAGGGG + Intergenic
960967572 3:123115828-123115850 GGCCCTGCCTGGGCAGTGAGGGG + Intronic
961512062 3:127409253-127409275 GAGTTTGCCAGGGCAGGGAGGGG - Intergenic
962221283 3:133566497-133566519 GGGCTTCCCATTGCATGGAGAGG + Intergenic
962869822 3:139478072-139478094 GGGTTTTCATGGGCATTGAGGGG + Intronic
963461593 3:145620901-145620923 ATGCTTGCCTAGGGATGGAGAGG + Intergenic
963821882 3:149906004-149906026 GTGATTGCCTGGGGCTGGAGTGG - Intronic
968566549 4:1316539-1316561 GCGCATGGCTGGGCATGGGGAGG - Intronic
969569380 4:7999774-7999796 GGCTGAGCCTGGGCATGGAGTGG - Intronic
970450497 4:16162192-16162214 GGGCAGGCCTGGGTCTGGAGAGG - Exonic
970823897 4:20251823-20251845 GGGCGGGCCTGGGCCTCGAGGGG + Intergenic
973643079 4:52922356-52922378 GGGATTGCCAGGGGCTGGAGGGG - Intronic
974063255 4:57054345-57054367 GTGCTTGGCTGGGCACGGGGTGG + Intronic
975245795 4:72119688-72119710 GGGCTTCCCTTGGCTAGGAGAGG - Intronic
979022934 4:115525501-115525523 GGGCTTCCCTTGGCTTGGGGAGG + Intergenic
980019968 4:127697325-127697347 ATGATTGCCTGGGGATGGAGGGG - Intronic
980587596 4:134837277-134837299 GGTTTTCCCTGGGGATGGAGGGG + Intergenic
985922699 5:2991955-2991977 TGCCTGGCCTGGGCATGGTGCGG + Intergenic
986002328 5:3640038-3640060 GTGATTGCCAGGGCAGGGAGGGG - Intergenic
986628796 5:9748932-9748954 GGCCCTGGCTGGGTATGGAGGGG - Intergenic
987921226 5:24283894-24283916 GGGCTGGGCTGGGCAGGGAAAGG + Intergenic
989961329 5:50419163-50419185 GGGCAGGACTGGCCATGGAGGGG - Intronic
993443252 5:87980872-87980894 AGATCTGCCTGGGCATGGAGTGG + Intergenic
994399727 5:99264078-99264100 AGATATGCCTGGGCATGGAGTGG - Intergenic
997009769 5:129862329-129862351 GGGCCAGCCTGGGCATAGTGAGG + Intergenic
997261215 5:132466726-132466748 GGGCAGGCCTGGACAGGGAGAGG - Intronic
997529734 5:134574528-134574550 GGGCTGAGCTGGGCCTGGAGAGG + Intronic
998721740 5:144959688-144959710 AGGCTTGCCTGGGCATTATGGGG - Intergenic
999248146 5:150166584-150166606 GGACTGGCCAGGGCCTGGAGGGG - Intergenic
1001159235 5:169299754-169299776 GGGCTTGGCAGCGAATGGAGAGG - Intronic
1002270269 5:178067258-178067280 TGGATTTCCTGGGCCTGGAGAGG - Intergenic
1002278107 5:178116022-178116044 GGGCTTCCCTGAGCTGGGAGCGG - Intronic
1002779781 6:357380-357402 GGGCCTGGCAAGGCATGGAGCGG - Intergenic
1003106505 6:3220676-3220698 GTGATTTCCTGGGCTTGGAGTGG + Intergenic
1003425086 6:5993832-5993854 GGTCTGGCCTGGGCACTGAGGGG + Intergenic
1005299207 6:24454502-24454524 GGGCTTGCCTGAGAGTAGAGAGG + Intronic
1005372798 6:25153057-25153079 GGGGCAGCCTGGGCAAGGAGGGG + Intergenic
1005771504 6:29077464-29077486 GGGCCTGTCTGGGGGTGGAGAGG - Intergenic
1006107519 6:31725301-31725323 GGGCTTGATTGGGTATAGAGAGG - Intronic
1006456238 6:34133531-34133553 GGGCCTGCCAGGGCTAGGAGTGG - Exonic
1006514820 6:34539826-34539848 GGGCTTGCCTGGGCTGGGGCGGG + Intronic
1006578120 6:35060647-35060669 GGCCTTGGCTGGGCAGGGAAGGG - Intronic
1006644906 6:35509305-35509327 GGGAGTGCCTGAGCGTGGAGGGG + Exonic
1006739617 6:36297985-36298007 GGGGTTGCTTGGGAATGGCGGGG - Intronic
1006804785 6:36781068-36781090 GGGCTTGCCTGGGCAGGGAGGGG + Intronic
1007326864 6:41068833-41068855 TTCCTTGCCTGGGCATGGAGAGG + Exonic
1007479198 6:42138889-42138911 GGCCTTGCTTGGGCTGGGAGAGG + Intronic
1007750326 6:44067238-44067260 GGGCCTGCCTGGACCTGGTGGGG + Intergenic
1007912234 6:45527459-45527481 GGGCTTCCCTGGAAATGGTGGGG + Intronic
1008936590 6:56999158-56999180 AGATCTGCCTGGGCATGGAGTGG - Intronic
1009787479 6:68358369-68358391 AGGTTTGCCTAGGAATGGAGTGG + Intergenic
1012676128 6:102115280-102115302 AGATTTGCCTGGACATGGAGTGG + Intergenic
1013536686 6:111068982-111069004 GGGCATTCTTGGGCATGCAGTGG - Intergenic
1016041725 6:139438526-139438548 TGACTGGCATGGGCATGGAGTGG - Intergenic
1019532586 7:1511134-1511156 GGGCTAGCCTGGGGGTGGATGGG - Intergenic
1020930898 7:14392604-14392626 GGTCTTACCAGGGCATGCAGTGG + Intronic
1021351816 7:19602910-19602932 AGATTTGCCTGGGCATGGAGCGG + Intergenic
1023168105 7:37363207-37363229 GTGGTGGCCTGGACATGGAGGGG - Intronic
1023328922 7:39092031-39092053 GGCCTTCCCTGGGAATGCAGAGG + Intronic
1024346899 7:48322561-48322583 CGGCTGCCCTGGGCATTGAGAGG - Intronic
1025099654 7:56124014-56124036 GGGCTGAGCTGGGTATGGAGTGG + Intergenic
1025960243 7:66214196-66214218 GTGGTTGCCTAGGGATGGAGAGG - Intronic
1026209101 7:68287502-68287524 GGGCTTGCCTGGGCAGAGGTAGG + Intergenic
1027188259 7:75984293-75984315 GGGGCTGCCTGGGCCTGGTGGGG + Intronic
1027434301 7:78148356-78148378 GTGCTTGCCAGGGCTGGGAGTGG + Intronic
1027495135 7:78878777-78878799 AGATCTGCCTGGGCATGGAGTGG - Intronic
1029113082 7:98223321-98223343 GGGCCTGGCTGGGCCTGGATGGG - Intronic
1029113258 7:98224001-98224023 GGGCCTCCCTGGGGCTGGAGCGG + Intronic
1029458585 7:100683120-100683142 GGGCTGGCCTGGCCAAGCAGGGG - Exonic
1029599146 7:101553631-101553653 GGGCTTCCCGGGACAGGGAGAGG + Intronic
1032013014 7:128359309-128359331 GGGCTTTCCTTGGGATGGGGTGG + Intronic
1032080531 7:128856388-128856410 GGGCCAGGCTGGGCATGGGGTGG + Intronic
1032363755 7:131279976-131279998 GTGGTTGCCTGGGGTTGGAGTGG - Intronic
1034338222 7:150337010-150337032 GAGAGTGCCTGGGCCTGGAGTGG + Exonic
1034451467 7:151139321-151139343 GGGGTGGGCTGGGCATGGATTGG - Intronic
1034477721 7:151296611-151296633 GTGGTTGCCTGGGGATGGTGGGG - Intergenic
1034560286 7:151875954-151875976 GGGCGTTTCTGGGCCTGGAGCGG - Intronic
1034996339 7:155579690-155579712 GAGCTTGCCTGGGAATGGCGGGG + Intergenic
1035123369 7:156588713-156588735 AGTCCTGCCTGGGCATGCAGAGG + Intergenic
1037992333 8:23329888-23329910 GGGCTGGCCATGGCATGGTGGGG + Intronic
1038392508 8:27216555-27216577 GTGCTTACCTGGGCATGAGGAGG + Intergenic
1038536038 8:28353276-28353298 GGGCTGGCCTGGGGGTGGGGGGG + Exonic
1039395639 8:37223033-37223055 GGCCTTGGCAGTGCATGGAGGGG - Intergenic
1039547022 8:38417723-38417745 GGGGTTACCTGGGAGTGGAGGGG - Intronic
1040758059 8:50804803-50804825 GTTCCAGCCTGGGCATGGAGCGG - Intergenic
1041028192 8:53708114-53708136 GGGCTTGGCTGGGCTTTGTGTGG - Intergenic
1042082604 8:65071533-65071555 GGGGTTGGCTGGGCAGGGCGCGG + Intergenic
1044313705 8:90726219-90726241 GGGCTTCCCTGGTCATGGTCTGG - Intronic
1044946875 8:97397519-97397541 GGTCTTGGGTGGGAATGGAGTGG - Intergenic
1045434537 8:102148666-102148688 GTGCTTGCCTGGAGATGGATAGG + Intergenic
1046657141 8:116907062-116907084 GGGCTTTCACAGGCATGGAGAGG + Intergenic
1048330451 8:133467284-133467306 GGGCGGGCCTGGGCATGCAGCGG - Intronic
1048823106 8:138397841-138397863 GGGCTGCCCTGGGCAAGGAAGGG - Intronic
1049604962 8:143525120-143525142 GGGCTTGGCTGGAGATGGCGAGG - Intronic
1049850633 8:144828228-144828250 GGGAATGCCTGGGCAGGTAGAGG + Intronic
1051394294 9:16602575-16602597 GGGCCTGAGTGGGCATAGAGTGG - Intronic
1053303231 9:36966349-36966371 GGGCTTGTCTGGGCCTCCAGTGG - Intronic
1055129707 9:72760873-72760895 GCGCTTTCATGGGTATGGAGAGG - Intronic
1055736514 9:79336491-79336513 AGGCCTGCCTGGGTGTGGAGTGG + Intergenic
1056867920 9:90246330-90246352 GGGATAACCTGGACATGGAGTGG - Intergenic
1057560836 9:96126842-96126864 GGCCTTGGCTGGTCAGGGAGAGG - Intergenic
1057852242 9:98574713-98574735 GGGCTGTCCTGCTCATGGAGAGG + Intronic
1058967415 9:110049979-110050001 GGGCTTTCCTGGGTCTGGAAAGG - Intronic
1059328092 9:113516975-113516997 GGGCTGGGCTGGGCAAGGTGAGG + Intronic
1061013640 9:127969620-127969642 GGGCTTGGCTGTTCATGGGGAGG - Intronic
1061452915 9:130678306-130678328 GAGATGGCCTGGGCAGGGAGAGG + Intronic
1061870775 9:133519159-133519181 GGCCCAGCCTGGTCATGGAGGGG + Intronic
1062265206 9:135683753-135683775 GGGCTGGCCTGGGGTGGGAGGGG - Intergenic
1062432824 9:136533549-136533571 GGGCTTGCCGGGCCGTCGAGTGG - Intronic
1062524170 9:136971623-136971645 GGGCTGGGCTGGGGAGGGAGGGG + Exonic
1062532435 9:137007819-137007841 GTGCCTGCCAGGGCCTGGAGTGG - Exonic
1186252123 X:7679641-7679663 GGGCCTGTCTGGGGATGGCGAGG - Intergenic
1186459797 X:9739380-9739402 GGGCTGTCCTGTGCATGGCGGGG - Intronic
1187391132 X:18887276-18887298 GGGCTTGGCTGGGGGTGGAGGGG - Intergenic
1187401225 X:18962263-18962285 GTGCGTGCATGGGCATGGAGGGG + Intronic
1190287724 X:48971867-48971889 GAGCTTGCCGGGAGATGGAGAGG + Intergenic
1190456087 X:50629031-50629053 GGGCTAGACAGGGCATGGACAGG - Intronic
1190486165 X:50927281-50927303 GGGCTTGCCTGGCACTGGTGTGG + Intergenic
1190505808 X:51125138-51125160 GGGCTTCCCTTGGCTAGGAGAGG - Intergenic
1191786555 X:64922613-64922635 GGACTTTCCTGGGCATTGAGAGG - Intronic
1191876825 X:65806442-65806464 CTGTTTGCCTGGGCAGGGAGAGG - Intergenic
1192212510 X:69136932-69136954 GGGCTGGCCTGGGGATGGGGAGG - Intergenic
1192529646 X:71873366-71873388 GGGCTTGGCTGGGCTTGGCTGGG - Intergenic
1193035249 X:76943155-76943177 GGGCCTACCTGAGCATGGAGGGG - Intergenic
1193906814 X:87254142-87254164 TGGCTTCCCTTGGCTTGGAGAGG + Intergenic
1194559473 X:95403317-95403339 TGGCTTCCCTTGGCTTGGAGAGG - Intergenic
1194923552 X:99796311-99796333 AGAACTGCCTGGGCATGGAGTGG + Intergenic
1196775967 X:119338075-119338097 GGGTTTGCCTGGGGATGGTTTGG - Intergenic
1197147089 X:123183401-123183423 CGGCTTGCGGGGGCATGGGGTGG - Intergenic
1198214640 X:134545204-134545226 GGGCTTCCCGGGGCCAGGAGTGG - Intergenic
1200044751 X:153395580-153395602 GGGATTGGCTGGGGATGGGGTGG - Intergenic
1200114822 X:153765410-153765432 GAGCTGGCCTGGGGAAGGAGGGG - Intronic
1200211825 X:154350082-154350104 TGGGGAGCCTGGGCATGGAGGGG - Exonic
1200936638 Y:8744145-8744167 AGGCCTGCCTAGGCATGTAGAGG - Intergenic
1201259296 Y:12142666-12142688 GGGCCTGTTGGGGCATGGAGGGG + Intergenic
1201920071 Y:19224504-19224526 GGGCCTGTCAGGGGATGGAGAGG - Intergenic