ID: 1133280573

View in Genome Browser
Species Human (GRCh38)
Location 16:4662838-4662860
Sequence GGTGCTTGGCTGCGGGCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 174}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133280563_1133280573 18 Left 1133280563 16:4662797-4662819 CCTATGTGTCTGTTGGTTCTGAG 0: 1
1: 1
2: 1
3: 19
4: 172
Right 1133280573 16:4662838-4662860 GGTGCTTGGCTGCGGGCTCAGGG 0: 1
1: 0
2: 0
3: 16
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133280573 Original CRISPR GGTGCTTGGCTGCGGGCTCA GGG Intronic
900652430 1:3736440-3736462 AGGGCTTGGATGAGGGCTCATGG - Intergenic
904301101 1:29555443-29555465 GGTGCATGGCTGCGGACACCCGG + Intergenic
904849007 1:33442961-33442983 GGTGCTTGGGGGCTGGTTCAGGG + Intergenic
905198577 1:36300816-36300838 ACTGCTTGGCTGGGGCCTCATGG - Intronic
906678911 1:47711706-47711728 GGTGCCTGGCTGCAGGTGCAGGG + Intergenic
907826071 1:58017896-58017918 AGTGCTGGGCTGCAGCCTCAAGG - Intronic
909584122 1:77270315-77270337 GGTGGTTGTCTGCGGACCCAGGG - Intergenic
910759144 1:90718190-90718212 GGCTCAGGGCTGCGGGCTCAGGG - Intergenic
916792492 1:168136641-168136663 TGTGCGAGGCTGAGGGCTCAGGG - Intronic
918238842 1:182604253-182604275 GGCACATGGCTGCGGGCGCAGGG + Exonic
923503366 1:234584844-234584866 GATGCATGGCTGCAGGCTTAGGG - Intergenic
923663896 1:235982051-235982073 TGTGGTTGGCTGTGGGCTCATGG - Intronic
1063161396 10:3421352-3421374 AGAGCTGGGCTTCGGGCTCAGGG - Intergenic
1064028967 10:11870547-11870569 GGTGCCTGGCTGGGGCCTCCTGG + Exonic
1064339295 10:14472379-14472401 AGGGCTTGGCTGCTGGGTCAAGG - Intergenic
1069752705 10:70754418-70754440 AGTGCTTGGCTGTGGGTTGATGG - Intronic
1073255328 10:102147168-102147190 GCTGCTTGGCTGAGGGTTCAGGG - Exonic
1075263072 10:120979716-120979738 GGTGCGGGGCTGCGCGCTTAGGG - Intergenic
1076522430 10:131089477-131089499 GATTCTTGTCTGAGGGCTCACGG - Intergenic
1079458711 11:20660767-20660789 GGGTCTTGGATGTGGGCTCAGGG + Intergenic
1081666710 11:44920947-44920969 GGGCCTTGGGTGGGGGCTCAAGG + Intronic
1082019357 11:47518839-47518861 GGTTCTTGGCTGCTTGGTCAAGG - Intronic
1083618152 11:64036339-64036361 GGTGCTTGGCTCTTGACTCAGGG - Intronic
1084358189 11:68653012-68653034 GGTCCTTGGGTGGTGGCTCACGG + Intergenic
1084580659 11:70020965-70020987 GGTGCTTCGCTGCGGGCGTCGGG + Intergenic
1084654284 11:70506133-70506155 GAAGCTTGGCTGCGGGGCCAAGG + Intronic
1084971164 11:72772842-72772864 GGTGTTTGGATGGGGCCTCAGGG - Intronic
1089734249 11:120538817-120538839 GATGCCAGGCTGGGGGCTCAGGG + Intronic
1092480881 12:8858115-8858137 AGTGGTTGGCTGCAGGCTCCTGG - Intronic
1092526395 12:9312617-9312639 GGTGCCTGGCCGGGGGCTCTGGG - Intergenic
1092811930 12:12279145-12279167 GTGGCTTGGCTTCGGCCTCAAGG - Intergenic
1094512166 12:31103317-31103339 GGTGCCTGGCCGGGGGCTCTGGG - Exonic
1096601383 12:52732289-52732311 GGGGCTTGCCTGCGGGGTCAAGG - Intergenic
1097290876 12:57913927-57913949 GGTGCTGGGCTCCGGCCCCATGG - Intergenic
1098275623 12:68808591-68808613 GGTTCGTGGCTGGGGGCTCGGGG + Intronic
1101440799 12:104703085-104703107 GCTGCGTGCCTGCTGGCTCATGG + Intronic
1104264593 12:127219777-127219799 GCTGCGGGGCTTCGGGCTCACGG - Intergenic
1104312748 12:127669093-127669115 GGTGCTGGGGTGAGGGCTCAGGG + Intergenic
1106463587 13:29993751-29993773 GGTGCTGGGCTTCTGGCTCCAGG - Intergenic
1106518682 13:30477477-30477499 GGAGCTTGGCTGCAGGCTCTGGG - Intronic
1106593641 13:31119148-31119170 GCAGCTTGGCTGCGGGACCAAGG + Intergenic
1107426355 13:40296967-40296989 GGTGCCTGGCTGGGATCTCAAGG + Intergenic
1112325352 13:98439883-98439905 GTTGCCTGGCTGCCAGCTCAGGG + Intronic
1112579270 13:100664376-100664398 GGAGCTTGGCTTAGGGCTGATGG - Intronic
1113427602 13:110222231-110222253 GGTGCTTGGCTGAGATCCCATGG - Intronic
1114580683 14:23756662-23756684 GGTGCTGGGCTGGGGGATCTAGG - Intergenic
1116176313 14:41474863-41474885 GGTGTTTGTCTGAGGGCTCTAGG - Intergenic
1116973708 14:51094318-51094340 GGTGCTTGGCTAGGGGCCCCCGG + Exonic
1118283226 14:64448114-64448136 AGTGAGTGGCTGCTGGCTCAAGG + Intronic
1120259645 14:82166309-82166331 GGTGCCTGGTTGGGGTCTCATGG - Intergenic
1120830910 14:88996587-88996609 GGTAATTGGCGGGGGGCTCAGGG + Intergenic
1121346264 14:93137963-93137985 GGGGCTGGGCGGCCGGCTCAGGG - Intergenic
1122029214 14:98900413-98900435 GGTGCTTGGCTGGGGGTCCTGGG - Intergenic
1122203918 14:100138911-100138933 GGCGGGTGGCTGCAGGCTCAGGG - Intronic
1124014103 15:25862069-25862091 GGTGCCTGGCTCGCGGCTCATGG + Intronic
1124970900 15:34489285-34489307 GGTTCTTGGCTGCCTGCTCTGGG + Intergenic
1125342029 15:38684688-38684710 GGTGCCTGACTGCTGGCTCTGGG + Intergenic
1126777458 15:52112245-52112267 CGCGCCTGGCTGCAGGCTCAGGG - Exonic
1129243989 15:74268824-74268846 ACTGCTGGGCTGTGGGCTCAGGG - Intronic
1130446056 15:84003079-84003101 GGTGCATGGCTGTAGTCTCAAGG - Intronic
1132630576 16:915360-915382 GGAGCTTGGCTGCGGAGTGAGGG - Intronic
1133280573 16:4662838-4662860 GGTGCTTGGCTGCGGGCTCAGGG + Intronic
1136283861 16:29230152-29230174 GGTGCTTGGCTGGGGGGACAGGG + Intergenic
1136299012 16:29320849-29320871 GCTGCCTGGCTGCAGGGTCAGGG - Intergenic
1139392289 16:66612567-66612589 GATGCTTGGCAGGAGGCTCAGGG - Intronic
1140504154 16:75459926-75459948 GGTGCAGGGCTGCAGGCTGATGG - Intronic
1141152531 16:81574192-81574214 GATGCCTGGCTGAGGGCCCAGGG + Intronic
1141356695 16:83353431-83353453 GACCCTTGGCTGCTGGCTCATGG + Intronic
1142088894 16:88199662-88199684 GGTGCTTGGCTGTGGGGACTGGG + Intergenic
1142470569 17:161198-161220 GGTGCTAAGCTGAGGGATCATGG - Intronic
1143686702 17:8523169-8523191 GGTGTTTGGCAGCTGGCTCTGGG - Intronic
1144684771 17:17218867-17218889 GGTGGGTGGCTGAGGGCACAGGG - Intronic
1146183181 17:30709811-30709833 GGTGAGTGTCTGCGGGCCCAGGG + Intergenic
1146661511 17:34668020-34668042 GGGGCTTGGGTGGGGGGTCAAGG - Intergenic
1147374398 17:40015442-40015464 GGGGCTGGGCTGCAGGCTCCGGG - Exonic
1147600132 17:41740184-41740206 GGGGCTGGGCTGAGGGCTCTAGG - Intergenic
1147632732 17:41942615-41942637 GGAGCTTGGCAGGGGCCTCAGGG + Intronic
1148219122 17:45849829-45849851 GGTGCTGGGCAGTGGTCTCAGGG - Intergenic
1150597969 17:66623856-66623878 GGTGCCTGGCTCCAGGCTGATGG + Intronic
1151142892 17:72011973-72011995 GGTGCTTGGTTGAGGTCTCTTGG - Intergenic
1151351204 17:73533242-73533264 TGTCCTTGGCTGCGGGACCAGGG - Intronic
1159928807 18:74291985-74292007 GGGGCTGGGCGGCCGGCTCAGGG + Exonic
1160008794 18:75088470-75088492 CGTGCTTGCCTGCAGGTTCAGGG + Intergenic
1161973845 19:7598056-7598078 GGTGCTGGGCTGGGCGCTCAGGG + Intronic
1162975613 19:14205963-14205985 GGTGAGTGTCTGCGGGCCCAGGG - Exonic
1163243228 19:16076841-16076863 GGGTCCTGGCTGCGGGCGCAGGG - Intronic
1163821781 19:19500179-19500201 GGTGCGAGGCTGGGGGCTCTGGG - Intronic
1165849036 19:38838471-38838493 GGTTCTTGGCTGCCTGCTCTGGG + Exonic
1166902862 19:46079545-46079567 GGTGGCTGGCTGGGGGATCATGG - Intergenic
1168009304 19:53517807-53517829 GGTGGTTTGCTGGGGGCTCTCGG - Intergenic
1168269313 19:55241137-55241159 GGGGCTCGGCTGGGGGCTCAGGG - Intronic
925401422 2:3575767-3575789 GGTGCTCGGACGCGCGCTCAGGG + Intronic
926217341 2:10913680-10913702 CGTGCTTGGCCGCGGTCTCCAGG - Exonic
931428580 2:62192555-62192577 GGTGGTTGGCTGCAGGGTCTGGG - Intergenic
937466238 2:122135391-122135413 GGAGCTGGGCAGGGGGCTCAAGG + Intergenic
938766047 2:134461057-134461079 CCTGCTGGGCTGGGGGCTCAGGG - Intronic
942213287 2:173693055-173693077 GGAGCCTGGTTGGGGGCTCAGGG - Intergenic
947857761 2:233335811-233335833 GGAGCATGTCTGTGGGCTCAAGG + Intronic
948669331 2:239557759-239557781 GATGCTGGGCGACGGGCTCAAGG + Intergenic
948764010 2:240210369-240210391 GGTGGTTGGATGGGGGCACAAGG - Intergenic
1169110483 20:3029877-3029899 GGTGCTTGGCTTTGCACTCAAGG + Intronic
1170544310 20:17421282-17421304 GGTGCTTGCCAGCAGACTCAGGG + Intronic
1170792242 20:19517734-19517756 GGGCCTTGGCAGCAGGCTCATGG - Intronic
1171346789 20:24471182-24471204 CGTGCTAGGCTGCGACCTCAAGG + Intronic
1172642076 20:36446616-36446638 GGTTCTTGGTGGTGGGCTCAGGG - Intronic
1172870994 20:38135536-38135558 GCTGCCTGGCTGTGGGCTCCTGG - Intronic
1173822449 20:46028433-46028455 GGTCCCTGGCTGTGGGCTCCAGG + Intronic
1175524736 20:59625798-59625820 GGTTCTTGGCTGAGAGCTCCTGG + Intronic
1178606485 21:34040677-34040699 GGTGCTTGGCTGAATGCTGAAGG + Intergenic
1179379560 21:40885860-40885882 GGTGCTTGCCTGGGGCGTCAGGG - Intergenic
1179632857 21:42689247-42689269 GGAGCTCGGCTGAGGCCTCAAGG - Intronic
1180668868 22:17537135-17537157 AGGGCATGGCTGCTGGCTCAAGG + Exonic
1182045779 22:27273038-27273060 GGGGCTTGGCTGCAGGCTGCAGG - Intergenic
1184430284 22:44438363-44438385 GGACATTGGCTGCGGCCTCAGGG - Intergenic
1184554742 22:45227062-45227084 TGTGCCTGGCTCCTGGCTCAGGG - Intronic
1184947463 22:47813695-47813717 GCTGCTTGGCTGCGGGGTGAGGG + Intergenic
1185036366 22:48479263-48479285 GGGTCCTGGCTGCAGGCTCAGGG - Intergenic
1185036400 22:48479395-48479417 GGGTCCTGGCTGCAGGCTCAGGG - Intergenic
1185195571 22:49467334-49467356 GGTGCTGGGCTCAGGGATCAGGG - Intronic
1185231815 22:49688003-49688025 AGTCCCTGGCTTCGGGCTCAGGG - Intergenic
1185258352 22:49848827-49848849 GGTGCGTCGCTGCGGGCTCGTGG - Intergenic
950004057 3:9680057-9680079 GAGGCCTGGCTGTGGGCTCATGG - Intronic
950573890 3:13819306-13819328 GGAGCTGGGCTACGTGCTCAAGG - Exonic
950678453 3:14568820-14568842 GGTGGTTTGCTGAGTGCTCATGG - Intergenic
951317834 3:21208028-21208050 GGTGCATGGTTGTGGGCTTAGGG - Intergenic
955996437 3:64685143-64685165 GGCGCTTTGCTGGGGGCTAAAGG + Intronic
960710753 3:120525655-120525677 GGTGCTTTGCAGCTGGTTCAGGG - Intergenic
961385639 3:126521854-126521876 TGGGCTTGGCTGAGTGCTCATGG - Intergenic
961573923 3:127819831-127819853 GGTCCTAGGGTGGGGGCTCAGGG - Intronic
961775282 3:129279514-129279536 GGAGCTGGGCAGTGGGCTCAGGG + Intronic
968061837 3:195731753-195731775 GGCACCTGGCTGTGGGCTCATGG - Intronic
969394169 4:6909894-6909916 GGGCCTGGGCTGCGGGCCCACGG + Exonic
969636776 4:8373997-8374019 GGTGCATGGCAGGGGGCGCAGGG + Intronic
969875986 4:10135899-10135921 GCTGCTTGACTGGGAGCTCAAGG + Intergenic
977679246 4:99780687-99780709 TGAGATTGGCTGGGGGCTCAGGG + Intergenic
981117936 4:141013988-141014010 GTGGCTGGGCTGGGGGCTCAGGG - Intronic
982314326 4:154016251-154016273 GGTGCCTGGCTGCTGCCTCTTGG + Intergenic
983781479 4:171674963-171674985 GGTGCTGGGCTTCGGCCCCACGG - Intergenic
986214807 5:5709578-5709600 GGTTGTTGGCTGCTGGCTCAGGG - Intergenic
986574600 5:9198915-9198937 AGTGCTTAGCAGGGGGCTCAGGG - Intronic
986764174 5:10908740-10908762 GCTGTTTGGCTGCTGTCTCAAGG + Intergenic
992962788 5:81972269-81972291 CGGGCTGGGCTGCGGGGTCAGGG + Exonic
995647575 5:114329953-114329975 GGTGCTCTCCTGGGGGCTCAGGG - Intergenic
996715621 5:126585429-126585451 AGAGCTTGGCTGTGAGCTCAAGG + Intronic
998020603 5:138766728-138766750 GATGCTTGGTTTGGGGCTCATGG + Intronic
998071031 5:139198218-139198240 GGAGCTGGGCGGGGGGCTCAGGG - Intronic
998625047 5:143836949-143836971 GGTTCGTGGCTGCTGGCCCAAGG - Intergenic
1000763081 5:165251126-165251148 GGTACTTGGCTGTGTGCTTAGGG + Intergenic
1003170509 6:3718465-3718487 GGTGGTTGGATGTGGGCTCATGG - Intergenic
1003361544 6:5431129-5431151 AGTTCTTGGCTGCGGGGTGATGG + Exonic
1006474229 6:34244594-34244616 GGGGCTTGGCTCCTGGCTCTGGG + Intronic
1006811899 6:36825477-36825499 GGTGGTTGCCTGTGGGGTCAGGG - Intronic
1007250184 6:40490029-40490051 GGTGCTGGGCTCCGGGCTCCAGG - Intronic
1009691799 6:67044272-67044294 TGTGATTGGCTGAGGTCTCACGG - Intergenic
1010468632 6:76198919-76198941 GATTCTTGGCTGCCTGCTCATGG + Intergenic
1011337370 6:86276014-86276036 GGGGGTTGGCTGTGGGCTCAGGG + Intergenic
1018978160 6:168581433-168581455 GGTGCTTGGCTGCAGGTCCCTGG - Intronic
1019288368 7:234906-234928 GGTGCTGGCCTGAGGGCTCCTGG - Intronic
1021868130 7:24979359-24979381 GGTGCTGGGCTGGAGGCCCAGGG - Intronic
1022531017 7:31066947-31066969 GGGGCATGGCTGAGGGCCCAGGG + Intronic
1027211237 7:76150437-76150459 GGTGTCTGGCCGCTGGCTCAGGG - Intergenic
1030992503 7:116317318-116317340 GCTGCTTGGCTGCTGACTCTGGG - Intronic
1035690544 8:1556894-1556916 GGTGCATGGCTGCTGCCTCCCGG - Intronic
1035752656 8:2007457-2007479 AGGGCTTGGCTGGGAGCTCATGG - Intergenic
1036265025 8:7266771-7266793 GGTGCCTGACTGCAGGCTGAGGG - Intergenic
1036318381 8:7732984-7733006 GGTGCCTGACTGCAGGCTGAGGG - Intergenic
1036319690 8:7740631-7740653 GGTGCCTGACTGCAGGCTGAGGG - Intergenic
1036320997 8:7748279-7748301 GGTGCCTGACTGCAGGCTGAGGG - Intergenic
1036351123 8:8013085-8013107 GGTGCCTGACTGCAGGCTGAGGG + Intergenic
1036632588 8:10525758-10525780 GGGGCATGGATGGGGGCTCATGG + Intronic
1036788952 8:11705028-11705050 GTCGCTTGGCTTTGGGCTCAGGG + Intronic
1036846410 8:12173504-12173526 GGTGCCTGACTGCAGGCTGAGGG + Intergenic
1036867773 8:12415823-12415845 GGTGCCTGACTGCAGGCTGAGGG + Intergenic
1037836154 8:22215971-22215993 GAGGCTGGGCTGGGGGCTCAGGG - Intergenic
1044336093 8:90985603-90985625 GGGGCTTGGCGGCGGGTTCCAGG + Intergenic
1047359344 8:124153415-124153437 GGTGCTGGGCTTGGAGCTCATGG + Intergenic
1049228993 8:141472517-141472539 GGTGCTTAGCTCCAGGGTCAGGG + Intergenic
1049657770 8:143806315-143806337 GGTGCTTGGCTGCCTTCTCCCGG - Intronic
1051937497 9:22460662-22460684 GGTGTTTGGCTGAGGACTCACGG - Intergenic
1052743762 9:32419102-32419124 GGTGATTGGCTACAGGCTGATGG + Exonic
1056692776 9:88822365-88822387 ATTGCTAGGCTGGGGGCTCAAGG + Intergenic
1059328852 9:113522565-113522587 GGTGCTGGGCTGGAGGCTCCAGG + Intronic
1060588501 9:124801557-124801579 GGGGCTTGGCTGTGGGCTGGAGG - Exonic
1060937908 9:127526678-127526700 GGGGCTTCCCTGAGGGCTCAGGG + Intronic
1061059346 9:128242935-128242957 GCTGCTGGGCTGCAGGGTCAGGG - Intronic
1061801303 9:133114746-133114768 CGTGCTTGGCTGTGTCCTCAAGG + Intronic
1061925931 9:133806059-133806081 GGTGAGTGGCTGCCGGCTCCTGG - Exonic
1193181091 X:78457156-78457178 GGTGCCTGGCTGAGGTCTCAGGG + Intergenic
1195361640 X:104087913-104087935 GCTGTGTGGGTGCGGGCTCATGG - Intergenic
1201274482 Y:12285272-12285294 GGTGCTGGGGAGGGGGCTCAGGG + Intergenic
1202048370 Y:20756444-20756466 AGTGCTGGGCTGCGGAGTCAAGG - Intronic