ID: 1133281402

View in Genome Browser
Species Human (GRCh38)
Location 16:4667407-4667429
Sequence TGGGGAGCCCAGTACTAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 93}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133281402_1133281403 -9 Left 1133281402 16:4667407-4667429 CCTTTTTAGTACTGGGCTCCCCA 0: 1
1: 0
2: 1
3: 7
4: 93
Right 1133281403 16:4667421-4667443 GGCTCCCCAGCTGCTCTCCCCGG 0: 1
1: 1
2: 6
3: 56
4: 464
1133281402_1133281406 -4 Left 1133281402 16:4667407-4667429 CCTTTTTAGTACTGGGCTCCCCA 0: 1
1: 0
2: 1
3: 7
4: 93
Right 1133281406 16:4667426-4667448 CCCAGCTGCTCTCCCCGGCCCGG 0: 1
1: 0
2: 5
3: 42
4: 422
1133281402_1133281412 14 Left 1133281402 16:4667407-4667429 CCTTTTTAGTACTGGGCTCCCCA 0: 1
1: 0
2: 1
3: 7
4: 93
Right 1133281412 16:4667444-4667466 CCCGGACTCGTCAGAAGCCACGG 0: 1
1: 0
2: 0
3: 1
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133281402 Original CRISPR TGGGGAGCCCAGTACTAAAA AGG (reversed) Intronic
902237050 1:15064232-15064254 TGGGGAGCCCAGGACTAGAAAGG - Intronic
902345805 1:15816482-15816504 TGGGATGTCCAGTAATAAAATGG + Intergenic
902430613 1:16360214-16360236 TGGGGTCCCCTGTACCAAAAGGG + Intronic
905663334 1:39745374-39745396 GGGAGAGCCCATTGCTAAAAAGG + Exonic
907576232 1:55528157-55528179 TGGGGATCTGAGTACTGAAATGG + Intergenic
910163382 1:84298388-84298410 GGGGAAGGCCAGTACTAGAAGGG - Exonic
910856037 1:91696878-91696900 TGGGCAGCCCAGCACTCCAAAGG + Intronic
915253633 1:154608662-154608684 TTAGGAGCTCAGTACTGAAACGG - Intronic
915294368 1:154909778-154909800 TGGAGAGCACAGCACCAAAATGG + Intergenic
917604466 1:176612513-176612535 TGGGAAGCTCAGAACTAAAATGG - Intronic
918531466 1:185526910-185526932 TGGGTATCCCAGTACAAAAATGG - Intergenic
1075189706 10:120295665-120295687 TGGTGAGCCCAGAAATACAATGG + Intergenic
1077777584 11:5288448-5288470 TGGGGACCCCAGTACACAAGAGG - Intronic
1078648601 11:13166282-13166304 TGGGGAGCTCAGTAAACAAATGG - Intergenic
1083834805 11:65259254-65259276 TAGGTAGCCCAGGGCTAAAATGG - Intergenic
1088156479 11:106810410-106810432 TGGAGAGCCCAAAAATAAAATGG + Exonic
1089152806 11:116377090-116377112 TGGGGAGCCAAGGACAGAAAAGG + Intergenic
1091002041 11:131917869-131917891 TGAGGAGCCAAAAACTAAAATGG + Intronic
1094026189 12:25961645-25961667 TGGGGATACCACTACTTAAAGGG + Intronic
1094107448 12:26829621-26829643 TGGTGAGCCTAGGACTTAAATGG - Intronic
1095242324 12:39875837-39875859 TAGGTAGCCCATTACTTAAATGG - Intronic
1097322000 12:58236390-58236412 TTGGGAGTTGAGTACTAAAAGGG + Intergenic
1097814213 12:64054526-64054548 TGGGGAATACAGTACTACAATGG - Intronic
1098614429 12:72505869-72505891 TGGGGAGCCTGGTATTACAAGGG - Intronic
1099963624 12:89421337-89421359 TGGGCATCCCAGTTCTTAAAAGG - Intronic
1102107426 12:110337321-110337343 TGGCCAGCCTAGTACTGAAAGGG + Intronic
1105236990 13:18566245-18566267 TGGGGAATCAAGTAATAAAATGG - Intergenic
1106716387 13:32392823-32392845 TTGGGATCCCAGAACAAAAAAGG - Intronic
1106754370 13:32807728-32807750 TGGGGAGGGCAGTACAAAAAGGG - Intergenic
1108004099 13:45930509-45930531 TGTGGAGCTCAGCAATAAAAGGG - Intergenic
1111914239 13:94344135-94344157 TTGTGAACCCAGGACTAAAATGG + Intronic
1114352081 14:21863928-21863950 TAGGGAGCATAGTACTGAAAAGG + Intergenic
1119128428 14:72149970-72149992 TGGGTAGCCCAATAGTAAGATGG - Intronic
1121544089 14:94750950-94750972 TGGGGTGCCCAGAATTAAACAGG - Intergenic
1122424861 14:101600019-101600041 TAGGGAGCTCAGTGCCAAAATGG - Intergenic
1122941617 14:104984074-104984096 TGGGGAGCACAGTACTCCCAGGG - Intergenic
1124001411 15:25763448-25763470 CTGGGAGCCCAGTACTGGAAGGG - Intronic
1125551453 15:40547871-40547893 AGGGGAGGCCTGTACAAAAAAGG + Intronic
1127393454 15:58525391-58525413 AGGGGAGCTCTGAACTAAAAAGG - Intronic
1128543125 15:68550823-68550845 GGGGGACCCCAAGACTAAAATGG + Intergenic
1128820356 15:70646824-70646846 AGGAGAGCCCAGTACTATGAGGG + Intergenic
1130981319 15:88813626-88813648 TGGGTAGCCCAGTAGTGATAAGG - Intronic
1131951658 15:97688098-97688120 TGGGGACCCCAGTTTTATAAAGG + Intergenic
1133281402 16:4667407-4667429 TGGGGAGCCCAGTACTAAAAAGG - Intronic
1141898938 16:86977518-86977540 TGGTCAGCCCAGTACTGAAGAGG + Intergenic
1143143050 17:4753777-4753799 TGGGGTGCCCACAACTAACAGGG - Intergenic
1148806377 17:50266123-50266145 GGAGAAGCCCAGGACTAAAATGG - Intergenic
1149644612 17:58230993-58231015 TGGGGAGCTCAGTATTTACATGG - Intronic
1150970376 17:70020486-70020508 TTAGGAGCCCAGGATTAAAAAGG - Intergenic
1151473072 17:74329978-74330000 TGGGGAGCCCAGAGGTAAACAGG - Intronic
1163797891 19:19347859-19347881 TGGGGATCCCAGGGCTAAAAGGG - Intronic
1164220174 19:23186211-23186233 TGGGGAGCCCAGAGCGAGAAAGG + Intergenic
931901422 2:66793019-66793041 TGTGGAGCCAGCTACTAAAAAGG + Intergenic
932222250 2:70008808-70008830 TGGGGAGGACAGGGCTAAAAGGG + Intergenic
934136899 2:89004706-89004728 TGGGGAGCACAGTGCTACATTGG - Intergenic
935340190 2:102052915-102052937 TGGGCAGCCCAGTAGTCACATGG + Intergenic
938512795 2:131968315-131968337 TGGGGAATCAAGTAATAAAAGGG + Intergenic
941172307 2:162154302-162154324 TGGGGCTCCCAGTACCATAAGGG + Intergenic
944264904 2:197712632-197712654 GGGGGAAACCATTACTAAAAAGG + Intronic
945725215 2:213466390-213466412 TGGGGAACCAAATATTAAAAGGG - Intronic
947155783 2:227161856-227161878 TTCTGAGCTCAGTACTAAAATGG - Intronic
948714634 2:239853105-239853127 TGGGAATCCCAGTAGCAAAATGG + Intergenic
1170516817 20:17138499-17138521 TGGTGAGCCAAGTACAAAATGGG - Intergenic
1171426823 20:25054025-25054047 TGGAGAGCCAGGTTCTAAAAGGG - Intronic
1174032850 20:47644672-47644694 TGGGGAGTCCTGAAATAAAAGGG - Intronic
1176780977 21:13194527-13194549 TGGGGAATCAAGTAATAAAATGG - Intergenic
1177978661 21:27883630-27883652 TGGGGAATCAAGTAATAAAATGG - Intergenic
1181372477 22:22429315-22429337 TTGGGAGACCAGTAAGAAAAGGG - Intergenic
1183278043 22:36913735-36913757 TGGGGAGTCCAGGATGAAAAAGG + Intronic
1183671061 22:39273166-39273188 TGGGGAGCCCAGATCCAACAGGG - Intergenic
950968541 3:17163909-17163931 AGGGGACCCAAGTACCAAAAGGG + Intronic
954558152 3:51534420-51534442 TGGGGAACACAGCACTAAACAGG - Intergenic
956997449 3:74844107-74844129 TTGGGGGCCCAGTACTGAAATGG - Intergenic
957298002 3:78356322-78356344 TGGGGAGGTAAGTAGTAAAAGGG - Intergenic
960616541 3:119600813-119600835 TGGGGAGCCCAGGGCTCAAGGGG + Intronic
963286376 3:143438281-143438303 TGGGGAGCTCAGTCTCAAAATGG + Intronic
965781439 3:172290084-172290106 TTGGGAGCACAGTTGTAAAAAGG + Intronic
966095819 3:176201707-176201729 TGGGTATCCCAGAACAAAAATGG + Intergenic
966968913 3:185024368-185024390 AGGGGATCCCACTGCTAAAAAGG + Exonic
976908260 4:90267099-90267121 AGGGGAGCCCAGTGTTAGAAAGG + Intronic
984811570 4:183799921-183799943 TGAGGAGCTCAGTACTACAGAGG - Intergenic
990029404 5:51238715-51238737 TGGGGAGAAAGGTACTAAAAAGG - Intergenic
991963142 5:72065495-72065517 TGGGGACCCCAGCTCTAAAATGG + Intergenic
993160282 5:84281404-84281426 TGGAGTGCCCATTACTGAAAGGG - Intronic
996561863 5:124838565-124838587 TGGGGAGCAGAGTGCAAAAAAGG + Intergenic
1000399497 5:160811437-160811459 AGGGGAGCCCAGTACTTGGAAGG + Intronic
1003631974 6:7795443-7795465 TGGGGATCCCTGAACTAACAGGG - Intronic
1004741433 6:18464976-18464998 TGGGGAGGCCAGGAGTAACAAGG - Exonic
1004949800 6:20656171-20656193 TAGGAAGCACAGTAATAAAATGG - Intronic
1011498930 6:87966647-87966669 TGTGTACCTCAGTACTAAAATGG - Intergenic
1016891329 6:149010318-149010340 TGTGGAGCCCACAACTACAATGG - Intronic
1021658354 7:22894282-22894304 TGGGGAAGTCAGTGCTAAAAGGG + Intergenic
1024136819 7:46417237-46417259 TGGGGAGCAGAGAACAAAAACGG - Intergenic
1024166588 7:46739086-46739108 TGGGCAGACCAGTACTAGAAAGG + Intronic
1025022384 7:55489830-55489852 TGGGGAGCCCAGTGTAAACATGG + Intronic
1031565733 7:123295145-123295167 TGGGGAGCCCATTACCTCAAGGG - Intergenic
1035697981 8:1614630-1614652 TGGGGAGCCCAGCACTGCAGAGG - Intronic
1047924816 8:129672307-129672329 TGCAGAGCCAAGTACTAAGATGG - Intergenic
1059699833 9:116764363-116764385 TAGGGAGCTCAGGACTAAAGAGG - Intronic
1196619629 X:117807241-117807263 AGGGAAGCCCAGCACTATAAAGG + Intergenic
1199549659 X:149044813-149044835 TGAGTAGCCCAGTATTATAAAGG - Intergenic
1200309425 X:155062641-155062663 TGAGTCCCCCAGTACTAAAATGG + Intronic