ID: 1133284273

View in Genome Browser
Species Human (GRCh38)
Location 16:4683375-4683397
Sequence CCTCTTGGCCGAGGGTTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 115}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133284273_1133284279 -10 Left 1133284273 16:4683375-4683397 CCCAGGAACCCTCGGCCAAGAGG 0: 1
1: 0
2: 0
3: 8
4: 115
Right 1133284279 16:4683388-4683410 GGCCAAGAGGCCCCCCTCGGCGG 0: 1
1: 0
2: 0
3: 7
4: 118
1133284273_1133284289 8 Left 1133284273 16:4683375-4683397 CCCAGGAACCCTCGGCCAAGAGG 0: 1
1: 0
2: 0
3: 8
4: 115
Right 1133284289 16:4683406-4683428 GGCGGCACTGGGATCCCGGCTGG 0: 1
1: 0
2: 0
3: 21
4: 169
1133284273_1133284296 23 Left 1133284273 16:4683375-4683397 CCCAGGAACCCTCGGCCAAGAGG 0: 1
1: 0
2: 0
3: 8
4: 115
Right 1133284296 16:4683421-4683443 CCGGCTGGGAGGGACTGAACGGG 0: 1
1: 0
2: 1
3: 12
4: 127
1133284273_1133284291 12 Left 1133284273 16:4683375-4683397 CCCAGGAACCCTCGGCCAAGAGG 0: 1
1: 0
2: 0
3: 8
4: 115
Right 1133284291 16:4683410-4683432 GCACTGGGATCCCGGCTGGGAGG 0: 1
1: 1
2: 4
3: 14
4: 189
1133284273_1133284281 -4 Left 1133284273 16:4683375-4683397 CCCAGGAACCCTCGGCCAAGAGG 0: 1
1: 0
2: 0
3: 8
4: 115
Right 1133284281 16:4683394-4683416 GAGGCCCCCCTCGGCGGCACTGG 0: 1
1: 0
2: 0
3: 5
4: 137
1133284273_1133284292 13 Left 1133284273 16:4683375-4683397 CCCAGGAACCCTCGGCCAAGAGG 0: 1
1: 0
2: 0
3: 8
4: 115
Right 1133284292 16:4683411-4683433 CACTGGGATCCCGGCTGGGAGGG 0: 1
1: 0
2: 1
3: 15
4: 191
1133284273_1133284290 9 Left 1133284273 16:4683375-4683397 CCCAGGAACCCTCGGCCAAGAGG 0: 1
1: 0
2: 0
3: 8
4: 115
Right 1133284290 16:4683407-4683429 GCGGCACTGGGATCCCGGCTGGG 0: 1
1: 0
2: 0
3: 11
4: 172
1133284273_1133284297 30 Left 1133284273 16:4683375-4683397 CCCAGGAACCCTCGGCCAAGAGG 0: 1
1: 0
2: 0
3: 8
4: 115
Right 1133284297 16:4683428-4683450 GGAGGGACTGAACGGGTGACTGG 0: 1
1: 0
2: 1
3: 11
4: 146
1133284273_1133284282 -3 Left 1133284273 16:4683375-4683397 CCCAGGAACCCTCGGCCAAGAGG 0: 1
1: 0
2: 0
3: 8
4: 115
Right 1133284282 16:4683395-4683417 AGGCCCCCCTCGGCGGCACTGGG 0: 1
1: 0
2: 0
3: 6
4: 98
1133284273_1133284294 22 Left 1133284273 16:4683375-4683397 CCCAGGAACCCTCGGCCAAGAGG 0: 1
1: 0
2: 0
3: 8
4: 115
Right 1133284294 16:4683420-4683442 CCCGGCTGGGAGGGACTGAACGG 0: 1
1: 0
2: 2
3: 19
4: 186
1133284273_1133284288 4 Left 1133284273 16:4683375-4683397 CCCAGGAACCCTCGGCCAAGAGG 0: 1
1: 0
2: 0
3: 8
4: 115
Right 1133284288 16:4683402-4683424 CCTCGGCGGCACTGGGATCCCGG 0: 1
1: 0
2: 1
3: 15
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133284273 Original CRISPR CCTCTTGGCCGAGGGTTCCT GGG (reversed) Intronic