ID: 1133286513

View in Genome Browser
Species Human (GRCh38)
Location 16:4693302-4693324
Sequence TCGGCCTCCTGGGGAGAAAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133286507_1133286513 -9 Left 1133286507 16:4693288-4693310 CCATGCGGGCCGGGTCGGCCTCC No data
Right 1133286513 16:4693302-4693324 TCGGCCTCCTGGGGAGAAACGGG No data
1133286501_1133286513 10 Left 1133286501 16:4693269-4693291 CCATTGCGGATGGACGGGGCCAT No data
Right 1133286513 16:4693302-4693324 TCGGCCTCCTGGGGAGAAACGGG No data
1133286497_1133286513 19 Left 1133286497 16:4693260-4693282 CCAAGGGTGCCATTGCGGATGGA No data
Right 1133286513 16:4693302-4693324 TCGGCCTCCTGGGGAGAAACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133286513 Original CRISPR TCGGCCTCCTGGGGAGAAAC GGG Intergenic
No off target data available for this crispr