ID: 1133287681

View in Genome Browser
Species Human (GRCh38)
Location 16:4698164-4698186
Sequence TGCAGCTGGCCCTCATGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 295}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133287674_1133287681 11 Left 1133287674 16:4698130-4698152 CCTTCTAGGGGAGGGAGGGGCTC 0: 1
1: 0
2: 4
3: 29
4: 252
Right 1133287681 16:4698164-4698186 TGCAGCTGGCCCTCATGGGCTGG 0: 1
1: 0
2: 3
3: 24
4: 295
1133287666_1133287681 22 Left 1133287666 16:4698119-4698141 CCCACCTCAGACCTTCTAGGGGA 0: 1
1: 0
2: 0
3: 16
4: 159
Right 1133287681 16:4698164-4698186 TGCAGCTGGCCCTCATGGGCTGG 0: 1
1: 0
2: 3
3: 24
4: 295
1133287662_1133287681 24 Left 1133287662 16:4698117-4698139 CCCCCACCTCAGACCTTCTAGGG 0: 1
1: 0
2: 2
3: 13
4: 228
Right 1133287681 16:4698164-4698186 TGCAGCTGGCCCTCATGGGCTGG 0: 1
1: 0
2: 3
3: 24
4: 295
1133287664_1133287681 23 Left 1133287664 16:4698118-4698140 CCCCACCTCAGACCTTCTAGGGG 0: 1
1: 0
2: 1
3: 15
4: 190
Right 1133287681 16:4698164-4698186 TGCAGCTGGCCCTCATGGGCTGG 0: 1
1: 0
2: 3
3: 24
4: 295
1133287667_1133287681 21 Left 1133287667 16:4698120-4698142 CCACCTCAGACCTTCTAGGGGAG 0: 1
1: 0
2: 0
3: 9
4: 189
Right 1133287681 16:4698164-4698186 TGCAGCTGGCCCTCATGGGCTGG 0: 1
1: 0
2: 3
3: 24
4: 295
1133287670_1133287681 18 Left 1133287670 16:4698123-4698145 CCTCAGACCTTCTAGGGGAGGGA 0: 1
1: 1
2: 1
3: 10
4: 184
Right 1133287681 16:4698164-4698186 TGCAGCTGGCCCTCATGGGCTGG 0: 1
1: 0
2: 3
3: 24
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133287681 Original CRISPR TGCAGCTGGCCCTCATGGGC TGG Intronic
900379683 1:2377707-2377729 TGCCTCTGGCCCTCCTGGGGGGG + Intronic
900398515 1:2463202-2463224 TGCAGCTCCCCCTCCGGGGCTGG - Intronic
900544875 1:3222887-3222909 TGCAGTTTGCCCTCAAGGCCGGG + Intronic
900794125 1:4697816-4697838 TGCAGCGGCCACTAATGGGCTGG + Intronic
900813823 1:4828184-4828206 TTCAGCTGCACCTCATGGCCTGG - Intergenic
901519287 1:9770485-9770507 GGCAGCTGTCCCGCCTGGGCTGG + Intronic
901837680 1:11934793-11934815 TGCTACTGGCCCTGCTGGGCTGG + Exonic
902675798 1:18007830-18007852 TGCAGCTGTCCCAGATGTGCCGG + Intergenic
903474951 1:23613231-23613253 TGCAGCTGGGCCCCAGGTGCTGG + Intronic
903484016 1:23676396-23676418 TGCAGCTGCCCCTGACAGGCAGG + Intergenic
903567390 1:24278547-24278569 AGCACCTGTCCCTCTTGGGCAGG + Intergenic
903625557 1:24727671-24727693 TGGGGCTGGGCCTCCTGGGCCGG - Intergenic
903675688 1:25063127-25063149 TGCAGGAGGGCCTCAGGGGCTGG - Intergenic
903936675 1:26900210-26900232 AGAAGCTGGCCCTCAGCGGCTGG + Exonic
905252154 1:36656440-36656462 TGAGGCTGGGCCTCTTGGGCCGG + Intergenic
905446247 1:38030083-38030105 GGCAGCTGGCCTCCCTGGGCAGG - Intergenic
905648508 1:39640633-39640655 TGGAGCTGGACTTCTTGGGCAGG + Intergenic
907288187 1:53395635-53395657 AGCAGCTTGGCCTCAGGGGCCGG - Intergenic
907730584 1:57061727-57061749 TTCAGCTGCTCCTCATGGGATGG + Intronic
908423440 1:63981663-63981685 TTCAGCTGGTCCACATGGGTAGG + Intronic
909212151 1:72837667-72837689 TGGAGCTTACCCTCTTGGGCAGG + Intergenic
910638827 1:89438858-89438880 TACAGCTGGGCCTCCTGGGGTGG - Intergenic
912455292 1:109792743-109792765 TCCAGTTGGCTCTCCTGGGCTGG - Intergenic
912696979 1:111849121-111849143 TGCAGGTGGCCCTCAGAGACTGG + Intronic
914882806 1:151560597-151560619 TGCAGCTGGGCCTCAAGGCAGGG + Intronic
915306739 1:154984107-154984129 TGCAGCAGGCCCTTAAGGACAGG - Intronic
916649076 1:166818112-166818134 AACAGCTGGCCCTTATGAGCAGG - Intergenic
919296647 1:195710140-195710162 TGCAGGTGGGCCTCGTGGGGTGG - Intergenic
920171502 1:204074794-204074816 TGCCGCGGGCCCTCCAGGGCGGG - Intronic
921262276 1:213394896-213394918 TGCAGCTGCCCCTCATGCTGAGG + Intergenic
922034639 1:221836258-221836280 TGAAACTGGCCTTCATCGGCTGG - Intergenic
923039113 1:230307269-230307291 TGCTGAAGGGCCTCATGGGCAGG - Intergenic
923157264 1:231289805-231289827 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
924448334 1:244155256-244155278 TGCAGCTGTCCCACTTGTGCTGG - Intergenic
924726914 1:246679592-246679614 TGCAGCTGGTCTCCAGGGGCAGG - Intergenic
1062848688 10:727049-727071 TGCCCCTGGCCAGCATGGGCTGG - Intergenic
1063061884 10:2563973-2563995 CGCAGCTTGCCTTCATGGGCAGG - Intergenic
1064327376 10:14363908-14363930 TGCAGCTGTACCTCGTGTGCAGG - Intronic
1071273074 10:84026762-84026784 TGCAGCTGGCCCACAAGGCATGG + Intergenic
1071842889 10:89491208-89491230 GCCAGCAGGCCCTCTTGGGCAGG - Intronic
1072588391 10:96803354-96803376 TCCAGTTGTCCTTCATGGGCTGG + Intergenic
1075638995 10:124050786-124050808 TGCCAGTAGCCCTCATGGGCTGG - Intronic
1076388823 10:130080629-130080651 AGCAGCGGGGCCTCTTGGGCTGG - Intergenic
1077103736 11:833134-833156 TGCGGCTGGGCCTCCGGGGCTGG - Intronic
1077524163 11:3054187-3054209 TGCAGCTGGACCTCCGGGGCTGG - Intronic
1081578483 11:44334645-44334667 TGCAGCTGCTCCTCCTGGGAGGG + Intergenic
1081774184 11:45666145-45666167 TGCAGTTGTCCCTCTTGGGCAGG + Intergenic
1083471261 11:62885587-62885609 TGCAGCTGCCCTTCCTGGACAGG + Exonic
1083613983 11:64017616-64017638 TGCAGCTGGACCTGCTGGGGTGG - Intronic
1083839728 11:65297380-65297402 TGCAGCTGCCCCTCCCTGGCTGG - Exonic
1084179944 11:67441196-67441218 GGAAGATGGCCCGCATGGGCCGG + Exonic
1084371398 11:68746896-68746918 TGCAGCTGAGCCTCATGGTTTGG - Intronic
1084523847 11:69683982-69684004 TACAGCTAGCCCTAAGGGGCTGG - Intergenic
1086397778 11:86433851-86433873 TCCAGCTGGCCCACAAGCGCCGG + Intergenic
1088522145 11:110711950-110711972 TGCCGCTGGCCGTCAAGGGCGGG + Intronic
1089321032 11:117626824-117626846 TGCACCTGCCGCTCATGGCCAGG - Intronic
1091796473 12:3300134-3300156 TGCAGCTGGGCCCCAGGGCCCGG - Intergenic
1092141795 12:6189136-6189158 TGCAGCTGCTACCCATGGGCTGG + Intergenic
1092289915 12:7153863-7153885 TCCAGCTGCCCTGCATGGGCTGG + Intronic
1095234333 12:39778365-39778387 TACAGCTGGCCCCCAAGAGCTGG - Intronic
1098235890 12:68417822-68417844 AGCTGCTGCCCCTCTTGGGCAGG - Intergenic
1098515964 12:71376888-71376910 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1098859438 12:75690665-75690687 TGCTGCAGGCCCTCATGGCAGGG - Intergenic
1101789289 12:107912827-107912849 TGCAGCTGGCCCTCCCGCACTGG + Intergenic
1102011854 12:109623970-109623992 TGGAGCTGGGCCTGGTGGGCTGG - Intergenic
1102060171 12:109925786-109925808 TGGAGCTGGCACTGCTGGGCTGG - Intronic
1103180507 12:118907222-118907244 CGCACCTGGCCCTCCTGGACAGG + Intergenic
1103909956 12:124346676-124346698 GCCACCAGGCCCTCATGGGCCGG + Exonic
1103916848 12:124380212-124380234 TGGAGCTGGGCCTCATGGAGGGG + Intronic
1104360604 12:128129367-128129389 TGCAGCTGGCCCTTGTTAGCTGG - Intergenic
1104767253 12:131338158-131338180 TGGAGATGGCCATCAGGGGCAGG - Intergenic
1105256174 13:18745154-18745176 TGGGGCTGCCCCTCCTGGGCTGG + Intergenic
1106108757 13:26759291-26759313 GGCTGCTGCCCGTCATGGGCTGG - Exonic
1110405374 13:75144801-75144823 TCCAGGTGGCCCTCCTGGACAGG + Intergenic
1113610577 13:111642168-111642190 TGCAGCAGGCCTTCCAGGGCTGG + Intronic
1116452327 14:45080467-45080489 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
1117049558 14:51846759-51846781 TGCACCTGTCCCACATGGGAGGG - Intronic
1117159985 14:52979819-52979841 TGCAGATGGCCCTGATGGGGAGG - Intergenic
1118389008 14:65280814-65280836 TGCAGCTGCCCCGCGAGGGCCGG + Intergenic
1119061789 14:71482165-71482187 GGAAGCTGGTCCTGATGGGCAGG + Intronic
1122534624 14:102453647-102453669 TGCAGATGGCCCCCAGGGCCCGG + Intronic
1202834027 14_GL000009v2_random:64617-64639 CGCAGCTGTCTCTCATGGACAGG - Intergenic
1123783066 15:23645830-23645852 TGCCTCTGGGCCTCCTGGGCAGG + Exonic
1123886249 15:24730751-24730773 TGCAGGTGGCACTTATGGGAGGG - Intergenic
1123995283 15:25713825-25713847 TGGAGCTGCCCCACCTGGGCAGG - Exonic
1124363382 15:29054679-29054701 TGCAGCTGGCCTTGATGGGTGGG - Exonic
1124578403 15:30929251-30929273 TGCAGCCTGGCCTCAAGGGCTGG - Exonic
1124962733 15:34410439-34410461 TGCAGCTGGCCTTGATGGGTGGG - Intronic
1124979359 15:34556661-34556683 TGCAGCTGGCCTTGATGGGTGGG - Intronic
1125503484 15:40253367-40253389 GGCAGGTGGCCCTCCTGGGCTGG + Intronic
1125887270 15:43238215-43238237 TGCCTCTGGCCCTCATGGACTGG + Intronic
1126850717 15:52795289-52795311 TGCAGCTGCTGCTCTTGGGCCGG - Intergenic
1127882429 15:63170053-63170075 GGCAGCTGGGCCACATGGGGTGG + Intergenic
1128943698 15:71807891-71807913 GGCAGCTGCCCCTCCTGGGAGGG + Intronic
1129154549 15:73709703-73709725 TGGAGCTGGCCCTCTTGGCTGGG + Intronic
1131846573 15:96495323-96495345 AGCAGCTGGTCTTCCTGGGCTGG - Intergenic
1132014608 15:98304709-98304731 TGAAGCAGGCTCTCGTGGGCTGG - Intergenic
1132551965 16:557227-557249 GGCTGCTGGCCTTGATGGGCGGG - Intergenic
1132778942 16:1612555-1612577 TGCAGCCGGCGCTCGGGGGCCGG + Intronic
1133034187 16:3025856-3025878 GGCACTTGGCCCTCATGGGACGG + Intronic
1133287681 16:4698164-4698186 TGCAGCTGGCCCTCATGGGCTGG + Intronic
1134630495 16:15752585-15752607 TGCACCTGGCCCTCTTTGGAGGG - Intronic
1136276190 16:29180665-29180687 TGCAAATGGATCTCATGGGCTGG - Intergenic
1137023457 16:35452229-35452251 TGCTGGTGCCCCTCAGGGGCAGG - Intergenic
1137418824 16:48312782-48312804 TGCAGCTGACGCTCATCTGCAGG - Intronic
1138246328 16:55469555-55469577 TGCAGCTGACATTCAAGGGCAGG + Intronic
1138451138 16:57093887-57093909 TGCAGCCTGCCCTGATGGGGAGG + Intronic
1138589905 16:57994012-57994034 TGCAGCTGGGCCACGGGGGCAGG + Intergenic
1140354314 16:74292080-74292102 TGCATCTGGCCTTCATGCCCTGG - Intergenic
1141618030 16:85221189-85221211 TGCAGCTGTCCCTCCCGTGCTGG + Intergenic
1141847699 16:86622131-86622153 AGCAGGTGGCCGTCAGGGGCCGG - Intergenic
1142043284 16:87909149-87909171 TGCAGCAGCCTCTGATGGGCCGG + Intronic
1142080569 16:88146724-88146746 TGCAAATGGATCTCATGGGCTGG - Intergenic
1142155323 16:88530288-88530310 CGCAGCTGCCCCTCAGGGACTGG - Intronic
1142243254 16:88956655-88956677 TGCAGCTGCCCCACCTGGCCTGG + Intronic
1142672980 17:1495955-1495977 TGCAGCGGCCCCTCATGTACCGG + Intronic
1142856649 17:2734325-2734347 TCAAGCAGGACCTCATGGGCAGG - Intergenic
1143771786 17:9173660-9173682 TGCCTGTGGCCCTCCTGGGCTGG - Intronic
1143936836 17:10494961-10494983 AGCAGCTGGCCCTGAAGGGTGGG - Exonic
1143939331 17:10523526-10523548 AGCAGCTGGCCCTGAAGGGTGGG - Exonic
1143950705 17:10630318-10630340 AGCAGCTGGCGCTGAAGGGCGGG - Exonic
1148731489 17:49839583-49839605 TTCAGCTGGCCCTGAGGGGCAGG + Intronic
1149006710 17:51813631-51813653 TCCAGCTCTCTCTCATGGGCAGG - Intronic
1149571556 17:57675783-57675805 TGCATCTGGCCTTCAAGGGGTGG - Intronic
1152307781 17:79531247-79531269 TGCTGCAGACCCTCCTGGGCCGG - Intergenic
1154434860 18:14335524-14335546 TGGGGCTGCCCCTCCTGGGCTGG - Intergenic
1160723478 19:607566-607588 TGCGGCAGGACCTCCTGGGCCGG + Intronic
1161073815 19:2275468-2275490 TGCAGCTGCCCCTCCAGGGCTGG - Exonic
1161345727 19:3767974-3767996 AGGGGCTGGCACTCATGGGCAGG + Intronic
1162184309 19:8892754-8892776 TGCAGCTGGCACCAGTGGGCAGG + Intronic
1163842775 19:19621458-19621480 TGGATCTGGCACTCATGGGTTGG + Intergenic
1165083574 19:33326605-33326627 TGCAACTTGTCCTCCTGGGCTGG - Intergenic
1167728205 19:51233571-51233593 AGCAGCTTGCCCGCAGGGGCTGG + Intronic
925342335 2:3146177-3146199 TTCAGCAGGCCCTCAACGGCTGG + Intergenic
926302761 2:11616390-11616412 TGCAGCTGTGCCTCATGGGCAGG + Intronic
926624637 2:15080955-15080977 GGCAGCTGTCCATCAAGGGCTGG - Intergenic
927177863 2:20422792-20422814 TGCAGATGGCCTTCCTGTGCAGG - Intergenic
927194455 2:20538132-20538154 TGAAGCTGGCCCTTTGGGGCTGG - Intergenic
928395533 2:30940805-30940827 TCCAGAAGGCCTTCATGGGCTGG + Intronic
929070023 2:38020543-38020565 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
929599140 2:43194208-43194230 TGCACCTGGCCCCCAGGGCCAGG + Intergenic
931462509 2:62461334-62461356 TGCAGCTTGCCCTCAGCCGCAGG + Intergenic
932231653 2:70088292-70088314 GGGAGCTGGCCGGCATGGGCTGG - Exonic
932666631 2:73703661-73703683 AGCAGCTGGCCCAGAGGGGCTGG + Intergenic
932699303 2:73982466-73982488 AGCTCCTGTCCCTCATGGGCTGG + Intergenic
932831952 2:74998774-74998796 TGCAGCAGGCCCACATGCACTGG - Intergenic
934731596 2:96661993-96662015 TGCATCTGGCCATCATAGACAGG - Intergenic
935128589 2:100244650-100244672 TGCAGCTGGTCCTGAGGAGCTGG + Intergenic
935589904 2:104836554-104836576 TGGAGCTGGGCCTGGTGGGCTGG + Intergenic
935784531 2:106536678-106536700 TGCACCTGCACCTCATGAGCTGG - Intergenic
937330477 2:121024225-121024247 TGCAGGTGGCCCTCAGAAGCAGG + Intergenic
941905415 2:170714027-170714049 GGCAGGTGGCCCTCCTCGGCAGG + Exonic
941918824 2:170829410-170829432 TGCAGCTGACCCTCAGGGGCTGG + Intronic
942317630 2:174709897-174709919 TCCAGCTGGCCCGCAAGCGCGGG + Intergenic
945537842 2:211041207-211041229 TGCAGCCCACCCCCATGGGCTGG - Intergenic
947029874 2:225782231-225782253 TGCTTCTGCCACTCATGGGCGGG - Intergenic
947411959 2:229850749-229850771 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
947565417 2:231190233-231190255 TGGAGCTGGCCCCGCTGGGCAGG - Intergenic
947592592 2:231394100-231394122 TGCGGGTGGCCCTCAGTGGCAGG + Intergenic
947665609 2:231903607-231903629 GGGAGCTGGGCCTTATGGGCAGG + Intergenic
948763268 2:240205564-240205586 AGCAGCTGGTCCTCCTGGGAGGG - Intergenic
948818438 2:240525881-240525903 TGCACCTGGCCCTCAGGGGTGGG + Intronic
948861616 2:240755297-240755319 TGCTGCTGCCTCTCTTGGGCTGG - Intronic
948861774 2:240756066-240756088 GACAGCAGGTCCTCATGGGCAGG - Intronic
1171880911 20:30616905-30616927 TGGTGCTGCCCCTCCTGGGCTGG + Intergenic
1172044428 20:32070398-32070420 TGTAGCTGAAGCTCATGGGCAGG - Intronic
1172594245 20:36139114-36139136 GGAAGCTGGCCCTCTTGGGCCGG - Intronic
1172604942 20:36207819-36207841 TGCGGCCAGCCCCCATGGGCGGG - Intronic
1174171362 20:48620007-48620029 TGCAGCTGGCCCTGCTGCCCTGG - Intergenic
1174341684 20:49901104-49901126 AGCAGCTGGCCCTGATGCTCTGG - Intergenic
1174509891 20:51043039-51043061 TGAAGCTGGCCCTGGTGGTCTGG + Intergenic
1174538069 20:51268001-51268023 TGCAGCTGGCCCTGCTGAGGAGG + Intergenic
1175371593 20:58496323-58496345 TGTAGCAGCCCCTCATGGGCAGG + Intronic
1175552645 20:59827213-59827235 ACCAGCTGGCCTTCATGGGCGGG + Intronic
1175717053 20:61262185-61262207 TGCAGCTGGCCAGCCGGGGCGGG + Intronic
1176659837 21:9623913-9623935 TGGGGCTGGGCCTCATGGGATGG + Intergenic
1176842176 21:13850178-13850200 TGGGGCTGCCCCTCCTGGGCTGG + Intergenic
1176849494 21:13901893-13901915 TGCAGCTGCCTCTCATGGACAGG + Intergenic
1179479586 21:41668943-41668965 GGCAGCCGGCCCTCCTTGGCTGG - Intergenic
1180868752 22:19134372-19134394 TGTAGCTGGCCCGCAGGGCCCGG + Exonic
1180982533 22:19885570-19885592 AGGAGCTGGGCCCCATGGGCAGG + Intronic
1181169207 22:20998787-20998809 TGCACCTGGCCCACATGGCTGGG - Exonic
1181488150 22:23244606-23244628 TTCCGCTGGCTCCCATGGGCAGG + Intronic
1184090984 22:42292962-42292984 AGGAGCTGGGCCTCATAGGCAGG + Intronic
1184152807 22:42648490-42648512 TGCTGCTGTCACTCCTGGGCTGG - Intronic
1184229840 22:43152482-43152504 GGCAGTAGGCCTTCATGGGCAGG - Intronic
949731177 3:7114945-7114967 TGCAAATGGCCCTCATGAGAAGG + Intronic
949769961 3:7568629-7568651 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
950362291 3:12458184-12458206 TGTAGCTGGAACTCATGGGTAGG - Intergenic
953002857 3:38951183-38951205 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
953957751 3:47244740-47244762 AGCAGCTGGCCCTCCTCGGTGGG - Intronic
954715052 3:52522782-52522804 TCCACCTGTGCCTCATGGGCTGG + Exonic
954815235 3:53275066-53275088 TGCATAAGGCTCTCATGGGCTGG + Intergenic
957778476 3:84787366-84787388 TGCATCTGGCCTTCAAAGGCAGG - Intergenic
958034737 3:88156317-88156339 TGCATCTTCTCCTCATGGGCTGG + Exonic
960282104 3:115791593-115791615 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
961003764 3:123391083-123391105 GGCAGCTGGTCCTCATGTGCAGG - Intronic
964130515 3:153281427-153281449 TGCACGTGGCGCTCGTGGGCCGG + Intergenic
966263745 3:178012572-178012594 TGCAGTTTGTCCTAATGGGCAGG + Intergenic
966440872 3:179942723-179942745 GGCAGCTGGCCTTGAAGGGCTGG - Intronic
966726892 3:183116317-183116339 TGCAGCCAGTCCTCACGGGCAGG - Intergenic
970281624 4:14462903-14462925 TGCAGGTGGCCCTGAGAGGCTGG - Intergenic
972006483 4:34114644-34114666 TGCACCTGGCCATCATCAGCAGG - Intergenic
973964439 4:56147136-56147158 TGCAGCTGGCCCTCTCTGCCTGG + Intergenic
978324369 4:107535432-107535454 TGCAGGTGTCCCTCAGGGCCAGG + Intergenic
978665301 4:111174871-111174893 TGAAGCTGCCCCTCATGAACTGG + Intergenic
981146806 4:141333522-141333544 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
981397904 4:144275687-144275709 TGCAGGCTTCCCTCATGGGCTGG + Intergenic
981577099 4:146216960-146216982 TGCAGGCTGCCCTCGTGGGCTGG + Intergenic
984978529 4:185254429-185254451 TGGGGCTGTACCTCATGGGCAGG + Intronic
985610472 5:885132-885154 TGCTGCTGGCCTTCAGGGGTCGG - Intronic
986912420 5:12574273-12574295 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
987794100 5:22605843-22605865 TGCACAAGGACCTCATGGGCTGG - Intronic
989283838 5:39675843-39675865 TCCAGGAGGCCCTCTTGGGCAGG + Intergenic
993445357 5:88004964-88004986 TGGAACTGGAACTCATGGGCAGG + Intergenic
993822003 5:92631365-92631387 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
1002876953 6:1219184-1219206 TGCAGCTGGGCCTCATGTGAAGG + Intergenic
1002924684 6:1598596-1598618 TGCCCCTGGGCCTGATGGGCCGG + Intergenic
1003807867 6:9746797-9746819 TCCAACTGGCCCTAATGGGATGG - Intronic
1004176134 6:13341769-13341791 TGCAGCTGTGGCTCATGGGAAGG - Intergenic
1006846908 6:37068714-37068736 TGCAGCTGGCCCTCACTGAGTGG + Intergenic
1007703280 6:43776593-43776615 AGCAGTTTGCCCTCTTGGGCGGG + Intronic
1011660534 6:89590482-89590504 TGCATCTGGCTCTCCTGGGGAGG - Intronic
1013233649 6:108177464-108177486 TGCAGCTGGCCCTCCTCTGAGGG - Intronic
1013312767 6:108912702-108912724 GGCACCAGGCCCTCATGGGGTGG - Intronic
1016921238 6:149296178-149296200 TGCCTCTGACCCTCACGGGCAGG - Intronic
1019218139 6:170456610-170456632 TGCAGGTGGGCATGATGGGCGGG - Intergenic
1019427710 7:985175-985197 TCCCGCTGGCCCTACTGGGCTGG + Exonic
1019599819 7:1875561-1875583 AGCAGGTGGCCCACACGGGCTGG + Intronic
1019884597 7:3892968-3892990 TGCAGCTCGGCCTCCTGGGAAGG - Intronic
1021101060 7:16586287-16586309 AGCAGCTGGCCCTCGTCGGGAGG - Intergenic
1024604073 7:51010679-51010701 TGCAGCTGGACCCCGTGGCCAGG - Intergenic
1025150203 7:56541453-56541475 TGGAGCTGCCCCTCCTGGGCTGG + Intergenic
1025776885 7:64568469-64568491 TGCAGCTGGCCCACAGGTGTGGG - Intergenic
1026511780 7:71033439-71033461 TTGAGCTGGTGCTCATGGGCAGG + Intergenic
1026644845 7:72158588-72158610 TACAGAGGGCCCTCATGGGTAGG + Intronic
1028753121 7:94404859-94404881 TCCAGCTGGCCCTCCTGGCAAGG + Exonic
1029274577 7:99396571-99396593 TGCAACAGCCCCTCATGGCCAGG - Exonic
1029283124 7:99449440-99449462 AGCAGCTGGCTCTCCTGGGCAGG + Intronic
1030457561 7:109793785-109793807 TTCTGGTGGACCTCATGGGCAGG + Intergenic
1030711712 7:112757627-112757649 TCCAGGTGGCCCTCATGGGCAGG - Intergenic
1032444209 7:131967361-131967383 TGCTGCTTGCCTTCAAGGGCTGG + Intergenic
1033597700 7:142868591-142868613 TGCAGATGACCTTCCTGGGCCGG + Exonic
1033673120 7:143511786-143511808 TGCACCTGGCCACCCTGGGCGGG - Intergenic
1034449807 7:151131197-151131219 TGCGGCGGGCTCTCTTGGGCCGG - Intronic
1034632168 7:152539188-152539210 TCCAGCTGGCCCGCAAGCGCTGG + Intergenic
1035053393 7:156017647-156017669 TGCAGAGGACTCTCATGGGCAGG + Intergenic
1035054999 7:156029250-156029272 AGCAGCTGGCCCCAAGGGGCAGG - Intergenic
1038012757 8:23487752-23487774 TGAAGCAGGCCCACATGGGCAGG - Intergenic
1039527601 8:38230998-38231020 TGCAGCTGGCACCAATGGGCTGG + Intronic
1041954624 8:63543695-63543717 TGCAGCTGGGACTCAAGGGTTGG + Intergenic
1042145658 8:65727235-65727257 TGCAGCTGCCACTCATGATCTGG - Exonic
1044395084 8:91702213-91702235 TGCAGCTGCCCTTCTTGGGAAGG + Intergenic
1047014974 8:120714368-120714390 TGAGGCTGGCCCTCATGAGTAGG + Intronic
1049236676 8:141515599-141515621 TGGGGCTGGCCCTCGAGGGCAGG - Intronic
1049455604 8:142684766-142684788 TGCAGGTGGCCCTCCCTGGCTGG - Intergenic
1049642224 8:143720899-143720921 GGGGGCTGTCCCTCATGGGCTGG - Intronic
1051678190 9:19579900-19579922 GGCCACTGGCACTCATGGGCTGG + Intronic
1052880589 9:33599085-33599107 TGGGGCTGCCCCTCCTGGGCTGG - Intergenic
1053072106 9:35107724-35107746 TGCAGCTGGCCTGGAGGGGCTGG + Exonic
1053390569 9:37732489-37732511 GGCATCTGGCCCTCCTGGCCAGG - Intronic
1053495381 9:38545126-38545148 TGGGGCTGCCCCTCCTGGGCTGG + Intronic
1055985843 9:82056174-82056196 TGGGGCTGTCCCTCCTGGGCTGG - Intergenic
1056585496 9:87924944-87924966 TGGGGCTGCCCCTCCTGGGCTGG + Intergenic
1056611385 9:88127999-88128021 TGGGGCTGCCCCTCCTGGGCTGG - Intergenic
1056687167 9:88776242-88776264 CGAAGCTGCCCCTCAGGGGCTGG + Intergenic
1056764714 9:89437607-89437629 TGCCGCTGGCACACATGGGCAGG - Intronic
1057198161 9:93126621-93126643 TGCAGCCGGCCCGCTGGGGCTGG - Exonic
1057809465 9:98246707-98246729 TGCAGCTGGGCCTTAAGGACTGG + Intronic
1058694471 9:107547787-107547809 GGCTCCTGGCCCCCATGGGCAGG - Intergenic
1059023564 9:110601289-110601311 TGCACCTGGCTATTATGGGCTGG - Intergenic
1059320395 9:113464089-113464111 CGCAGTTGGCACTCATGGCCGGG - Intronic
1059324524 9:113496168-113496190 TGCACCTGGCCCTCATCTTCTGG - Intronic
1059337452 9:113578162-113578184 TGCAGCAGGTCCTGATGGACAGG + Intronic
1060394236 9:123304374-123304396 TGCAGCAGGACCCCATAGGCAGG + Intergenic
1060407576 9:123380487-123380509 GGCAGCTGGCCTTCCTGGGTTGG - Exonic
1060514308 9:124256534-124256556 AGCAGCTGGCCCACAGGAGCGGG - Intergenic
1060541060 9:124430495-124430517 TTCAGCTGTCCATCATGAGCTGG - Intergenic
1060872148 9:127051078-127051100 CTCTACTGGCCCTCATGGGCGGG + Intronic
1060902120 9:127268350-127268372 TGCAGCTGCGCCTCATGTGATGG + Intronic
1060947560 9:127579136-127579158 TGCAGCTGCCCCTCACCAGCTGG + Intergenic
1061406138 9:130393991-130394013 TCCAGCTGACCGTCATGGGTGGG + Intronic
1061601815 9:131675271-131675293 TTCAGCTGACCCTGCTGGGCTGG - Intronic
1061677632 9:132227432-132227454 GGCAGGTGGCCCCCATGGGATGG + Intronic
1062081742 9:134627705-134627727 TGCAGCTGTCCCACCTGGGGTGG + Intergenic
1062213788 9:135378281-135378303 TGCTGCTGGCACACATGGGGCGG - Intergenic
1062634995 9:137486015-137486037 TGCAGGAGACCCTCGTGGGCAGG - Intronic
1203546742 Un_KI270743v1:133823-133845 CGCAGCTGTCTCTCATGGACAGG + Intergenic
1203637398 Un_KI270750v1:125757-125779 TGGGGCTGGGCCTCATGGGATGG + Intergenic
1185626869 X:1488602-1488624 AGGAGCTGGCACCCATGGGCTGG - Intronic
1185643582 X:1601318-1601340 TGCTGCTGGCCCGCCTGGCCCGG - Exonic
1187788871 X:22925583-22925605 TGCAGCTGCCTCTCATTGGTAGG - Intergenic
1189487554 X:41444969-41444991 TGTACCTGGCCCTCCTGGGGTGG - Intergenic
1190344675 X:49326748-49326770 TGAAGATGGTCCTGATGGGCAGG + Exonic
1190345768 X:49336305-49336327 TGAAGATGGTCCTGATGGGCAGG + Exonic
1190346872 X:49345855-49345877 TGAAGATGGTCCTGATGGGCAGG + Exonic
1190348121 X:49536882-49536904 TGAAGATGGTCCTGATGGGCAGG + Exonic
1190349222 X:49546438-49546460 TGAAGATGGTCCTGATGGGCAGG + Exonic
1190350326 X:49555994-49556016 TGAAGATGGTCCTGATGGGCAGG + Exonic
1190351428 X:49565553-49565575 TGAAGATGGTCCTGATGGGCAGG + Exonic
1190352528 X:49575106-49575128 TGAAGATGGTCCTGATGGGCAGG + Exonic
1190353629 X:49584654-49584676 TGAAGATGGTCCTGATGGGCAGG + Exonic
1190354731 X:49594176-49594198 TGAAGATGGTCCTGATGGGCAGG + Exonic
1190355836 X:49603726-49603748 TGAAGATGGTCCTGATGGGCAGG + Exonic
1190456551 X:50633618-50633640 TACAGCTGGAGCTCATTGGCTGG + Exonic
1191108707 X:56788668-56788690 TACAGCTTGCCCTCCTTGGCTGG - Intergenic
1192233745 X:69283475-69283497 TGCAGCCGGCACTCTTGAGCAGG - Intergenic
1194437973 X:93893419-93893441 TGCAGCTGTCCTTCATTGGAAGG + Intergenic
1196563061 X:117173607-117173629 TGGAGCTGGACCCCTTGGGCAGG - Intergenic
1198695013 X:139325965-139325987 TGCAGCTGTCCTTCTTGGGAAGG - Intergenic
1198729054 X:139707710-139707732 TGCACCTGGGCTTCATGGGATGG - Intronic
1199815330 X:151392283-151392305 CGCTGCCGCCCCTCATGGGCAGG + Intergenic
1199989120 X:152974747-152974769 TGCAGATAGGCCTCATTGGCTGG - Intergenic
1200829944 Y:7679925-7679947 TGCAGGAGGCCCTCTTGTGCTGG - Intergenic
1200951284 Y:8902244-8902266 TGCAGGAGGCCCTTATGTGCTGG + Intergenic
1200988430 Y:9326820-9326842 TGCAGGAGGCCCTCCTGTGCTGG - Intergenic
1201018148 Y:9625254-9625276 TGCAGGAGGCCCTCGTGTGCTGG - Intergenic
1202119578 Y:21509372-21509394 TGCAGGAGGCCCTCCTGTGCTGG + Intergenic
1202122030 Y:21532912-21532934 TGCAGGAGGCCCTCCTGTGCTGG + Intronic
1202156976 Y:21896470-21896492 TGCAGGAGGCCCTCCTGTGCTGG - Intronic
1202159422 Y:21920011-21920033 TGCAGGAGGCCCTCCTGTGCTGG - Intergenic
1202185870 Y:22184926-22184948 TGCAGGAGGCCCTCCTGTGCTGG - Intergenic
1202205490 Y:22401470-22401492 TGCAGGAGGCCCTCCTGTGCTGG + Intronic