ID: 1133288855

View in Genome Browser
Species Human (GRCh38)
Location 16:4704699-4704721
Sequence AGCAGCGCACCCGACCCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 91}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133288845_1133288855 21 Left 1133288845 16:4704655-4704677 CCCTGAGAAAACAGCAGGGCCTG 0: 1
1: 0
2: 2
3: 30
4: 323
Right 1133288855 16:4704699-4704721 AGCAGCGCACCCGACCCAGCTGG 0: 1
1: 0
2: 0
3: 8
4: 91
1133288846_1133288855 20 Left 1133288846 16:4704656-4704678 CCTGAGAAAACAGCAGGGCCTGT 0: 1
1: 1
2: 3
3: 28
4: 243
Right 1133288855 16:4704699-4704721 AGCAGCGCACCCGACCCAGCTGG 0: 1
1: 0
2: 0
3: 8
4: 91
1133288848_1133288855 2 Left 1133288848 16:4704674-4704696 CCTGTTTTCTTGGCCTCCTGCCC 0: 1
1: 0
2: 5
3: 43
4: 375
Right 1133288855 16:4704699-4704721 AGCAGCGCACCCGACCCAGCTGG 0: 1
1: 0
2: 0
3: 8
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133288855 Original CRISPR AGCAGCGCACCCGACCCAGC TGG Intronic
901380423 1:8869959-8869981 AGCAACCCACCCGACTCTGCAGG - Intronic
902876850 1:19345552-19345574 ACCAGCTCACCCGAGCCAACTGG + Intronic
903262094 1:22136876-22136898 AGCTGGGCACCCGACTCAGGAGG + Intronic
903641651 1:24864101-24864123 GCCACCGCACCCGGCCCAGCTGG + Intergenic
907031668 1:51178275-51178297 AGCAGGCCACCGGAGCCAGCAGG + Intergenic
908028141 1:59972349-59972371 AACAGCTCACCAGACCCAGGGGG - Intergenic
915604457 1:156941863-156941885 AGCAGGGCCCCACACCCAGCAGG - Exonic
1062938154 10:1403019-1403041 ACGAGCGCACCTGCCCCAGCAGG - Intronic
1063036403 10:2290583-2290605 AGCAGCGCCCCTGACACTGCAGG + Intergenic
1064322192 10:14315978-14316000 AGCAGGGCACCCAACCCACCTGG - Intronic
1070753046 10:78975102-78975124 AGCAGGGAAGCCAACCCAGCAGG + Intergenic
1073426459 10:103458268-103458290 GGCAGGGCACCCGGGCCAGCAGG + Exonic
1076146474 10:128126243-128126265 TGCAGCGAACGCGACCCCGCGGG - Exonic
1076227644 10:128793072-128793094 AGCAGCGCACATATCCCAGCTGG + Intergenic
1076848400 10:133081182-133081204 AGCGGCGCATCCCGCCCAGCTGG - Intronic
1084185428 11:67468698-67468720 AGGAGCTCCCCCAACCCAGCGGG + Intronic
1090387396 11:126364962-126364984 GGCAGCTCACCTGACCCTGCAGG - Intronic
1090389962 11:126382160-126382182 GGCAGCTCACCTGACCCTGCAGG - Intronic
1090703942 11:129319883-129319905 AGGAGCCCACCCCACCCAACAGG + Intergenic
1090803463 11:130188680-130188702 ACCAGCGCACACAGCCCAGCAGG - Intronic
1091356619 11:134942400-134942422 AGCAGCGCGGCCCTCCCAGCAGG + Intergenic
1103363775 12:120368648-120368670 GCGAGCGCACCCGGCCCAGCGGG - Intronic
1106522068 13:30506756-30506778 AGGAGCGCACCCCACTCAGCAGG - Intronic
1115190837 14:30745571-30745593 TGCAGCCCACCTGAACCAGCCGG + Intergenic
1116814881 14:49574742-49574764 GTCAGCTCACCAGACCCAGCAGG - Exonic
1122969473 14:105146628-105146650 AGCTGCCCACCCGGCCGAGCCGG - Exonic
1124041696 15:26111370-26111392 GGAAGCGCACCCTCCCCAGCCGG + Intergenic
1124127026 15:26945523-26945545 ATCAGCTCACACGCCCCAGCGGG - Intronic
1128537404 15:68501435-68501457 AGCAGCACAGCCCACCCAGGTGG + Intergenic
1131290196 15:91100385-91100407 TGCGGTGCAACCGACCCAGCCGG + Intronic
1132728969 16:1351452-1351474 GGCAGCGCACCAGCCCCAGGCGG + Exonic
1133288855 16:4704699-4704721 AGCAGCGCACCCGACCCAGCTGG + Intronic
1138345954 16:56320328-56320350 AGCAGCGCAGCCCACCCCTCAGG + Intronic
1145805567 17:27726210-27726232 AGCTGGCCACCCGAACCAGCAGG + Intergenic
1145903159 17:28501021-28501043 AGAAGCCCTCCCCACCCAGCAGG + Intronic
1146736483 17:35243056-35243078 AGCAGAGAACCTGACCCGGCGGG - Exonic
1147950594 17:44105598-44105620 AGCAGGGCACCCTGCCCACCTGG + Intronic
1148161538 17:45453163-45453185 AGCAGGGCACTGGCCCCAGCCGG + Intronic
1148480546 17:47957133-47957155 AGCAGCTCACAGAACCCAGCTGG - Intronic
1149384203 17:56125837-56125859 AGCAATGCACCCCACACAGCAGG + Intronic
1150392774 17:64799808-64799830 AGCAGGGCACTGGCCCCAGCCGG + Intergenic
1151499711 17:74481033-74481055 GCCACCGCACCCGGCCCAGCTGG + Intronic
1152869337 17:82743583-82743605 AGCACCACAGCCGACCCAGCTGG - Intronic
1153413089 18:4815957-4815979 AGCAGGCCACCTGAGCCAGCAGG + Intergenic
1154498038 18:14976902-14976924 AGCAGCGCGGCCCTCCCAGCAGG - Intergenic
1158204700 18:54979681-54979703 AGCAGCTCACCTGTCCCAGGTGG - Intergenic
1160428407 18:78794107-78794129 AGCAGAGGCCCCGACCCAGGAGG + Intergenic
1160437338 18:78861835-78861857 AGGAGCGCAGCCTTCCCAGCAGG - Intergenic
1162971249 19:14182699-14182721 GGCAGCCCTCCCGGCCCAGCTGG + Intronic
1163503286 19:17688411-17688433 CGCAGCGCCCCCGCCCCATCAGG - Intergenic
1168056750 19:53868720-53868742 CGCAGCGCACCCGACTCTCCGGG - Intronic
925132077 2:1501374-1501396 AGCAGCGCTCCCGACAGAGGAGG - Intronic
925948881 2:8892897-8892919 AGCAGGACACCGGATCCAGCAGG + Intronic
926000835 2:9331124-9331146 AGCAGGGCACAGCACCCAGCAGG - Intronic
926225522 2:10964516-10964538 AGCAGAGGTCCCCACCCAGCGGG - Intergenic
929553638 2:42910071-42910093 AGCAGGGCAACCGAGCCAGGAGG + Intergenic
929576345 2:43055190-43055212 AGCAGCTGACCCGACCCATCTGG - Intergenic
934786697 2:97014652-97014674 AGCAGGGCACCTGCGCCAGCAGG + Intronic
945066536 2:205952457-205952479 AGCAGAGAACCCCGCCCAGCTGG + Intergenic
945066834 2:205954821-205954843 AGCAGAGAACCCTACCCAGCTGG + Intergenic
945080848 2:206085471-206085493 AGCAGCGCCGCCGTCCCACCCGG + Intronic
945951535 2:216043505-216043527 AGCACCCCACCCCACCTAGCAGG + Intronic
947935241 2:233998549-233998571 AGCAGCTCACCCTAACTAGCTGG - Intronic
948710787 2:239824221-239824243 AGCAGCCCACCTGAGCCGGCGGG - Intergenic
1168814606 20:728205-728227 AGCTGCGGACCCGGCCCGGCCGG - Intergenic
1169758662 20:9068557-9068579 GGCTGCGCCCCCGACCCAGTCGG + Intergenic
1172745407 20:37203906-37203928 AGCATCCCACCTGTCCCAGCAGG + Exonic
1175920300 20:62447559-62447581 AGCAGCTCGCCCCACCCAGCCGG + Intergenic
1179615429 21:42580223-42580245 AGCTGCCCTCCCGGCCCAGCAGG - Intronic
1183711407 22:39505895-39505917 AGCAGCACCCTCCACCCAGCTGG - Intronic
1184890435 22:47375783-47375805 AGCAGCGCCCCCGGCCCCTCGGG - Intergenic
950202886 3:11057318-11057340 AGCAGGGCAGCTGACCCAGCTGG - Intergenic
953170131 3:40499724-40499746 AGCACCACACCAGATCCAGCAGG - Intergenic
961640221 3:128360405-128360427 AGTATGGCCCCCGACCCAGCTGG - Intronic
967494623 3:190128944-190128966 AGCAGCCCACCCCAGCCAGATGG + Intergenic
975033852 4:69657569-69657591 AGCAGGCCATCCGAGCCAGCTGG - Intergenic
976042332 4:80902079-80902101 AGGAAGGCACCTGACCCAGCTGG - Intronic
985486638 5:155628-155650 AACATCCCACCCGACCCAGAAGG + Intronic
1006135968 6:31896958-31896980 AGCAGCGCCCCCATCTCAGCGGG + Exonic
1009672930 6:66779702-66779724 AGCAGGCCACCAGAGCCAGCAGG - Intergenic
1015910177 6:138161858-138161880 CGGAGCGCACCTGACCCAGGCGG + Intergenic
1018734080 6:166674464-166674486 AGCAGGACACGCAACCCAGCAGG + Intronic
1019262441 7:88960-88982 AGAAGCAAACCCAACCCAGCAGG + Intergenic
1019434020 7:1012543-1012565 ACCAGCGCTCCCGACCTGGCAGG + Intronic
1020503396 7:8952590-8952612 TGCTGCCCACCTGACCCAGCAGG + Intergenic
1023511908 7:40962014-40962036 AGCAGGCCACCCAAGCCAGCTGG - Intergenic
1024507905 7:50178516-50178538 AGCAGAGCACCGGGCCCAACTGG - Intergenic
1024870076 7:53955013-53955035 AGCAGGCCACCAGAGCCAGCCGG - Intergenic
1026378508 7:69775734-69775756 AGCAGCTCACCCGGCCCACGTGG - Intronic
1026853223 7:73737618-73737640 CGCAGGGCACCAGGCCCAGCTGG + Exonic
1026990744 7:74583971-74583993 AGCAGGGATCCTGACCCAGCTGG - Intronic
1027411618 7:77925770-77925792 AGCACCGCACCCGGCCAAGTGGG - Intronic
1029604273 7:101589238-101589260 AGCAGGGGACCAGGCCCAGCAGG + Intergenic
1039454522 8:37698096-37698118 TGCAGCGCGCACGACCCTGCCGG + Exonic
1043847228 8:85177333-85177355 CGCAGCGGAGCCGACCCGGCAGG + Intronic
1048155051 8:131939258-131939280 AGTAACGCACCCAGCCCAGCTGG + Intronic
1049165464 8:141122767-141122789 AGCAGGACCCCTGACCCAGCAGG - Intronic
1049280464 8:141741522-141741544 AGCAGCCCACAGGACCCAGTGGG - Intergenic
1060480019 9:124012316-124012338 AGCCGCGCCCCCGGCCCCGCCGG + Exonic
1062274577 9:135724760-135724782 GGCAGCCCAGCCGACCCAGCCGG - Intronic