ID: 1133289429

View in Genome Browser
Species Human (GRCh38)
Location 16:4709232-4709254
Sequence TTGCATTTTTGGGAGAGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263614
Summary {0: 2, 1: 102, 2: 5455, 3: 79857, 4: 178198}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133289429_1133289434 -4 Left 1133289429 16:4709232-4709254 CCCTGTCTCTCCCAAAAATGCAA 0: 2
1: 102
2: 5455
3: 79857
4: 178198
Right 1133289434 16:4709251-4709273 GCAAAATTAGCCAGACGTGGTGG 0: 3
1: 266
2: 6616
3: 53276
4: 154408
1133289429_1133289439 27 Left 1133289429 16:4709232-4709254 CCCTGTCTCTCCCAAAAATGCAA 0: 2
1: 102
2: 5455
3: 79857
4: 178198
Right 1133289439 16:4709282-4709304 TGTAATCCCAGCTACTAGGGAGG 0: 4457
1: 105533
2: 254011
3: 236169
4: 467796
1133289429_1133289436 23 Left 1133289429 16:4709232-4709254 CCCTGTCTCTCCCAAAAATGCAA 0: 2
1: 102
2: 5455
3: 79857
4: 178198
Right 1133289436 16:4709278-4709300 TGCCTGTAATCCCAGCTACTAGG 0: 52453
1: 101789
2: 153905
3: 227834
4: 315316
1133289429_1133289433 -7 Left 1133289429 16:4709232-4709254 CCCTGTCTCTCCCAAAAATGCAA 0: 2
1: 102
2: 5455
3: 79857
4: 178198
Right 1133289433 16:4709248-4709270 AATGCAAAATTAGCCAGACGTGG 0: 1
1: 214
2: 3956
3: 12974
4: 25838
1133289429_1133289437 24 Left 1133289429 16:4709232-4709254 CCCTGTCTCTCCCAAAAATGCAA 0: 2
1: 102
2: 5455
3: 79857
4: 178198
Right 1133289437 16:4709279-4709301 GCCTGTAATCCCAGCTACTAGGG 0: 3551
1: 119062
2: 256286
3: 228049
4: 381809

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133289429 Original CRISPR TTGCATTTTTGGGAGAGACA GGG (reversed) Intronic
Too many off-targets to display for this crispr