ID: 1133289430

View in Genome Browser
Species Human (GRCh38)
Location 16:4709233-4709255
Sequence TTTGCATTTTTGGGAGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 424297
Summary {0: 3, 1: 201, 2: 11536, 3: 190954, 4: 221603}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133289430_1133289434 -5 Left 1133289430 16:4709233-4709255 CCTGTCTCTCCCAAAAATGCAAA 0: 3
1: 201
2: 11536
3: 190954
4: 221603
Right 1133289434 16:4709251-4709273 GCAAAATTAGCCAGACGTGGTGG 0: 3
1: 266
2: 6616
3: 53276
4: 154408
1133289430_1133289437 23 Left 1133289430 16:4709233-4709255 CCTGTCTCTCCCAAAAATGCAAA 0: 3
1: 201
2: 11536
3: 190954
4: 221603
Right 1133289437 16:4709279-4709301 GCCTGTAATCCCAGCTACTAGGG 0: 3551
1: 119062
2: 256286
3: 228049
4: 381809
1133289430_1133289433 -8 Left 1133289430 16:4709233-4709255 CCTGTCTCTCCCAAAAATGCAAA 0: 3
1: 201
2: 11536
3: 190954
4: 221603
Right 1133289433 16:4709248-4709270 AATGCAAAATTAGCCAGACGTGG 0: 1
1: 214
2: 3956
3: 12974
4: 25838
1133289430_1133289436 22 Left 1133289430 16:4709233-4709255 CCTGTCTCTCCCAAAAATGCAAA 0: 3
1: 201
2: 11536
3: 190954
4: 221603
Right 1133289436 16:4709278-4709300 TGCCTGTAATCCCAGCTACTAGG 0: 52453
1: 101789
2: 153905
3: 227834
4: 315316
1133289430_1133289439 26 Left 1133289430 16:4709233-4709255 CCTGTCTCTCCCAAAAATGCAAA 0: 3
1: 201
2: 11536
3: 190954
4: 221603
Right 1133289439 16:4709282-4709304 TGTAATCCCAGCTACTAGGGAGG 0: 4457
1: 105533
2: 254011
3: 236169
4: 467796

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133289430 Original CRISPR TTTGCATTTTTGGGAGAGAC AGG (reversed) Intronic
Too many off-targets to display for this crispr