ID: 1133289431

View in Genome Browser
Species Human (GRCh38)
Location 16:4709242-4709264
Sequence CTGGCTAATTTTGCATTTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4335
Summary {0: 4, 1: 90, 2: 158, 3: 472, 4: 3611}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133289431_1133289437 14 Left 1133289431 16:4709242-4709264 CCCAAAAATGCAAAATTAGCCAG 0: 4
1: 90
2: 158
3: 472
4: 3611
Right 1133289437 16:4709279-4709301 GCCTGTAATCCCAGCTACTAGGG 0: 3551
1: 119062
2: 256286
3: 228049
4: 381809
1133289431_1133289436 13 Left 1133289431 16:4709242-4709264 CCCAAAAATGCAAAATTAGCCAG 0: 4
1: 90
2: 158
3: 472
4: 3611
Right 1133289436 16:4709278-4709300 TGCCTGTAATCCCAGCTACTAGG 0: 52453
1: 101789
2: 153905
3: 227834
4: 315316
1133289431_1133289441 23 Left 1133289431 16:4709242-4709264 CCCAAAAATGCAAAATTAGCCAG 0: 4
1: 90
2: 158
3: 472
4: 3611
Right 1133289441 16:4709288-4709310 CCCAGCTACTAGGGAGGCTGAGG 0: 7518
1: 202677
2: 272816
3: 187311
4: 194142
1133289431_1133289439 17 Left 1133289431 16:4709242-4709264 CCCAAAAATGCAAAATTAGCCAG 0: 4
1: 90
2: 158
3: 472
4: 3611
Right 1133289439 16:4709282-4709304 TGTAATCCCAGCTACTAGGGAGG 0: 4457
1: 105533
2: 254011
3: 236169
4: 467796
1133289431_1133289443 27 Left 1133289431 16:4709242-4709264 CCCAAAAATGCAAAATTAGCCAG 0: 4
1: 90
2: 158
3: 472
4: 3611
Right 1133289443 16:4709292-4709314 GCTACTAGGGAGGCTGAGGCAGG 0: 6336
1: 175987
2: 235818
3: 172632
4: 171596

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133289431 Original CRISPR CTGGCTAATTTTGCATTTTT GGG (reversed) Intronic
Too many off-targets to display for this crispr