ID: 1133289432

View in Genome Browser
Species Human (GRCh38)
Location 16:4709243-4709265
Sequence TCTGGCTAATTTTGCATTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1661
Summary {0: 1, 1: 19, 2: 289, 3: 443, 4: 909}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133289432_1133289437 13 Left 1133289432 16:4709243-4709265 CCAAAAATGCAAAATTAGCCAGA 0: 1
1: 19
2: 289
3: 443
4: 909
Right 1133289437 16:4709279-4709301 GCCTGTAATCCCAGCTACTAGGG 0: 3551
1: 119062
2: 256286
3: 228049
4: 381809
1133289432_1133289443 26 Left 1133289432 16:4709243-4709265 CCAAAAATGCAAAATTAGCCAGA 0: 1
1: 19
2: 289
3: 443
4: 909
Right 1133289443 16:4709292-4709314 GCTACTAGGGAGGCTGAGGCAGG 0: 6336
1: 175987
2: 235818
3: 172632
4: 171596
1133289432_1133289439 16 Left 1133289432 16:4709243-4709265 CCAAAAATGCAAAATTAGCCAGA 0: 1
1: 19
2: 289
3: 443
4: 909
Right 1133289439 16:4709282-4709304 TGTAATCCCAGCTACTAGGGAGG 0: 4457
1: 105533
2: 254011
3: 236169
4: 467796
1133289432_1133289441 22 Left 1133289432 16:4709243-4709265 CCAAAAATGCAAAATTAGCCAGA 0: 1
1: 19
2: 289
3: 443
4: 909
Right 1133289441 16:4709288-4709310 CCCAGCTACTAGGGAGGCTGAGG 0: 7518
1: 202677
2: 272816
3: 187311
4: 194142
1133289432_1133289436 12 Left 1133289432 16:4709243-4709265 CCAAAAATGCAAAATTAGCCAGA 0: 1
1: 19
2: 289
3: 443
4: 909
Right 1133289436 16:4709278-4709300 TGCCTGTAATCCCAGCTACTAGG 0: 52453
1: 101789
2: 153905
3: 227834
4: 315316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133289432 Original CRISPR TCTGGCTAATTTTGCATTTT TGG (reversed) Intronic
900210483 1:1453361-1453383 CCTGGCTAATTTTTCTATTTTGG + Intronic
900304426 1:1997259-1997281 CCTGGCTAATTTTGTATTTTTGG - Intronic
900945486 1:5829059-5829081 CCCAGCTAATTTTGTATTTTTGG + Intergenic
901234418 1:7660227-7660249 CCCAGCTAATTTTGTATTTTTGG + Intronic
901370812 1:8795819-8795841 CCCAGCTAATTTTGTATTTTTGG - Intronic
901431612 1:9218687-9218709 TCTGGCTAATTTTCATATTTTGG + Intergenic
901491535 1:9598808-9598830 CCTGGCTAATTTTGTATTTTTGG + Intronic
901701645 1:11047594-11047616 CCTGGCTAATTTTTTATTTTTGG + Intergenic
902039918 1:13485114-13485136 CCTAGCTAATTTTGTATTTTTGG - Intronic
902167579 1:14584803-14584825 CCTGGCTAATTTTGTATTTTAGG + Intergenic
902312407 1:15591343-15591365 CCCAGCTAATTTTGTATTTTTGG - Intronic
902402719 1:16166921-16166943 CCTGGCTAATTTTTGTTTTTTGG + Intergenic
902492959 1:16798684-16798706 CCTGGCTAATTTTGTATATTTGG + Intronic
902579661 1:17400344-17400366 CCTGGCTAATTTTGTATTTTTGG - Intronic
902603146 1:17553626-17553648 CCTGGCTAATTTTTGTTTTTTGG - Intronic
902915949 1:19639598-19639620 CCCAGCTAATTTTGTATTTTTGG + Intronic
902945695 1:19836045-19836067 CCTGGCTAATTTTTTATTTTTGG - Intergenic
902972033 1:20060876-20060898 CCCAGCTAATTTTGTATTTTTGG + Intronic
903087612 1:20876833-20876855 CCTGGCTATTTTTTTATTTTTGG - Intronic
903433862 1:23331527-23331549 CCTGGCTAATTTTGTAGTTTTGG - Intronic
903458909 1:23507353-23507375 CCCGGCTAATTTTGTATTTTTGG - Exonic
903524736 1:23984865-23984887 TCTGACTAATTTTGCTCTGTGGG + Intergenic
903939058 1:26916225-26916247 ACTGGCTAATTTTTTTTTTTTGG - Intronic
904116833 1:28168827-28168849 CCCAGCTAATTTTGTATTTTTGG + Intronic
904212131 1:28892962-28892984 CCAGGCTAATTTTGTATTTTTGG + Intronic
904283424 1:29437340-29437362 TTTGGCCAATTTTTCTTTTTTGG + Intergenic
904407027 1:30298462-30298484 GCTTGGTAATTTTCCATTTTTGG - Intergenic
904482539 1:30803011-30803033 CCCAGCTAATTTTGTATTTTTGG - Intergenic
904546659 1:31279584-31279606 CCTGGCTAATTTTGTATTTTTGG - Intronic
904658099 1:32064496-32064518 CCCGGCTAATTTTGTATTTTTGG + Intergenic
904690609 1:32291026-32291048 CCCGGCTAATTTTGTATTTTTGG - Intergenic
904692709 1:32306317-32306339 GCCAGCTAATTTTGTATTTTTGG + Intronic
904723937 1:32532313-32532335 CCCGACTAATTTTGTATTTTTGG - Intronic
905082481 1:35336545-35336567 CCTGGCTAATTTTGTATTTTGGG + Intronic
905427937 1:37899018-37899040 CCTGGCTAATTTTGCATTTTTGG - Intronic
906012156 1:42537806-42537828 CCTGGCTAATTTTGTATTTTCGG - Intronic
906067788 1:42994584-42994606 CCCGGCTAATTTTGTATTTTTGG + Intergenic
906087263 1:43147004-43147026 CCTGGCTAATTTTGTATTTTTGG + Intronic
906121438 1:43394715-43394737 CCCGGCTAATTTTGTATTTTTGG - Intronic
906185527 1:43859396-43859418 CCAGGCTAATTTTGTATTTTTGG - Intronic
906245752 1:44272678-44272700 CCCAGCTAATTTTGTATTTTTGG - Intronic
906377620 1:45308472-45308494 GCTGGCTAATTTTGTATTTTTGG - Intergenic
906628573 1:47345914-47345936 CCCAGCTAATTTTGTATTTTTGG + Intronic
906736300 1:48132509-48132531 TTTGGCTACTTGGGCATTTTTGG + Intergenic
906983148 1:50653509-50653531 CCCGGCTAATTTTGTATTTTTGG + Intronic
907079771 1:51610419-51610441 CCCAGCTAATTTTGTATTTTTGG + Intronic
907080899 1:51620888-51620910 ACTGGTTAATTTTGTATTTTTGG + Intronic
907493844 1:54828490-54828512 CCTGGCCAATTTTTCTTTTTTGG + Intronic
907570852 1:55482236-55482258 TCTGGCTAGTTGTACATTTCAGG - Intergenic
908077215 1:60533698-60533720 TTTGGAGAATTTTGCATATTTGG - Intergenic
908230752 1:62102698-62102720 CCTGGCTAATTGTGCTTTTTCGG - Intronic
908242051 1:62195874-62195896 CCCGGCTAATTTTGTATTTTTGG - Intronic
908494893 1:64684968-64684990 CCCGGCTAATTTTGTATTTTTGG + Intronic
908533882 1:65060035-65060057 TTTAGATATTTTTGCATTTTAGG - Intergenic
908544872 1:65152561-65152583 TGTGGCTATTTTTGTATTTTTGG + Intronic
908763941 1:67537573-67537595 TCTGGATAATTTGGCTTCTTGGG + Intergenic
909104840 1:71394304-71394326 TTTGGCTAATTTTTCTTTTGTGG + Intergenic
909346935 1:74601141-74601163 TCTTGCTTATTTTACAATTTTGG - Intronic
909754094 1:79201646-79201668 TCTGGCTAATTTTGCGTTTTTGG + Intergenic
909847681 1:80416526-80416548 CCTGGCTAATTTTTGTTTTTTGG + Intergenic
909955202 1:81770632-81770654 CCCAGCTAATTTTGTATTTTTGG + Intronic
910031675 1:82733273-82733295 CCTGGCTAATTTGTAATTTTTGG + Intergenic
910191423 1:84599846-84599868 CCTGGCTAATTTTTCTTTTTTGG - Intergenic
910229531 1:84971898-84971920 CCCAGCTAATTTTGTATTTTTGG - Intronic
910241607 1:85092692-85092714 GCAGGATAATTTTTCATTTTGGG + Intronic
910399723 1:86826512-86826534 TCTGGCTAATTCAGCATTCAGGG - Intergenic
910586291 1:88883550-88883572 CCTGGCTAATTTTTTTTTTTTGG - Intronic
910589374 1:88913127-88913149 CCTGGCTAATTTTGTATTTTTGG + Intergenic
910599921 1:89020076-89020098 CCCAGCTAATTTTGTATTTTTGG - Intronic
910675635 1:89813838-89813860 CCCAGCTAATTTTGTATTTTTGG - Intronic
910823137 1:91373298-91373320 TCTGCCTAATTTTGTATGGTGGG - Intronic
910879426 1:91909387-91909409 CCTGGCTAATTTTGAATTTTTGG + Intergenic
910972419 1:92869752-92869774 AATTGCTAATTTTGAATTTTAGG - Intronic
911866050 1:103023516-103023538 CCTGGGTAATTTTGTATATTTGG + Intronic
912138785 1:106696104-106696126 TCTGGTAAATATTGAATTTTTGG - Intergenic
912167209 1:107056167-107056189 GCCGGCTAATTTTGTATTTTTGG - Intergenic
912353555 1:109037166-109037188 CCTGGCTAATTTTGTATTTTTGG - Intronic
912542758 1:110429542-110429564 CCCAGCTAATTTTGTATTTTTGG + Intergenic
912783219 1:112573185-112573207 CCCAGCTAATTTTGTATTTTCGG - Intronic
912873888 1:113336019-113336041 CCCAGCTAATTTTGTATTTTTGG + Intergenic
912998771 1:114558861-114558883 TTTGGCTTATTTTCTATTTTGGG - Intergenic
913311543 1:117501173-117501195 TCTGTCTAAATTTGAATTATAGG + Intronic
914045380 1:144087181-144087203 CCCAGCTAATTTTGTATTTTTGG - Intergenic
914132730 1:144873505-144873527 CCCAGCTAATTTTGTATTTTTGG + Intergenic
914240852 1:145851790-145851812 TCCGGCTAATTTTGTATTTTTGG - Intronic
914395704 1:147265812-147265834 TCACGCTTATTTTGCATTCTAGG - Intronic
914667949 1:149847642-149847664 CCCGGCTGATTTTGTATTTTTGG - Intronic
914724157 1:150313381-150313403 CCCGACTAATTTTGTATTTTTGG + Intergenic
914726918 1:150335624-150335646 CCTGGCTAATTTTGTATTTTTGG + Intronic
914733530 1:150394209-150394231 CCTGGCTAATTTTGTATTTTTGG + Intronic
914740504 1:150460884-150460906 CCCAGCTAATTTTGTATTTTTGG + Intronic
914740898 1:150464168-150464190 CCCGGCTAATTTTTTATTTTTGG + Intronic
914743201 1:150482213-150482235 CCTGGCTAATTGTGTATTTTTGG + Intergenic
914748852 1:150518893-150518915 CCCAGCTAATTTTGTATTTTTGG - Intergenic
914836277 1:151209598-151209620 CCTGGCTAATTTTGTATTTTTGG + Intronic
914866764 1:151436602-151436624 CCTGGCTAATTTTGTATGTCTGG + Intronic
915239809 1:154512503-154512525 CCTGGCTAAATTTGTATTTTTGG + Intronic
915385958 1:155492207-155492229 CCTGGCTAATTCTGTATTTTTGG + Intronic
915392544 1:155557421-155557443 CCCGGCTAATTTTGTTTTTTGGG + Intronic
915404523 1:155649412-155649434 CTCGGCTAATTTTGTATTTTTGG + Intergenic
915434164 1:155890979-155891001 CCCAGCTAATTTTGTATTTTTGG + Intergenic
915560837 1:156686623-156686645 CCCAGCTAATTTTGTATTTTTGG - Intergenic
915575102 1:156770533-156770555 CCCAGCTAATTTTGTATTTTTGG + Intronic
915920125 1:159969879-159969901 CCTAGCTAATTTTGTATTTTGGG - Intergenic
915975004 1:160379622-160379644 CCTGGTTCAGTTTGCATTTTGGG - Intergenic
916156920 1:161860500-161860522 TCTGACTAAATTTGTATTTAAGG - Intronic
916411142 1:164548416-164548438 CCCAGCTAATTTTGTATTTTGGG + Intergenic
916556405 1:165897637-165897659 TCTGGGTAATTTTCTCTTTTCGG + Intronic
916642788 1:166748942-166748964 TCTGTCTGTTTTTGCATTTCTGG - Intergenic
917148099 1:171914316-171914338 CCTGGCTAATTTTGTATTTTTGG + Intronic
917297545 1:173537399-173537421 CCCGGCTAATTTTGTATTTTTGG - Intronic
917348222 1:174050719-174050741 TCATGCTATTTTTGCATCTTGGG + Intergenic
917348667 1:174055422-174055444 CCTGGCTAATTTTGTATTTTTGG + Intergenic
917486803 1:175462588-175462610 TCTTGCTAATTTTGTGTATTTGG + Intronic
917576561 1:176327710-176327732 CCCGGCTAATTTTGTATTTTTGG - Intergenic
917782838 1:178417598-178417620 CCTGGCTAATTTTGTATTTTTGG - Intronic
917869009 1:179225697-179225719 GCTGGCTAATTCTGTGTTTTGGG - Intronic
918060603 1:181057847-181057869 CCCGGCTAATTTTGTATGTTTGG - Exonic
918200448 1:182261305-182261327 CCCAGCTAATTTTGTATTTTTGG + Intergenic
919066196 1:192695048-192695070 CCTGGCTAATTTTGTATTTTAGG - Intergenic
919633957 1:199986109-199986131 TCTGGCTAATTTTGTATTTTCGG - Intergenic
919876580 1:201873584-201873606 CCTGGCTAACTTTGTATTTTTGG - Intronic
919881547 1:201904369-201904391 CCTAGCTAATTTTGTATTTTTGG + Intronic
920109632 1:203578169-203578191 TGTGGTGAAATTTGCATTTTAGG + Intergenic
920142746 1:203831103-203831125 CCTGGGTAATTTTGTATTTTTGG + Intronic
920168409 1:204053106-204053128 CCTGGCTAATTTTGTATTTTTGG - Intergenic
920168452 1:204053454-204053476 CCTGGCTAATGTTGTATTTCTGG - Intergenic
920942244 1:210494712-210494734 CCTGGCTAATTTTTTGTTTTTGG + Intronic
921078003 1:211715353-211715375 CCCGGCTAATTTTGCATTTTTGG + Intergenic
921209732 1:212884136-212884158 CCCAGCTAATTTTGTATTTTTGG - Intronic
921393022 1:214636121-214636143 TCTGGCTACTGTTAAATTTTGGG + Intronic
921789275 1:219271103-219271125 CCCAGCTAATTTTGTATTTTTGG + Intergenic
921985849 1:221311029-221311051 TCTTGCTAATTTTGAATCTATGG + Intergenic
922063500 1:222113984-222114006 CCTGGCTAATTTTTTTTTTTTGG + Intergenic
922940830 1:229463982-229464004 ACTGGCTAATTTTGTATTTTTGG - Intronic
922950626 1:229556209-229556231 CCCGGCTAATTTTGTATTTTTGG - Intronic
923217063 1:231858110-231858132 TCTGTTTTATTTTGCTTTTTTGG - Intronic
923411861 1:233718451-233718473 CCAGGCTAATTTTGTATTTTTGG + Intergenic
923435236 1:233961615-233961637 CCTGGCTAATTTTGTGTTTTTGG + Intronic
923527487 1:234783844-234783866 CCTGGCTAATTTTGTATATTTGG - Intergenic
923535158 1:234843768-234843790 CCCAGCTAATTTTGCATTTTTGG - Intergenic
923722208 1:236476684-236476706 CCCGGCTAATTTTGTATTTTTGG + Intronic
923859938 1:237883551-237883573 TCCAGCTCATTTTGTATTTTTGG - Intronic
924000951 1:239551321-239551343 CCTGGCTAATTTTGTATTTTTGG + Intronic
924162396 1:241246209-241246231 TCCTGCTATTTTTGGATTTTGGG - Intronic
924363389 1:243264451-243264473 CCTGGGTAATTTTGTATTTTTGG - Intronic
924525259 1:244840708-244840730 TCTGCCTATGTTTGCTTTTTTGG - Intronic
924761338 1:246989853-246989875 CCCAGCTAATTTTGTATTTTTGG - Intronic
1062774081 10:130954-130976 CCCAGCTAATTTTGTATTTTTGG - Intergenic
1063790429 10:9439297-9439319 TCTGTATAGTTTTGCATATTGGG + Intergenic
1063803048 10:9603407-9603429 CATGGCTAATTTTGTATTTTTGG - Intergenic
1064072554 10:12243235-12243257 CCTGGCTAATTTTCTATTTTTGG - Intronic
1064288634 10:14013768-14013790 CCTGGCTAATTTTGTATTTTTGG - Intronic
1064376967 10:14805397-14805419 CCTGGCTAATTTTTTATTTTTGG - Intergenic
1064448319 10:15417342-15417364 TTCAGCTAATTTTGCATTCTAGG - Intergenic
1064480384 10:15734877-15734899 CCTAGCTAAATTTGTATTTTTGG + Intergenic
1064538405 10:16381705-16381727 CTGGGCTAATTTTGTATTTTTGG - Intergenic
1064541591 10:16411437-16411459 TTTGTCTCATTTTGCTTTTTTGG + Intergenic
1064864772 10:19867224-19867246 CCCAGCTAATTTTGTATTTTTGG + Intronic
1065025639 10:21536726-21536748 TCGGGCTAATTTTGTATTTTTGG + Intronic
1065042301 10:21709908-21709930 CCCAGCTAATTTTGCATTTTTGG + Intronic
1065290070 10:24220917-24220939 CCTGGCTCATTTTTTATTTTTGG + Intronic
1065495682 10:26325337-26325359 TCTGGCTACTTTTGTATTTTTGG + Intergenic
1065662353 10:28019191-28019213 CCCGGCTAATTTTGTATTTTTGG + Intergenic
1065724488 10:28656578-28656600 CCTGGCTAATTTTGTATTTTGGG - Intergenic
1065897503 10:30177026-30177048 ACTGGCTAGTTTAGCTTTTTTGG + Intergenic
1065909439 10:30288609-30288631 ACTGGCTAGTTTAGCTTTTTTGG + Intergenic
1066051944 10:31644187-31644209 CCGGGCTAATTTTGTATTTTTGG - Intergenic
1066385321 10:34936702-34936724 CCCAGCTAATTTTGTATTTTTGG + Intergenic
1066686422 10:37985995-37986017 TGCGGCTAATTTTGTATTTTTGG - Intergenic
1067276385 10:44838694-44838716 CCTGGCTAAATTTGTATTATTGG + Intergenic
1067589507 10:47497157-47497179 CCTGGCTAATTTTGTATTTTTGG - Intergenic
1067928526 10:50536170-50536192 TTTGACTAATTTTTGATTTTTGG - Intronic
1068332426 10:55588918-55588940 CCAGGCTAATTTTGTATTTTTGG - Intronic
1068677829 10:59785875-59785897 CCTGGCTAATTTTTAATTTTTGG + Intergenic
1068720717 10:60243021-60243043 TCTTACTATTTTTGCATTTTTGG + Intronic
1068750286 10:60584455-60584477 CCTGGCTAATTTTAAATTTTTGG - Intronic
1068999054 10:63243363-63243385 CCTGGCTAATTTTGTATTTTTGG - Intronic
1069010143 10:63363417-63363439 CCTGGCTAATTTTTTGTTTTTGG + Intronic
1069035317 10:63640661-63640683 CCTGGCTAATTTTTGTTTTTTGG + Intergenic
1069415234 10:68194341-68194363 TCTTGATAATTTTTCATTTCAGG + Exonic
1069524347 10:69154373-69154395 CCCAGCTAATTTTGTATTTTTGG - Intronic
1069547078 10:69336350-69336372 CCTGGCTCATTTTGTATTTTTGG + Intronic
1069703698 10:70443676-70443698 CCCAGCTAATTTTGTATTTTTGG - Intronic
1069979418 10:72242002-72242024 CCTGGCTAATTTTGTGTTTTTGG + Intergenic
1070022838 10:72603641-72603663 CCCGGCTAATTTTGTATTTTTGG - Intronic
1070030283 10:72670204-72670226 CCTGGCTAATTTTGTATTTTTGG - Intergenic
1070119840 10:73565353-73565375 TCTGGCGATTTTTAAATTTTTGG - Intronic
1070229319 10:74547817-74547839 TCCGGCTAATTTTGTATTTTTGG + Intronic
1070298209 10:75183325-75183347 CCCAGCTAATTTTGTATTTTTGG + Intergenic
1070517163 10:77218845-77218867 TCCGGCTAATTTTTGTTTTTTGG + Intronic
1070650949 10:78235993-78236015 CCTGGCTTATTCTGCCTTTTTGG - Intergenic
1070775207 10:79105725-79105747 TAAGGCTAATTTTGTATTTAAGG + Intronic
1070940537 10:80341861-80341883 CCCGGCTGATTTTGTATTTTTGG - Intronic
1071280155 10:84094449-84094471 CCTGGCTAATTTTTTACTTTTGG - Intergenic
1071497057 10:86175868-86175890 CCTGGCTAATTTTGTATTTTTGG + Intronic
1071710267 10:88042808-88042830 TCTGGGTAATGTTTCATTCTTGG + Intergenic
1072069636 10:91903902-91903924 CCCAGCTAATTTTGTATTTTTGG + Intergenic
1072553496 10:96496719-96496741 TGTGGCTAATTTTTCTTTTTTGG - Intronic
1073012979 10:100375793-100375815 CCGGGCTAATTTTGTATTTTTGG - Intergenic
1073157538 10:101359759-101359781 CCCAGCTAATTTTGTATTTTTGG + Intronic
1073195969 10:101692592-101692614 CCCAGCTAATTTTGTATTTTTGG - Intronic
1073242945 10:102070068-102070090 CCCAGCTAATTTTGTATTTTTGG + Intergenic
1073311044 10:102542043-102542065 CCCGACTAATTTTGTATTTTTGG + Intronic
1073416973 10:103391920-103391942 CCTGGCTAATTTTTGTTTTTTGG + Intronic
1073952635 10:108828863-108828885 TTTGGCTAATTTCTCACTTTTGG - Intergenic
1074042979 10:109810504-109810526 CCTGATTAATTTTGTATTTTTGG - Intergenic
1074085415 10:110206139-110206161 CCCGGCTAATTTTGTATTTTTGG + Intergenic
1074590994 10:114813026-114813048 CCCGGCTAATTTTGTATTTTTGG + Intergenic
1074603755 10:114940280-114940302 CCCAGCTAATTTTGTATTTTTGG + Intronic
1074916891 10:117965454-117965476 ATTGGATAATTTGGCATTTTAGG - Intergenic
1075042513 10:119119436-119119458 CCAGCCTAATTTTGTATTTTTGG + Intronic
1075053850 10:119203707-119203729 TCTGACTTCTTTTGCATTTTTGG + Intergenic
1075166718 10:120074752-120074774 GCTGGATAATATTCCATTTTTGG + Intergenic
1075176907 10:120172769-120172791 TTCTTCTAATTTTGCATTTTGGG + Intergenic
1075281130 10:121139325-121139347 TCTGCCAAATTTTGGATTTGGGG + Intergenic
1075320785 10:121490323-121490345 TCAGGCTAATTTTGTATTTTTGG + Intronic
1075764755 10:124884562-124884584 CCCGGCTAATTTTGTATTTTTGG + Intergenic
1075853832 10:125610614-125610636 TGTAGCAACTTTTGCATTTTGGG + Intronic
1076873745 10:133206037-133206059 CCCGGCTAATTTTGTATTTTTGG - Intronic
1077002092 11:328717-328739 CCCGGCTAATTTTGTACTTTTGG + Intergenic
1077725387 11:4669667-4669689 TCAGGCTAATTTTTCATTGTCGG + Intergenic
1077746378 11:4911346-4911368 TCTGGCACATTTTGCAACTTGGG - Intronic
1077933317 11:6756020-6756042 TATGTATAATTTTGCATTTATGG + Intergenic
1078198685 11:9159477-9159499 CCTGGCTAATTTTGTATTTTTGG + Intronic
1078202348 11:9194878-9194900 CCTGGCTAATTTTGTGTTTTTGG + Intronic
1078212065 11:9277759-9277781 CCCAGCTAATTTTGTATTTTTGG - Intergenic
1078497167 11:11829687-11829709 CCCAGCTAATTTTGTATTTTTGG - Intergenic
1078500276 11:11867056-11867078 CCCAGCTAATTTTGTATTTTTGG + Intronic
1078799170 11:14625285-14625307 CCCAGCTAATTTTGTATTTTTGG - Intronic
1079097251 11:17518856-17518878 CCCAGCTAATTTTGTATTTTTGG - Intronic
1079196420 11:18331503-18331525 CCTGGCTATTTTTGTATTTTTGG - Intronic
1079223323 11:18583820-18583842 CCCGGGTAATTTTGTATTTTTGG + Intronic
1079431354 11:20391403-20391425 ACTGGCTAATTTTGTATTTTAGG + Intronic
1079434245 11:20429815-20429837 TCTGGTGAAATTTGCATTTAAGG + Intronic
1079643261 11:22832611-22832633 TATCACTAATTTTGCACTTTGGG - Intergenic
1079825717 11:25189872-25189894 CCTGGCTAATTTTGTATTTTTGG + Intergenic
1079834469 11:25315880-25315902 TCCGGCTAATTTTGTATTTTTGG + Intergenic
1079952599 11:26823475-26823497 TTTGGCTGATTCTCCATTTTGGG - Intergenic
1079955613 11:26860240-26860262 GCTGGCTATGATTGCATTTTAGG + Intergenic
1080013606 11:27482548-27482570 CCTGGCTAATTTTGTATTTTTGG + Intergenic
1080057481 11:27921422-27921444 TCTTGCTGATTTTGGATTTTTGG + Intergenic
1080190730 11:29545177-29545199 TCTGGCTAATTTTGTATTTTTGG - Intergenic
1080265799 11:30400648-30400670 TCTGGCTAATGTTAAATTTTGGG - Intronic
1080373120 11:31675423-31675445 CCTGGCTAATTTTGTATTTTTGG + Intronic
1080888686 11:36389771-36389793 CCTGGCTAGTTTTGTATTTTTGG + Intronic
1080903816 11:36521118-36521140 CCTGGCAAATTTTGCATTTTTGG + Intronic
1081111296 11:39137456-39137478 CCTGGCTAATTTTGTATTTTTGG + Intergenic
1081326552 11:41752793-41752815 TCTGGCTAACTTTGTATTTTTGG - Intergenic
1082022499 11:47546425-47546447 CCTGGCTAATTGTGTATTTTTGG + Intronic
1082221596 11:49645520-49645542 TGAGGCTAATTTTGGATTTCTGG - Intergenic
1082780590 11:57284480-57284502 TCTGGCTGATTTTTCCCTTTTGG + Intergenic
1082823028 11:57557553-57557575 CCCAGCTAATTTTGTATTTTTGG + Intronic
1083410685 11:62490360-62490382 CCCGGCTAATTTTGTATTTTTGG + Intronic
1083700209 11:64472316-64472338 CGTGGCTAATTTTGTATTTTTGG + Intergenic
1084130207 11:67127865-67127887 CCCGGCTAATTTTGTATTTTTGG + Intronic
1084571982 11:69965410-69965432 ACTGGTCAACTTTGCATTTTTGG + Intergenic
1084723618 11:70925815-70925837 TATTGCTAATTTTGTATTTGTGG - Intronic
1084753098 11:71217033-71217055 CCTGGCTAATTTTGTATTTTTGG - Intronic
1085068000 11:73515346-73515368 CCCGACTAATTTTGTATTTTTGG - Intronic
1085071104 11:73546569-73546591 CCCAGCTAATTTTGTATTTTTGG - Intronic
1085071182 11:73547499-73547521 CCTGGCTTATTTTTAATTTTTGG - Intronic
1085334341 11:75679489-75679511 CCTGGCTAATTTTTTATTTTTGG + Intergenic
1086038818 11:82449720-82449742 CCTGGCTAATTTTGTATTTTTGG - Intergenic
1086099739 11:83086602-83086624 CCCAGCTAATTTTGTATTTTTGG + Intergenic
1086149907 11:83597623-83597645 TCTGGCTAATTTTTTTTTTTTGG - Intronic
1086365357 11:86104343-86104365 TCTAGCTAATTGTACCTTTTAGG - Intergenic
1086453098 11:86936426-86936448 CCTGGCTAATTTTGTATTTTTGG + Intronic
1086468565 11:87080845-87080867 CCTGGCTAATTTTGTATTTTTGG + Intronic
1086627439 11:88973638-88973660 TGAGGCTAATTTTGGATTTCTGG + Intronic
1087122023 11:94584901-94584923 CCCGGCTAATTTTGTATTTTTGG - Intronic
1087280375 11:96202787-96202809 CCTGGCTAATTTTGTATTTTTGG + Intronic
1087414325 11:97833798-97833820 TCTGGCTAATGTTTATTTTTTGG + Intergenic
1087498692 11:98922808-98922830 TCTTTCTAAATCTGCATTTTCGG - Intergenic
1087659470 11:100970147-100970169 CCCGGCTAATTTTGTATTTTCGG + Intronic
1087771242 11:102212740-102212762 CCCGGCTAATTTTGTGTTTTTGG + Intronic
1087797616 11:102471278-102471300 CCTGGCTATTTTTGTATTTTTGG + Intronic
1087933059 11:104000653-104000675 TCTGTCTAACTTTGTACTTTGGG + Intronic
1088113955 11:106295527-106295549 ACCAGCTAACTTTGCATTTTGGG + Intergenic
1088162657 11:106892061-106892083 TCTGCAAAATTTTGCAATTTGGG + Intronic
1088258102 11:107919897-107919919 GCTGGCTAATTTTGTATTTTGGG + Intronic
1088417075 11:109600931-109600953 GATGGCTAATAATGCATTTTGGG - Intergenic
1088863343 11:113822286-113822308 CCCGGCTAATTTTGTATTTTTGG - Intronic
1089341025 11:117757827-117757849 CCTGGCTAATTTTGTATTTTTGG - Intronic
1089426123 11:118376890-118376912 CCTGGCTAATTTTTTTTTTTTGG - Intronic
1089438525 11:118493870-118493892 CCTGGCTAATTTTGTATTTTTGG + Intronic
1089523878 11:119084076-119084098 CCCAGCTAATTTTGTATTTTTGG - Intergenic
1089546586 11:119231545-119231567 CCCGGCTAATTTTGTATTTTTGG - Intronic
1089669429 11:120043342-120043364 TTTGGCTAATTTTTCTCTTTTGG - Intergenic
1090148368 11:124353863-124353885 TCTGGCTATTTTTTTTTTTTTGG - Intergenic
1090370905 11:126251841-126251863 CCCGGCTAATTTTGTATTTTTGG + Intronic
1090478475 11:127046497-127046519 TCCTGCTAATTTTGTATTTTTGG - Intergenic
1091133927 11:133170854-133170876 GCTGGCTAATTGTGCTTTTGGGG - Intronic
1091456995 12:615425-615447 CCCGGCTAATTTTTTATTTTTGG - Intronic
1091557650 12:1587074-1587096 CCCGGCTAATTTTGTATCTTTGG - Intronic
1091947224 12:4558094-4558116 TCTGGCTAATTTTACTTTTGGGG - Intronic
1092550937 12:9499027-9499049 CCCAGCTAATTTTGTATTTTTGG + Intergenic
1092651923 12:10644125-10644147 TCTCTCTAATTTTGCCATTTTGG - Intronic
1092724887 12:11475315-11475337 TTTGGCCAATTTTTCCTTTTCGG + Intronic
1092778256 12:11962604-11962626 ACCAGCTAATTTTGTATTTTTGG - Intergenic
1092845816 12:12584083-12584105 TCAGGCTAGTCTTGAATTTTTGG - Intergenic
1092849416 12:12613030-12613052 CCCGGCTAATTTTGTATTTTTGG + Intronic
1092869684 12:12795285-12795307 CCCGGCTAATTTTGTATTTTTGG + Intronic
1093014091 12:14138762-14138784 CATGGCTAATTTTCCATCTTCGG + Intergenic
1093028378 12:14265538-14265560 GGTGGCTAATTTTGTATTTTTGG - Intergenic
1093155658 12:15681567-15681589 CCCGGCTAATTTTGTATTTTCGG - Intronic
1093418015 12:18942851-18942873 TTTTGCTAACTTTGCAATTTCGG - Intergenic
1093583707 12:20812066-20812088 CCCAGCTAATTTTGTATTTTTGG + Intronic
1093679302 12:21982371-21982393 TCTGTCAAACTTTCCATTTTTGG - Intergenic
1093935410 12:24995336-24995358 CCTGGCTAATTTTGTATTTTTGG + Intronic
1093945951 12:25109837-25109859 CTTGGCTAATTTTGTATTTTTGG + Intronic
1094536838 12:31328718-31328740 CCCGGCTAATTTTGCATTTTTGG - Intergenic
1094544897 12:31395430-31395452 TGAGGCTAATTTTGTATTTTGGG - Intronic
1094579398 12:31720377-31720399 CCCGGCTAATTTTGTATTTTTGG - Intronic
1094598186 12:31884522-31884544 CTCGGCTAATTTTGTATTTTGGG - Intergenic
1095157216 12:38871972-38871994 CCCGGCTAATTTTGTATTTTTGG - Intronic
1095370219 12:41458316-41458338 CCCAGCTAATTTTGTATTTTTGG + Intronic
1095435749 12:42186028-42186050 CCTAGCTAATTTTGTATTTTAGG - Intronic
1095497321 12:42798519-42798541 CCTGGCTAATTTTGTATTTTTGG + Intergenic
1095668086 12:44825879-44825901 CTGGGCTAATTTTGTATTTTTGG - Intronic
1095962056 12:47841837-47841859 TGTGGAAAATCTTGCATTTTGGG + Intronic
1096129917 12:49149977-49149999 CCCAGCTAATTTTGTATTTTTGG - Intergenic
1096159215 12:49363393-49363415 CCCGGCTAATTTTGTATTTTCGG - Intergenic
1096169903 12:49459507-49459529 CCCAGCTAATTTTGTATTTTTGG + Intronic
1096342729 12:50815692-50815714 ACTAGCTAATTTTAAATTTTTGG - Intronic
1096823740 12:54258375-54258397 AGTGACTAATTTTGAATTTTAGG - Intronic
1097031752 12:56094788-56094810 CCGGGCTAATTTTAAATTTTTGG - Intronic
1097072522 12:56365624-56365646 CCCGGCTAATTTTGTATTTTTGG + Intergenic
1097289271 12:57900279-57900301 CCTGGCTAATTTTAATTTTTTGG + Intergenic
1097649779 12:62282735-62282757 TCTCACTACTCTTGCATTTTGGG - Intronic
1097825035 12:64166902-64166924 CCCAGCTAATTTTGCATTTTTGG - Intergenic
1097928537 12:65158331-65158353 CCTGGCTAATTTTTTATTTTTGG + Intergenic
1098017185 12:66118200-66118222 GCCGGCTAATTTTGTATTTTTGG - Exonic
1098124685 12:67278316-67278338 CCTGGCTAATTTTGTATTTTTGG + Intronic
1098361593 12:69659512-69659534 CCTGGCTAATTTTTTATTTTTGG + Intronic
1099195217 12:79607886-79607908 CCCGGTTAATTTTGTATTTTTGG - Intronic
1099321165 12:81151225-81151247 TTTGTCTTATATTGCATTTTGGG - Intronic
1099346612 12:81508358-81508380 CCAGGCTAATTTTGTATTTTTGG - Intronic
1099701828 12:86093565-86093587 CCCAGCTAATTTTGTATTTTTGG - Intronic
1099724857 12:86412522-86412544 TTTGGCTGATTTTTCTTTTTTGG + Intronic
1100290241 12:93206938-93206960 CCCGGCTAATTTTGTATTTTTGG - Intergenic
1100445173 12:94653219-94653241 TCCGGCTAATTTTGTATTTTTGG - Intergenic
1100497325 12:95138057-95138079 CCCGACTAATTTTGTATTTTTGG - Intronic
1100771030 12:97923012-97923034 CCTAGCTAATTCTGTATTTTTGG - Intergenic
1101370576 12:104125685-104125707 CCCAGCTAATTTTGTATTTTTGG - Intronic
1101623224 12:106411297-106411319 CCCGGCTAATTTTGTATTTTTGG + Intronic
1101666240 12:106818325-106818347 CCTGGCTAATTTTGTATTTTTGG + Intronic
1102120039 12:110433069-110433091 CCCAGCTAATTTTGTATTTTTGG - Intergenic
1102121619 12:110446456-110446478 CCCAGCTAATTTTGTATTTTTGG + Intronic
1102391695 12:112554240-112554262 TAAGTCTAATTTTGCATGTTTGG + Intergenic
1102415254 12:112756371-112756393 CCCAGCTAATTTTGTATTTTTGG + Intronic
1102442838 12:112976774-112976796 TCTTGCTATTTATACATTTTAGG - Intergenic
1102592550 12:113967774-113967796 CCTGGCTAATTTTTTTTTTTTGG + Intergenic
1102740269 12:115200804-115200826 CCTGGCTAATTTTGTATTGTTGG + Intergenic
1103100107 12:118166375-118166397 CCTGGCTAATTTTGTATTTTTGG - Intronic
1103177726 12:118879078-118879100 TCTAGCTAATTTTTGAATTTTGG - Intergenic
1103346695 12:120255886-120255908 CCTGGCTAATTTTGTATTTTTGG - Intronic
1103412701 12:120724048-120724070 CCCGGCTAATTCTGTATTTTTGG + Intergenic
1103494259 12:121349397-121349419 CCTGGCTAATTTTTAAATTTTGG - Intronic
1103660240 12:122508793-122508815 CCCGGCTAATTTTGTATTTTTGG - Intronic
1103687183 12:122741366-122741388 CCCGGCTAATTTTGTATGTTTGG + Intergenic
1103876168 12:124129058-124129080 GCTGTCTAATTTTGTATTTTTGG + Intronic
1103954909 12:124570556-124570578 CCTGGCTGATTTTGTATTTTTGG - Intergenic
1104111273 12:125707144-125707166 CCCTGCTAATTTTGTATTTTTGG + Intergenic
1104232860 12:126902141-126902163 TCTGAATAATTTTAGATTTTGGG - Intergenic
1104825545 12:131706175-131706197 CCTGGCTAATTTTGTATTTTTGG - Intergenic
1104866090 12:131955441-131955463 CCCGGCTAATTTTGTATTATTGG + Intronic
1105018743 12:132802462-132802484 CCTGGCTAATTTTTTTTTTTTGG - Intronic
1105258471 13:18760931-18760953 TCTGGCAAATTTCGTCTTTTTGG - Intergenic
1105493719 13:20911859-20911881 CCCAGCTAATTTTGTATTTTCGG - Intergenic
1105797664 13:23872298-23872320 CCCAGCTAATTTTGTATTTTTGG - Intronic
1105808656 13:23974268-23974290 CCTGGCTATTTTTGTATTTTTGG - Intergenic
1105958346 13:25305306-25305328 CCTGGCTAATTTTTGTTTTTTGG + Intronic
1106060745 13:26288910-26288932 CCTGGCTAATTTTGTACTTAAGG + Intronic
1106069544 13:26395287-26395309 CCCAGCTAATTTTGTATTTTTGG - Intronic
1106181755 13:27375335-27375357 TCCGGCTAATTTTTATTTTTCGG + Intergenic
1106249831 13:27975008-27975030 CCCAGCTAATTTTGTATTTTTGG - Intergenic
1106380661 13:29235252-29235274 CCTGGCTAATTTTGTATTTTTGG + Intronic
1106408523 13:29495021-29495043 TCCAGCTAATTTTGTATTTTTGG - Intronic
1106562024 13:30855047-30855069 CCCGGCTAATTTTGTATTTTTGG + Intergenic
1106689157 13:32095504-32095526 CCCAGCTAATTTTGTATTTTTGG + Intronic
1106714179 13:32370752-32370774 CCTGGCTAATTTTGTATTTTTGG + Intronic
1106794335 13:33188921-33188943 TCCGGCTAACTTTGCTTTCTAGG + Intronic
1106861652 13:33915957-33915979 CCTAGCTAATTTTGTATTTTTGG + Intronic
1106980812 13:35277458-35277480 CCTGGCTAATTTTGTATTTTTGG - Intronic
1107269651 13:38600184-38600206 CCAGGCTAATTTTGTATTTTTGG - Intergenic
1107340129 13:39396631-39396653 ACTGGCTAATTTTTGTTTTTTGG - Intronic
1107534284 13:41312289-41312311 ACTGGCTGGTTTTGCATTTGAGG + Intronic
1107579914 13:41772049-41772071 CCTGGCTAATTTTGTATTTTTGG + Intronic
1107783039 13:43925417-43925439 CCCAGCTAATTTTGTATTTTTGG - Intergenic
1107797805 13:44071733-44071755 CCCAGCTAATTTTGTATTTTTGG - Intergenic
1107892655 13:44927778-44927800 CCCGACTAATTTTGTATTTTTGG - Intergenic
1107905230 13:45055413-45055435 ACTGGGTAATTTCGAATTTTTGG - Intergenic
1107910310 13:45099725-45099747 CCTGGTTAGTTTTGTATTTTTGG - Intergenic
1108014509 13:46060299-46060321 CCTGGCTATTTTTGTATTTTTGG - Intronic
1108054973 13:46476667-46476689 TCCGGCTAATTTTGTATTTTTGG + Intergenic
1108943759 13:55994166-55994188 TCTGGTCAGTTTTGCATTTTTGG - Intergenic
1110544418 13:76740140-76740162 TCTGGCTAAATTCACATTTATGG + Intergenic
1110655605 13:77995094-77995116 CCTGGCTAATTTTGTATTTCGGG + Intergenic
1110656428 13:78005392-78005414 CCTAGCTAATTTTGCATTTTGGG + Intergenic
1110711553 13:78656419-78656441 CCCGGCAAATTTTGTATTTTTGG - Intronic
1110774134 13:79386844-79386866 TTTGGATAATTTTGCCTTTTTGG - Intronic
1110856709 13:80304630-80304652 CCTGCCTAATTTTGTATTTTTGG + Intergenic
1111280031 13:86010335-86010357 GCTGGCTAATTTTGTTTTTTTGG - Intergenic
1111675338 13:91380299-91380321 TCTGGGAAATTTAACATTTTAGG - Intergenic
1111788896 13:92827568-92827590 TCTGGCTCCATTTGCAATTTGGG + Intronic
1112027561 13:95425627-95425649 CCCGGATAATTTTGTATTTTTGG - Intergenic
1112114702 13:96339377-96339399 TCAGGCTATTTTTTCTTTTTTGG - Intronic
1112485445 13:99815394-99815416 TCTGGCTAATTTTTTTCTTTTGG - Intronic
1112510737 13:100006861-100006883 CCCAGCTAATTTTGTATTTTTGG - Intergenic
1112741748 13:102482395-102482417 TCTGGCTAATTTTGTATTTTTGG - Intergenic
1112741996 13:102485822-102485844 TTTGGGTAATTTTCAATTTTTGG - Intergenic
1112820561 13:103329686-103329708 CCTGGCTCATTTTGTATTTTTGG + Intergenic
1112959966 13:105112044-105112066 CCCGCCTAATTTTGTATTTTTGG - Intergenic
1113011738 13:105775328-105775350 TTTGGTTGAGTTTGCATTTTTGG + Intergenic
1113142390 13:107168519-107168541 ACGGGAGAATTTTGCATTTTTGG + Exonic
1113456500 13:110452924-110452946 CCTGGCTAATTTTGTAATTTTGG + Intronic
1113456560 13:110453338-110453360 CTTGGCTAATTTTGTATTTTTGG - Intronic
1113729753 13:112632693-112632715 CCTGGCTAATTTTTAATTTTTGG - Intergenic
1113845566 13:113388207-113388229 CCCGGCTAATTTTGTATTTTTGG + Intergenic
1114005957 14:18313516-18313538 CCCGGCTAATTTTGTATTTTTGG + Intergenic
1114051572 14:18923040-18923062 CCCAGCTAATTTTGTATTTTTGG + Intergenic
1114065570 14:19056493-19056515 CCTGGCTAATTTTGTATTTTTGG + Intergenic
1114096692 14:19343508-19343530 CCTGGCTAATTTTGTATTTTTGG - Intergenic
1114110988 14:19478885-19478907 CCCAGCTAATTTTGTATTTTTGG - Intergenic
1114308722 14:21446470-21446492 CTCGGCTAGTTTTGCATTTTTGG + Intronic
1114323576 14:21567470-21567492 TCTGGGTAATTTTGTATTTTTGG + Intergenic
1114341820 14:21753599-21753621 CCTGGCTAATTTTGTATTTTTGG + Intergenic
1114389533 14:22291993-22292015 CCCAGCTAATTTTGTATTTTTGG - Intergenic
1114442383 14:22760177-22760199 CCCAGCTAATTTTGTATTTTTGG + Intergenic
1114571408 14:23671802-23671824 TCTGGCTAATTTTATATTTTTGG + Intergenic
1114629339 14:24149122-24149144 CTCGGCTAATTTTGTATTTTTGG + Intronic
1114989958 14:28273946-28273968 TTTGGGTAGTTTTTCATTTTTGG - Intergenic
1115058948 14:29167898-29167920 CCTGGCTAATTTTTTGTTTTAGG - Intergenic
1115237588 14:31222634-31222656 CTCGGCTAATTTTGTATTTTTGG - Intergenic
1115500852 14:34048328-34048350 CCTGGCTAATTTTGTATTTTTGG + Intronic
1115709458 14:36034416-36034438 CCTGGCTAATTTTGTATTTTTGG + Intergenic
1115764227 14:36606369-36606391 TCTGGCAAAATCTCCATTTTAGG + Intergenic
1116358524 14:43962655-43962677 TAAAGCTCATTTTGCATTTTAGG + Intergenic
1116513883 14:45782561-45782583 CCTGGCTAATTTTGTATTTTTGG + Intergenic
1116852689 14:49924236-49924258 ACTGGCTAATTTTTGAATTTTGG - Intergenic
1116892203 14:50279897-50279919 CCCAGCTAATTTTGTATTTTTGG - Intronic
1117368688 14:55055767-55055789 CCCGGCTAATTTTTAATTTTTGG - Intronic
1117370205 14:55071323-55071345 CCTGGCTAATTCTTCAATTTTGG - Intergenic
1117429963 14:55647470-55647492 CCTGGCTAATTTTGTACATTTGG - Intronic
1117439052 14:55743446-55743468 TTGGGCTAATTTTTCATTGTGGG - Intergenic
1117476638 14:56102386-56102408 CCAGGCTACTTTTGAATTTTTGG - Intergenic
1117659955 14:57993065-57993087 TCTGGCTAATTTTTAATTTTTGG + Intergenic
1117683688 14:58231211-58231233 CCTGGCTAATTTTGTATTTTTGG + Intronic
1117687689 14:58271488-58271510 CCTGGCTACTTTTGTATTTTTGG + Intronic
1117907254 14:60603207-60603229 TGTGGTTAATTGTCCATTTTTGG - Intergenic
1118006158 14:61565632-61565654 TCTGGCTAATTTTTGTATTTTGG + Intronic
1118516858 14:66539573-66539595 GCTGGCTAATTTTGTATTTTTGG + Intronic
1118552529 14:66971165-66971187 CCTGGCTAATTCTGTATTTTTGG - Intronic
1118611710 14:67546549-67546571 CCCAGCTAATTTTGTATTTTTGG + Intronic
1119237893 14:73034838-73034860 CCTGGCTAATTTTGTATTTTCGG - Intergenic
1119811604 14:77525427-77525449 CCTGGCTAATTTTGTATTTTTGG - Intronic
1119835189 14:77743062-77743084 CCTGACTAATTTTGTATTTTTGG - Intronic
1119973960 14:79004404-79004426 TCCAGCTACTTTGGCATTTTTGG + Intronic
1120287991 14:82529250-82529272 CCTGGCTAATTTTGTATTTTTGG - Intergenic
1120322458 14:82981782-82981804 CCTGGCTAATTTTGTATTTTTGG - Intergenic
1120424890 14:84334717-84334739 TCTGGGTAAATATGAATTTTGGG + Intergenic
1120808715 14:88780734-88780756 CCCAGCTAATTTTGTATTTTTGG + Intronic
1121201237 14:92120509-92120531 CCCAGCTAATTTTGTATTTTTGG + Intronic
1121346694 14:93141416-93141438 CCTGGCTAATTTTATTTTTTTGG + Intergenic
1121524694 14:94611547-94611569 TGTGGATCAGTTTGCATTTTTGG - Intronic
1121715009 14:96067536-96067558 CCCAGCTAATTTTGTATTTTTGG - Intronic
1121869115 14:97390945-97390967 TTTGTATAATTTTGTATTTTTGG - Intergenic
1122036443 14:98952603-98952625 TCTTTCTAATTTTTCATTTTAGG - Intergenic
1122269377 14:100561585-100561607 CCAGGCTAATTTTGTATTTTTGG - Intronic
1122560964 14:102614054-102614076 CCCGGCTGATTTTGTATTTTTGG + Intronic
1123974707 15:25542213-25542235 CCTGGCTAATTTTTTATTTTAGG - Intergenic
1125184938 15:36919415-36919437 CCCAGCTAATTTTGTATTTTTGG - Intronic
1125206404 15:37158722-37158744 CCCGGCTGATTTTGGATTTTTGG + Intergenic
1125468940 15:39983601-39983623 CCCAGCTAATTTTGTATTTTTGG + Intronic
1125543643 15:40487273-40487295 CCTGGCTAATTTTTAGTTTTGGG - Intergenic
1125912575 15:43454522-43454544 CCTGGCTAATTTTGTGTTTTTGG + Intronic
1125961077 15:43830399-43830421 CCCAGCTAATTTTGTATTTTTGG - Intronic
1125974955 15:43943078-43943100 CCCAGCTAATTTTGTATTTTTGG - Intronic
1126155364 15:45560690-45560712 CCCGGCTAATTTTGTATTTTTGG - Intergenic
1126228376 15:46296991-46297013 TTTTGCCAATTCTGCATTTTTGG + Intergenic
1126548745 15:49903731-49903753 CCTAGCTAATTTTGTATTTTTGG - Intronic
1126596110 15:50385822-50385844 CCTGGATAATTTTGTATTTTTGG + Intergenic
1126602389 15:50442133-50442155 CCTGGCTAATTTTGTATTTTTGG + Intronic
1126611476 15:50533837-50533859 CCAGGCTAATTTTGTATTTTTGG - Intronic
1126780226 15:52133469-52133491 TCTGGCTAATTTTCATTTGTAGG - Exonic
1126922871 15:53547291-53547313 CCTGGCTAATTTTGTATTTTTGG + Intronic
1127442633 15:59025889-59025911 CCTGGCTAACTTTGCATTTTTGG + Intronic
1127892972 15:63271169-63271191 CCTGGCTATTTTTGTATTTTTGG - Intergenic
1128000884 15:64190573-64190595 CCTGGCTAATTTTGTATTTTTGG + Intronic
1128194183 15:65735928-65735950 CTTGTCTAATTTTGTATTTTTGG - Intronic
1128485301 15:68079991-68080013 CCCGGCTAATTTTGTATTTTTGG + Intronic
1128563851 15:68686195-68686217 CCTGGCTAATTTTGTAGTTTTGG + Intronic
1128641338 15:69340025-69340047 CCCGGCTAATTTTGTATTTGTGG + Intronic
1128673541 15:69592856-69592878 CCCGGCTAATTTTGTATTTTTGG + Intergenic
1129017570 15:72481995-72482017 CCCGGCTAATTTTGTATTTTTGG + Intronic
1129289407 15:74552354-74552376 CCCGGCTAATTTTGTATTTTTGG + Intronic
1129863098 15:78878689-78878711 TCTGGCAAAGTTTGTATTCTGGG + Intronic
1130360240 15:83177729-83177751 AGTGGCTATTTTTGCACTTTAGG + Intronic
1130536496 15:84789084-84789106 CCTGGCTAATTTTTGTTTTTTGG - Intronic
1130949677 15:88575582-88575604 CCTGGCTAATTTTGTATTTTTGG - Intergenic
1131020431 15:89093339-89093361 CCCAGCTAATTTTGTATTTTTGG + Intronic
1131120215 15:89817790-89817812 CCTGGCTAATTTTTTTTTTTTGG - Intergenic
1131181003 15:90240060-90240082 GCCAGCTAATTTTGTATTTTTGG - Intronic
1131233312 15:90675064-90675086 CCCGGCTAATTTTGTATTTTTGG - Intergenic
1131329349 15:91482124-91482146 TCTGGCTAATTCCTCATTTGTGG + Intergenic
1131474668 15:92727753-92727775 ACCGGCTAATTTTGTATTTTTGG + Intronic
1131480681 15:92779149-92779171 CCCCGCTAATTTTGTATTTTTGG + Intronic
1131810467 15:96168084-96168106 CCTGGCTAATTTTGTATATTTGG - Intergenic
1132350264 15:101135266-101135288 CCCGGCTAATTTTGTATTTTTGG + Intergenic
1132541795 16:513378-513400 CCTGGCTAACTTTTCTTTTTTGG + Intronic
1132582363 16:690767-690789 TTTGGCTAATTTTGTATTTTTGG + Intronic
1132714269 16:1283027-1283049 CCTGTATAATTTTGTATTTTTGG + Intergenic
1133242007 16:4420169-4420191 CCCAGCTAATTTTGTATTTTTGG - Intronic
1133289432 16:4709243-4709265 TCTGGCTAATTTTGCATTTTTGG - Intronic
1133470371 16:6069235-6069257 CCCAGCTAATTTTGTATTTTTGG - Intronic
1134083035 16:11337436-11337458 CCTGGCTAATTTTGTATTTTTGG - Intronic
1134367600 16:13593671-13593693 CCTGCCTTATTTTGTATTTTTGG - Intergenic
1134545068 16:15102007-15102029 CCTGGCTAATTTTGTATTTTTGG + Intronic
1134632850 16:15769337-15769359 CCTGGCTAATTTTTGATTTTAGG - Intronic
1134751272 16:16627532-16627554 CCCAGCTAATTTTGTATTTTTGG + Intergenic
1134837094 16:17370199-17370221 TCTGGCAAATTTGGCTTTCTGGG - Intronic
1134994182 16:18726060-18726082 CCCAGCTAATTTTGTATTTTTGG - Intergenic
1135001990 16:18784406-18784428 CCTGGCTAATTTTGTATTTTAGG + Intronic
1135356292 16:21771912-21771934 CCCGGCTAATTTTGTATTTTCGG + Intergenic
1135414123 16:22256256-22256278 CCTGGCTAATTTTGTATTTTTGG + Intronic
1135545156 16:23360754-23360776 CCTGGCTAATTTTTGGTTTTTGG + Intronic
1135812279 16:25599079-25599101 CTTGGCTAATTTTGTATTATTGG + Intergenic
1135813718 16:25612773-25612795 ACTGTTTTATTTTGCATTTTGGG + Intergenic
1136042329 16:27589936-27589958 CCTGGCTAATTTTGTGTTTTTGG + Intronic
1136405964 16:30047295-30047317 CCTGGCTAATTTTTGCTTTTTGG + Intronic
1136562563 16:31048916-31048938 CCTGGCTAATTTTTGGTTTTGGG + Intergenic
1136864361 16:33731955-33731977 CCTGGCTATTTTTGTACTTTTGG - Intergenic
1137496761 16:48975380-48975402 TCTGGCTATTTTTGCAAGTTAGG - Intergenic
1137536184 16:49328029-49328051 CCTGGCTAAATGTGCAGTTTTGG - Intergenic
1137628677 16:49926575-49926597 TCTGAATAATATTCCATTTTCGG - Intergenic
1137656643 16:50164888-50164910 CCTGGCTAATTTTTTTTTTTTGG - Intronic
1137794124 16:51200646-51200668 CCTGTCTAATTTTGTATTTTTGG + Intergenic
1137923188 16:52512365-52512387 TCTGGGTAATAGAGCATTTTGGG - Intronic
1138360983 16:56426640-56426662 CCTGGCTAATTTTTAATTTTTGG + Intergenic
1138372510 16:56538503-56538525 CCTGGTTAATTTTTTATTTTTGG - Intergenic
1138586538 16:57973975-57973997 ACAGACTAATTTTGCCTTTTGGG - Intergenic
1139061369 16:63256604-63256626 TATGATTAATTTTGCATATTTGG + Intergenic
1139181144 16:64750206-64750228 CCCGGCTAATTTTGTATTTTTGG + Intergenic
1139522654 16:67493514-67493536 CCCAGCTAATTTTGTATTTTTGG - Intergenic
1139626882 16:68196867-68196889 CCAGGCTAATTTTGTATTTTTGG - Intronic
1139723460 16:68876320-68876342 CCCGGCTAATTTTGTATTTTTGG + Intronic
1140088311 16:71816088-71816110 ACTGGCTTATTTTATATTTTTGG - Intergenic
1140425412 16:74857062-74857084 CCCTGCTAATTTTGTATTTTTGG - Intergenic
1140643863 16:77008776-77008798 CCCAGCTAATTTTGTATTTTTGG + Intergenic
1140652842 16:77107261-77107283 CCTGGCTATTTTTGTATTTTTGG - Intergenic
1140672886 16:77296370-77296392 ACTGTGTAATTTTGCATTTGGGG + Intronic
1140718056 16:77744739-77744761 CCTGGCTAATTTTGTATTTTTGG - Intergenic
1140760910 16:78108087-78108109 CCCAGCTAATTTTGTATTTTTGG + Intronic
1140823616 16:78685519-78685541 GGGGGCTATTTTTGCATTTTAGG - Intronic
1141082480 16:81064584-81064606 CCCAGCTAATTTTGTATTTTTGG - Intronic
1141266777 16:82505052-82505074 TCTGGCTACTTTTGCACTACAGG - Intergenic
1141427255 16:83952361-83952383 CCCGGCTAATTTTGTATTTTTGG - Intronic
1141499078 16:84431332-84431354 CCCGGCTAATTTTGTATTTTTGG - Intronic
1141922306 16:87144186-87144208 TCTGGCTCATTCTGCCTTTTTGG + Intronic
1142004619 16:87683765-87683787 CCCAGCTAATTTTGTATTTTTGG + Intronic
1142342042 16:89529998-89530020 TCCAGCTAATTTTGTATTTTTGG + Intronic
1203125847 16_KI270728v1_random:1580093-1580115 CCTGGCTATTTTTGTACTTTTGG - Intergenic
1142526135 17:542815-542837 CCCGGCTAATTTTGTATTTTTGG - Intronic
1142649606 17:1339364-1339386 CCTGGCTAATTTTGTGTTTTAGG - Intergenic
1142755170 17:2012085-2012107 TCTGGCAATTTTAGCATGTTTGG + Intronic
1142798713 17:2330078-2330100 CCTGGCTAATTTTGTATTTTTGG + Intronic
1142814996 17:2418427-2418449 CCTGGCTAATTTTGTGTTTTTGG - Exonic
1142831499 17:2552483-2552505 TCCGGCTAATTTTGTATTTTTGG - Intergenic
1142879563 17:2873921-2873943 CCTGGCTAATTCTGTATTTTTGG + Intronic
1142994542 17:3752886-3752908 CCCGGCTAATTTTATATTTTTGG - Intronic
1143074268 17:4327132-4327154 CCTGGCTAATTTTGTATTTTTGG - Intronic
1143196097 17:5077551-5077573 CCCGGCTAATTTTGTATTTTAGG - Intergenic
1143207637 17:5156465-5156487 CCTGGCTAATTTTGTTTTTTTGG + Intronic
1143276796 17:5717572-5717594 CCCGGCTAATTTTGTACTTTTGG + Intergenic
1143466919 17:7143381-7143403 CCTGGCTAATTTTTTTTTTTTGG - Intergenic
1143574546 17:7783236-7783258 CCCAGCTAATTTTGTATTTTTGG + Intronic
1143647520 17:8240716-8240738 CCTGGCTACTTTTGTATTTTTGG - Intronic
1143813068 17:9488163-9488185 CCCAGCTAATTTTGTATTTTTGG - Intronic
1143818733 17:9542195-9542217 CCTGGCTAATTTTGTATGTTTGG - Intronic
1143909211 17:10233992-10234014 GCCAGCTAATTTTGTATTTTTGG + Intergenic
1144042377 17:11423693-11423715 TCTTACTTATTTTGCAGTTTTGG - Intronic
1144103678 17:11966872-11966894 CCTGGCTAATTTTGCCATATGGG - Intronic
1144110525 17:12027041-12027063 TCTGGCTAAATTTGTAATCTGGG + Intronic
1144127450 17:12216250-12216272 CCTGGCTAATTTTCAATTTTGGG + Intergenic
1144544278 17:16178046-16178068 ACTGGCTAATTTTATATTTTTGG - Intronic
1144961999 17:19049645-19049667 CCAGCCTAATTTTGTATTTTTGG - Intergenic
1144973162 17:19124877-19124899 CCAGCCTAATTTTGTATTTTTGG + Intergenic
1145222519 17:21101162-21101184 CCCGGCTAATTCTGTATTTTTGG + Intergenic
1145229829 17:21165484-21165506 CCTGGCTAATTTTTAATTTTTGG + Intronic
1145711917 17:26985656-26985678 TCTGGCTTGTTTTGGATTTAAGG + Intergenic
1146046945 17:29516660-29516682 TCTGGCTAATTTTGTATTTTTGG + Intronic
1146055873 17:29580938-29580960 CCTGGCTAATTTTGTATTTTTGG + Intronic
1146087179 17:29840217-29840239 TTTGGTTAATTTTGCAAATTTGG + Intronic
1146110737 17:30086729-30086751 CCCAGCTAATTTTGTATTTTTGG - Intronic
1146429896 17:32782772-32782794 CCGAGCTAATTTTGTATTTTTGG - Intronic
1146698006 17:34926273-34926295 CCTGGCTAATTTTGTATTTTTGG - Intergenic
1146814080 17:35928599-35928621 CCTGGCTGATTTTGTATTTTTGG - Intronic
1146984828 17:37205625-37205647 TATGGCTAGTTCTGCATTTAGGG - Intronic
1147001689 17:37367904-37367926 CCCGGCTAATTTTGTATTTTTGG - Intronic
1147272932 17:39289494-39289516 CCTGGCTAATTTTTCTATTTTGG - Intronic
1147291608 17:39448207-39448229 TCTGGCTAATTTTGTATTTTCGG - Intronic
1147410673 17:40249612-40249634 CCCGGCTAATTTTGTATGTTTGG + Intronic
1147569772 17:41562089-41562111 CCTGGCTAATTTTGTATTTTTGG + Intergenic
1147634311 17:41953826-41953848 CCCAGCTAATTTTGTATTTTTGG + Intronic
1147708749 17:42447653-42447675 CCCGGCTAATTTTGTTTTTTCGG - Intergenic
1147724078 17:42555701-42555723 ACCGGCTAATTTTGTATGTTCGG + Intergenic
1147910175 17:43851281-43851303 TTTGGAGTATTTTGCATTTTTGG - Intronic
1147915930 17:43885946-43885968 CCCGGCTAATTTTGTATTTTTGG - Intronic
1148117961 17:45188692-45188714 CCCAGCTAATTTTGTATTTTTGG - Intergenic
1148254069 17:46112880-46112902 CCGGGCTAATTTTGTATTTTTGG + Intronic
1148343096 17:46885147-46885169 CCTGACTAATTTTGTATTTTTGG + Intronic
1148613330 17:48979903-48979925 CCCGGCTAATTTTGTATTTTTGG + Intergenic
1148650049 17:49243986-49244008 CCTGGCTATTTTTGTATTTTTGG + Intergenic
1148737362 17:49872455-49872477 CCCGGCTAATTTTGTATTTTTGG + Intergenic
1149608049 17:57938821-57938843 CCCGGCTAATTTTATATTTTTGG + Intronic
1149746104 17:59099962-59099984 CCTGGCTAATTTTGTATTTTTGG + Intronic
1149826604 17:59834423-59834445 CCTGGCTACTTTTGTTTTTTGGG + Intronic
1149854094 17:60064146-60064168 CCTGGCTAATTTTGTATTTTTGG - Intronic
1149872723 17:60197441-60197463 CCTGGCTAATTTTGCTTTTTTGG - Intronic
1150062602 17:62081908-62081930 CGTGGCTAATTTTGTATTGTTGG + Intergenic
1150524562 17:65908531-65908553 CCAGGCTAATTTTGTATTTGTGG - Intronic
1150559783 17:66284496-66284518 CCCAGCTAATTTTGTATTTTTGG - Intergenic
1150560478 17:66289946-66289968 GCTGGCTAATTTTGTATTTTTGG + Intergenic
1150611739 17:66739041-66739063 CCTGGCTAATTTTCTGTTTTTGG + Intronic
1150669135 17:67174635-67174657 CCCAGCTAATTTTGTATTTTTGG - Intronic
1150865900 17:68849725-68849747 TCTCTGTAAATTTGCATTTTGGG + Intergenic
1150877723 17:68987923-68987945 CCTGGCTAATTTTGTATTTTTGG + Intronic
1150905711 17:69334659-69334681 CCCAGCTAATTTTGTATTTTTGG - Intergenic
1150923482 17:69507735-69507757 TATGGGTAGTTTTCCATTTTTGG + Intronic
1151240224 17:72751736-72751758 CCCGGCTAATTTTGTAATTTTGG + Intronic
1151778756 17:76227714-76227736 CCCGGCTAATTTTGTATTTTTGG - Intronic
1151926188 17:77199163-77199185 CCCGACTAATTTTGTATTTTTGG + Intronic
1151938015 17:77275263-77275285 CCCGGCTAATTTTGTGTTTTTGG - Intergenic
1151981791 17:77515798-77515820 CCAGGCTAATTTTGTATTTTTGG - Intergenic
1152075095 17:78154385-78154407 CCTGTCTAATTTTGTATTTTTGG - Intronic
1152088721 17:78235446-78235468 CCCAGCTAATTTTGTATTTTTGG + Intronic
1152122575 17:78427806-78427828 CCTGGCTAATTTTGTATTTGTGG - Intronic
1152387278 17:79982305-79982327 CCCAGCTAATTTTGTATTTTTGG + Intronic
1152412930 17:80138755-80138777 CCTGGCTAATTTTTTATTATTGG + Intronic
1152653261 17:81506488-81506510 CCCAGCTAATTTTGTATTTTCGG - Intergenic
1152915852 17:83035338-83035360 CCTGGCGAATTTTGTATTTGGGG + Intronic
1153042571 18:827723-827745 CCTGGCTAATTTTGTGTTTTTGG + Intergenic
1153147784 18:2053108-2053130 CCTGGCTAATTTTGTATTTTTGG - Intergenic
1153438507 18:5091421-5091443 CCTGGCTAATTTTGTATTTTTGG + Intergenic
1153635836 18:7112794-7112816 CCTGGCTAATTTTGTATTTTTGG + Intronic
1153758351 18:8306056-8306078 CCTGGCTAATTTTGTATTTTTGG + Intronic
1153793008 18:8596668-8596690 CCTGGCTAATTTTATATTTTGGG + Intergenic
1153810582 18:8748380-8748402 CCTGGCTAATTTTTAAATTTTGG - Intronic
1154124667 18:11679706-11679728 CCTGGCTAATTTTGTATTTTTGG - Intergenic
1154246673 18:12705223-12705245 CCCAGCTAATTTTGTATTTTTGG + Intronic
1154531523 18:15350678-15350700 CCCGGCTAATTTTGTATTTTTGG - Intergenic
1155050774 18:22146054-22146076 CCTGGCTAATTTTGTACTTTTGG + Intergenic
1155191122 18:23431573-23431595 TCAAACTAATTCTGCATTTTAGG + Intronic
1155511382 18:26580779-26580801 TCTGTTTATTTATGCATTTTTGG - Intronic
1155599181 18:27524542-27524564 CAGGGCTAATTTTGTATTTTTGG + Intergenic
1155810550 18:30227673-30227695 CCTGGCTAATTTTGTATTTTTGG - Intergenic
1155847688 18:30730496-30730518 TCTGACTAATATAGCAATTTAGG - Intergenic
1155887143 18:31221997-31222019 CCTAGTTAATTTTGTATTTTTGG - Intergenic
1156045640 18:32874205-32874227 CGTGGCTAATTTTGTATTTTTGG - Intergenic
1156769391 18:40700564-40700586 TTTGGCTCAGTTTGCTTTTTTGG + Intergenic
1157354432 18:46919323-46919345 CCTGGCTAATTTTGCATTTTTGG - Intronic
1157372677 18:47131136-47131158 CCCGGCTAATTTTGTATTTTTGG + Intronic
1157658573 18:49417897-49417919 CCCGGTTAATTTTGTATTTTTGG - Intronic
1157835882 18:50902556-50902578 CCTGGCTAATTTTGTATTTTTGG + Intronic
1158194778 18:54872462-54872484 CCTGGCTAATTTTGTATTTTTGG - Intronic
1158599947 18:58848277-58848299 CCTGGCTAATTTTGTATTTTTGG + Intergenic
1158669727 18:59463928-59463950 GCTTTCTAATTTTTCATTTTGGG - Intronic
1158683575 18:59591924-59591946 TTTGGAGCATTTTGCATTTTTGG - Intronic
1158816774 18:61108535-61108557 TCTGGCTATTCTTGCTTTTTAGG - Intergenic
1158918972 18:62168031-62168053 CCTAGCTAATTTTGTATTTTTGG - Intronic
1158934918 18:62355436-62355458 CCTGGCTAATTTTGTATTTTTGG + Intronic
1159108960 18:64034192-64034214 TCTTGCTCATTTTACATTTCTGG - Intergenic
1159203528 18:65220922-65220944 TCCAGCTAATTTTGTATTTTTGG + Intergenic
1159236034 18:65673720-65673742 CCTGCCAATTTTTGCATTTTTGG - Intergenic
1159303307 18:66606231-66606253 TCTGACTAATTTTTCATATATGG + Intergenic
1159318206 18:66809294-66809316 TCTGACTAATTTTTCTTTATTGG + Intergenic
1159928509 18:74290403-74290425 CCTGGCTAATTTTGGTATTTTGG + Intronic
1160248269 18:77178235-77178257 GCCGGCTACTTTTGTATTTTTGG + Intergenic
1160355320 18:78222944-78222966 CCCGGCTAATTTTGTATTTTCGG + Intergenic
1160774681 19:849858-849880 CCAGGCTAATTTTGTATTTTTGG + Intergenic
1160816284 19:1037431-1037453 CCCAGCTAATTTTGTATTTTTGG + Intronic
1161037925 19:2095903-2095925 TCCGGCTAATTTTGTATTTTTGG + Intronic
1161053760 19:2179644-2179666 CCTGGCTAACTTTGTATTTTTGG - Intronic
1161173578 19:2826059-2826081 CTTGACTAATTTTGTATTTTTGG + Intronic
1161198975 19:3003866-3003888 CCTGGCTAATTTTGTATTTTTGG + Intronic
1161276665 19:3422095-3422117 CCCGGCTAATTTTGTATTTTTGG + Intronic
1161413815 19:4133172-4133194 CCTGGCTAATTTTGTATTTTTGG - Intergenic
1161423963 19:4191940-4191962 TCTAGCTAATTTTTTTTTTTTGG + Intronic
1161476742 19:4490246-4490268 TCCGGCTAATTTTGTGTTTTTGG + Intronic
1161544364 19:4871033-4871055 CCCGGTTAATTTTGTATTTTTGG - Intergenic
1161610892 19:5241994-5242016 CCCGGCTAATTTTGTATTTTTGG + Intronic
1161871340 19:6872765-6872787 CCCAGCTAATTTTGTATTTTTGG - Intergenic
1161888754 19:7018655-7018677 CCTGGCTAATTTTGTATTTTTGG - Intergenic
1161950705 19:7466220-7466242 CCTGGCTAATTTTGTATATTTGG - Intronic
1162024350 19:7885160-7885182 CTCGGCTAATTTTGTATTTTTGG - Intergenic
1162081824 19:8222657-8222679 CCTGGCTAATTTTGTATTTTTGG + Intronic
1162208401 19:9073143-9073165 CCCAGCTAATTTTGTATTTTTGG - Intergenic
1162239346 19:9336428-9336450 CCCAGCTAATTTTGTATTTTTGG - Intronic
1162244040 19:9384000-9384022 CCCAGCTAATTTTGTATTTTTGG - Intergenic
1162297688 19:9824668-9824690 CCTAGCTAATTTTGTATTTTTGG - Intronic
1162393171 19:10401991-10402013 CCTGGCTAATTTTGTATTTTTGG - Intronic
1162441222 19:10693338-10693360 CCTGGCTAATTTTGTATTTTTGG + Intergenic
1162442999 19:10704746-10704768 CCCGGCTAATTTTGTATTTTTGG + Intronic
1162518377 19:11164019-11164041 CTCGGCTAATTTTGTATTTTTGG - Intergenic
1162553550 19:11372325-11372347 CCCGGCTGATTTTGTATTTTTGG - Intergenic
1162610075 19:11742613-11742635 GCCGGCTCATTTTGTATTTTTGG - Intergenic
1162617334 19:11812988-11813010 CCTGGCTAGTTTTTTATTTTTGG - Intergenic
1162890123 19:13726733-13726755 CCTGGCTAATTTTTTATTTTTGG - Intergenic
1162993107 19:14316234-14316256 CCCGACTAATTTTGTATTTTTGG - Intergenic
1163031695 19:14548736-14548758 TCTGGCTAATTTTTGTATTTTGG + Intronic
1163041064 19:14602894-14602916 CCTGGCTAATTTTGTACTTTTGG + Intronic
1163041329 19:14604953-14604975 TCTGGCTATTGTTGCTGTTTGGG - Intronic
1163074677 19:14879420-14879442 CCCAGCTAATTTTGTATTTTTGG + Intergenic
1163149946 19:15405370-15405392 CCTGGCTAATTTTGTATTTTTGG - Intronic
1163247416 19:16105495-16105517 CCTGGCTAATTTTGTATTTTTGG - Intergenic
1163269067 19:16239092-16239114 CCTGGCTAATTTTGTATTTTTGG + Intronic
1163269727 19:16245055-16245077 CCTGCCTAACTTTGTATTTTTGG + Intronic
1163310080 19:16508979-16509001 TCTGGCTAATTTTGTATTTTTGG + Intronic
1163411139 19:17155388-17155410 CCAGGCTAATTTTGAATTCTTGG + Intronic
1163459378 19:17427344-17427366 CCTGGCTAATTCTGTATTTTTGG - Intronic
1163465736 19:17467636-17467658 CCTAGCTAATTATGTATTTTTGG - Intergenic
1163541744 19:17915506-17915528 CCCGGCTAATTGTGTATTTTTGG - Intergenic
1163589522 19:18184268-18184290 CCTGGCCAATTTTGTATTTTTGG - Intergenic
1163629411 19:18409990-18410012 CCTGGCTAATTTTTGTTTTTTGG + Intergenic
1163722297 19:18904124-18904146 CCCAGCTAATTTTGTATTTTTGG + Intronic
1163985904 19:20951042-20951064 CCTGGATAATTTTGTATTTTTGG + Intergenic
1164114399 19:22203753-22203775 CCTGGCTAATTCTGTATTTTTGG + Intergenic
1164122550 19:22280471-22280493 CCCGGCTAATTTTGCATTTTTGG - Intergenic
1164499185 19:28799700-28799722 TCTAGCTGCTTTTACATTTTTGG - Intergenic
1164569524 19:29362337-29362359 TTTGTCTATTTTTGCTTTTTGGG - Intergenic
1164668120 19:30055737-30055759 CCTGGCTAATTTTTGTTTTTTGG + Intergenic
1164684441 19:30157624-30157646 GCTGGTTAATTTTGTATTTTTGG - Intergenic
1164837911 19:31369913-31369935 CCCGGCTAATTTTGTATTTTCGG - Intergenic
1165004555 19:32794264-32794286 CCTGGCTAATTTTGTATTTTTGG + Intronic
1165032085 19:33005250-33005272 CCTGGCTAATTTTGTATTTTTGG - Intronic
1165134508 19:33659224-33659246 CCCGGCTAATTTTGTATTTTTGG + Intronic
1165356056 19:35304842-35304864 TCTGGCTCATTTTCAATTCTAGG + Intronic
1165418802 19:35712299-35712321 CCTAGCTAATTTTGAATTTTTGG - Intronic
1165545651 19:36533226-36533248 CCTGGCTAATTTTGTATTTTTGG - Intergenic
1165598520 19:37032342-37032364 CCTGGCTAATTTTAGTTTTTTGG - Intronic
1165616241 19:37203787-37203809 CCCAGCTAATTTTGTATTTTTGG + Intronic
1165637945 19:37359059-37359081 CCTGGCTAATTTTGTATTTTTGG + Intronic
1165658365 19:37552784-37552806 CTCGGCTAATTTTGTATTTTTGG - Intronic
1165764199 19:38340479-38340501 CCCGGCTAATTTTGTATTTTTGG + Intronic
1165786631 19:38465601-38465623 CCCGGCTAATTTTGTATTTTTGG - Intronic
1165954880 19:39496289-39496311 CCTGGCTAATTTATTATTTTTGG - Intergenic
1166000158 19:39872908-39872930 CCTAGCTAATTTTTTATTTTTGG - Intronic
1166048576 19:40244281-40244303 CCTGGCTAATTTTTTATCTTTGG - Intronic
1166222509 19:41374820-41374842 CCTGGCTAATTTTGTATTTTTGG - Intronic
1166549290 19:43654571-43654593 CCCAGCTAATTTTGTATTTTTGG - Intronic
1166815781 19:45544631-45544653 CCCGGCTAATTTTGTGTTTTTGG - Intronic
1166907381 19:46121225-46121247 TCTGGCTAACTTTGGTTTTTTGG - Intronic
1167016644 19:46845243-46845265 CCAGGCTAATTTTGTATTTTTGG - Intronic
1167088492 19:47327064-47327086 CCCAGCTAATTTTGTATTTTTGG - Intergenic
1167104111 19:47420311-47420333 TCTGGCTCTATTTGCTTTTTTGG + Intergenic
1167110912 19:47460534-47460556 CCTGGCTAATTTTGTATTTTTGG - Intronic
1167133568 19:47603319-47603341 CCCAGCTAATTTTGTATTTTTGG + Intergenic
1167145249 19:47677533-47677555 CCCGGCTAATTTTGTATTTTTGG - Intronic
1167155833 19:47738461-47738483 CCCAGCTAATTTTGTATTTTTGG + Intronic
1167395289 19:49224471-49224493 CCTGGCTAATTTTGTATTTTTGG + Intergenic
1167621375 19:50562899-50562921 CCTGGCTGATTTTGTATTTTTGG + Intronic
1167795698 19:51706818-51706840 CCTGGCTAATTTTGTATTTTTGG + Intergenic
1167983256 19:53293976-53293998 CCCAGCTAATTTTGTATTTTTGG - Intergenic
1168573633 19:57490512-57490534 ACCAGCTAATTTTGGATTTTTGG + Intronic
1168670540 19:58238091-58238113 CCCGGCTAATTTTGTATTTTTGG + Intronic
1202684938 1_KI270712v1_random:40585-40607 CCCAGCTAATTTTGTATTTTTGG - Intergenic
925016504 2:529987-530009 TCTTGGTAAATTTTCATTTTAGG - Intergenic
925641912 2:5993594-5993616 CCCGGCTAATTTTGCATTTTTGG + Intergenic
925659007 2:6182974-6182996 CCTGGCTAATTTTGTATTTTTGG + Intergenic
925760416 2:7179256-7179278 CCCGGCTAATTTTGTATTTTTGG + Intergenic
926138937 2:10356950-10356972 CCTAGCTAATTTTGTATTTTTGG - Intronic
926416386 2:12653669-12653691 ACTGGCTAATTTTTTTTTTTTGG - Intergenic
927049429 2:19312254-19312276 CCTGGCTAATTTTTTAATTTTGG - Intergenic
927795177 2:26041741-26041763 CCCAGCTAATTTTGTATTTTTGG - Intronic
928107775 2:28483201-28483223 CCTGGCTAATTTTGTATTTTAGG - Intronic
928146018 2:28776420-28776442 CCTGGCTAATTTTGTATTTTTGG + Intronic
928306496 2:30174182-30174204 CCTGGCTAATTTTTTTTTTTTGG + Intergenic
928309415 2:30197158-30197180 CCCGGCTAATTTTGTATTTTTGG - Intergenic
928497249 2:31846256-31846278 CCTGGCTAATTTTGTATTTTTGG + Intergenic
928509496 2:31989043-31989065 CCTGGCTAATTTTGTATTTTTGG - Intronic
928576235 2:32657988-32658010 CCCAGCTAATTTTGTATTTTTGG + Intronic
928577192 2:32667575-32667597 CCCGGCTAATTTTGTATTTTTGG + Intronic
929042164 2:37755555-37755577 TATGGCTAATTTTCCATTGTAGG - Intergenic
929573167 2:43035809-43035831 CCCAGCTAATTTTGTATTTTTGG - Intergenic
929647967 2:43648739-43648761 TCTGGCTAATTTTGTATTTTGGG + Intronic
929693340 2:44092900-44092922 CCCGGCTAATTTTGTGTTTTTGG + Intergenic
929721991 2:44378868-44378890 TCTGGCTTACTTTGTATTTTTGG + Intronic
930400112 2:50873548-50873570 TCTGAGTTATTTTTCATTTTGGG + Intronic
930749781 2:54923100-54923122 CCTGGCTAATTTTGTAATTTTGG + Intronic
930814772 2:55584042-55584064 CCTGGCTAACTGTGTATTTTTGG - Intronic
931656871 2:64517521-64517543 GTTGGATAATTCTGCATTTTGGG + Intergenic
931727696 2:65127563-65127585 CCCGGCTAATTTTGTATTTTTGG - Intronic
931754737 2:65362695-65362717 CCTGGCTAATTTTGTATTTTTGG - Intronic
931834189 2:66081826-66081848 CCTGGCTAATTTTTTATTTTTGG + Intergenic
931858759 2:66331821-66331843 CCTGGCTAATTTTGTATTTTTGG + Intergenic
931990796 2:67788169-67788191 CCTGGCTAATTTTGTATTTTTGG - Intergenic
932004965 2:67918682-67918704 TCTAGCTAATTTGTTATTTTTGG - Intergenic
932142148 2:69289199-69289221 TCTGGCTAATTTTGTTTTGTGGG + Intergenic
932146850 2:69327936-69327958 CCTGGCTAATTTTGTATTTTTGG - Intronic
932153213 2:69391719-69391741 CCTGACTATTTTTGTATTTTTGG - Intergenic
933134545 2:78716343-78716365 TCAGGCTACTTTTTCATTTCAGG + Intergenic
933142204 2:78806323-78806345 TCTGGGTTAATTTGTATTTTGGG - Intergenic
933301682 2:80547848-80547870 CCCGGCTAATTTTGTATTTGTGG + Intronic
933481983 2:82869617-82869639 TTTGGCTAATTTTTCCCTTTTGG - Intergenic
933526750 2:83450663-83450685 ACTGGATAACTTTGCATTTTGGG - Intergenic
933630186 2:84647006-84647028 CATGGCTAATTTTGTATTTTTGG + Intronic
934086664 2:88515592-88515614 CCCGACTAATTTTGTATTTTTGG + Intergenic
934246779 2:90314261-90314283 CCCAGCTAATTTTGTATTTTTGG + Intergenic
934508860 2:94920302-94920324 CCTGGCTAACTTAGTATTTTTGG - Intergenic
934632578 2:95944874-95944896 CCTGGCTATTTTTGTATTTTTGG - Intronic
934685520 2:96318472-96318494 CCTAGCTAATTTTGAACTTTTGG + Intergenic
934800925 2:97158386-97158408 CCTGGCTATTTTTGTATTTTTGG + Intronic
934971068 2:98764887-98764909 CCCGGCTAATTTTGTATTTTTGG - Intergenic
935474291 2:103499355-103499377 CATGGCTAATTTTGTATTTTTGG + Intergenic
935766757 2:106375513-106375535 ACTGGCTAATTTTGTATTTTTGG + Intergenic
936370963 2:111902044-111902066 CCTGGCTAATTTTGTATTTTTGG + Intronic
936512743 2:113161408-113161430 CCTGGCTAATTTTGTATTTTTGG - Intronic
936742614 2:115531846-115531868 TCTGCCTGTTTTTGCACTTTAGG + Intronic
936749108 2:115619236-115619258 TCTGGCTAATTTTGTATTTTTGG + Intronic
937335634 2:121060565-121060587 GCTGGCTAATTTGGCTTTGTGGG + Intergenic
937745265 2:125404525-125404547 TTTTTCTAATTTTGTATTTTTGG + Intergenic
937939412 2:127273586-127273608 CTCGGCTAATTTTGTATTTTTGG - Intronic
937976067 2:127582770-127582792 TCTGGCTGGTTTATCATTTTAGG + Intronic
938080223 2:128366076-128366098 CCCGGCTAATTTTGTATTTTTGG - Intergenic
938164116 2:129011246-129011268 CCTGGCTAATTTTGTATTTTTGG - Intergenic
938400743 2:130989120-130989142 CACGGCTAATTTTGTATTTTTGG + Intronic
938438739 2:131305790-131305812 CCTGGCTAATTTTGTGTTTTTGG + Intronic
938450870 2:131418618-131418640 CCCGGCTAATTTTGTATTTTTGG + Intergenic
938673085 2:133603697-133603719 CCTGGCTAATTTTGTATTTTTGG + Intergenic
938763708 2:134446578-134446600 TCTGACTCATTTTTCCTTTTAGG + Intronic
938886722 2:135657248-135657270 CCTGGCTAATTTTTTTTTTTTGG - Intronic
938921077 2:135995615-135995637 CCCGGCTAATTTTGTGTTTTTGG + Intergenic
939299303 2:140314154-140314176 TTTGACTAAATTTGCATTTATGG + Intronic
939328605 2:140728312-140728334 TGTGGCTAATTTTGACTTTCAGG + Intronic
939365699 2:141228085-141228107 CCTGGCTAATTTTTTATTTTTGG + Intronic
939384400 2:141476960-141476982 CCTGGCTAATTTTGTACTTTTGG - Intronic
939776947 2:146399606-146399628 CCTGGCTAATTTTGTATTTTTGG - Intergenic
940162360 2:150726986-150727008 CCTGGCTAATTTCGTATTTTTGG + Intergenic
940223154 2:151374962-151374984 CCTGGCTAATTTTGTATTTCTGG - Intronic
940451493 2:153843764-153843786 TCTGGCCAATTTCTCACTTTGGG - Intergenic
940769102 2:157821362-157821384 CCAGGCTAATTTTGTATTTTTGG - Intronic
941368280 2:164633588-164633610 CCTGACTAATTTTGTATTTTTGG + Intergenic
941459285 2:165748789-165748811 TTTGGCTAAGTATCCATTTTTGG + Exonic
941594623 2:167460395-167460417 TCTGGTGAATTTTTCATTTCAGG + Intergenic
941824684 2:169881338-169881360 CCTGGCTAGTTTTGTATTTTTGG + Intronic
941900275 2:170671604-170671626 CCTGGCTAATTTTTTTTTTTTGG - Intergenic
941971544 2:171356298-171356320 CCCGGCTAATTTTATATTTTTGG + Intronic
941979267 2:171436933-171436955 CCTGGCTAATTTTGTATTTTTGG + Intronic
942093241 2:172514212-172514234 CCTTGCTGATTTTGCATTATTGG - Intergenic
942295614 2:174514511-174514533 CCCGGCTAATTTTGTATTTTTGG - Intergenic
942350745 2:175050516-175050538 CCCAGCTAATTTTGTATTTTTGG + Intergenic
942396545 2:175555861-175555883 TCTTGGGAATTTTGCACTTTGGG - Intergenic
942550466 2:177110681-177110703 CCTGACTAATTTTGTATTTTTGG - Intergenic
943096936 2:183440763-183440785 TGTGTCTATTTTTGCATTTTTGG - Intergenic
943246702 2:185462380-185462402 CCCAGCTAATTTTGTATTTTTGG - Intergenic
943361148 2:186921222-186921244 CCTGGTTAATTTTGTATTTTTGG + Intergenic
943431943 2:187814354-187814376 TCTGGGAAATTTTGCCTTTTGGG + Intergenic
943564244 2:189498599-189498621 CCCGGCTAATTTTGTATTTTTGG - Intergenic
943658193 2:190531000-190531022 CCTGGCCAATTTTTTATTTTTGG - Intronic
943726196 2:191254372-191254394 CCTGGCTAATTTTGTATTTTTGG + Intronic
943907578 2:193519033-193519055 CCCAGCTAATTTTGTATTTTTGG + Intergenic
944338710 2:198569189-198569211 TCTGGCTATTTCTGTCTTTTTGG - Intronic
944366114 2:198921387-198921409 TCTAGTGAATTTTTCATTTTAGG - Intergenic
944702206 2:202255842-202255864 CCTGGCTAATTTTTGTTTTTTGG - Intergenic
944807914 2:203300726-203300748 CCCGGCTAATTTTGTATTTTTGG - Intronic
944939088 2:204603834-204603856 TCTGGCTAAATTCCCACTTTAGG + Intronic
945235681 2:207629307-207629329 CCAGACTAATTTTGTATTTTTGG - Intergenic
945611633 2:212011587-212011609 CCTGGCTAATTTTGTATTTTTGG - Intronic
945615611 2:212061894-212061916 CATGGCTAATTTTGTATTTTTGG + Intronic
946010824 2:216562276-216562298 CCTGGCTAATTTTGTATTTTTGG - Intronic
946259316 2:218472625-218472647 CCCGGCTAATTTTGTATTTTTGG + Intronic
946272092 2:218602963-218602985 CCCAGCTAATTTTGTATTTTTGG + Intergenic
946576488 2:221081507-221081529 TCTTGCAATTTTTACATTTTTGG - Intergenic
946824782 2:223666150-223666172 ACTGGCAAATTTTGCAATCTTGG + Intergenic
946834197 2:223756174-223756196 CCTGGCTAATTTTGTATTTTTGG - Intronic
946863221 2:224019835-224019857 TCTGGATAATTATTCATTGTAGG + Intronic
947215379 2:227745173-227745195 CCTGGCTAATTTCGTATTTTTGG + Intergenic
947646005 2:231740975-231740997 TCTGGCTAATTTTGTGTTTTCGG - Intronic
947684892 2:232074743-232074765 CCTGGCTAATTTTTTATTTTTGG + Intronic
947756638 2:232570773-232570795 CCCGGCTAATTTTGTATTTTTGG - Intronic
947985710 2:234445934-234445956 CCTGGCTAATTTTGTATTTTTGG - Intergenic
948086566 2:235255410-235255432 CCCGGCTAATTTTGTATTTTTGG - Intergenic
948118870 2:235514252-235514274 TCTGGGTAAATTTATATTTTGGG - Intronic
948163308 2:235842886-235842908 CCCAGCTAATTTTGTATTTTTGG + Intronic
948986449 2:241527640-241527662 CTGGGCTAATTTTGAATTTTTGG + Intergenic
949015915 2:241710643-241710665 CCCGGCTAATTTTGTATTTTTGG + Intronic
1168762480 20:358735-358757 CCTGGCTAATTTTGTATTTTAGG + Intronic
1168818748 20:759463-759485 CCTGGCTAATTTTTTTTTTTTGG - Intergenic
1168930179 20:1615979-1616001 TCTAGCTATTTTAGCTTTTTTGG - Intronic
1169040161 20:2487269-2487291 TCTGAATAGTTTTGCACTTTTGG - Intronic
1169059929 20:2653814-2653836 CCCGGCTAATTTTGTATTTTTGG + Intronic
1169153710 20:3311299-3311321 CCTGGCTAATTTTTTTTTTTTGG + Intronic
1169165908 20:3423840-3423862 CCCGGCTAATTTTGTATTTTTGG - Intergenic
1169242890 20:3999591-3999613 CCCAGCTAATTTTGTATTTTTGG - Intronic
1169676666 20:8162354-8162376 TATAGCTAATTTTTCATTTCTGG + Intronic
1169699126 20:8427070-8427092 TCTGGGTAATCTTGTATTTTTGG + Intronic
1169788831 20:9388075-9388097 CCCAGCTAATTTTGCATTTTTGG - Intronic
1170347900 20:15407239-15407261 GCTGGCTAACTCTGCATTTCTGG - Intronic
1171315047 20:24183241-24183263 ACTGGCTAGTTTTTCAATTTTGG - Intergenic
1171768496 20:29302805-29302827 CCTGGCTGATTTTGTATTGTTGG - Intergenic
1171979075 20:31614068-31614090 CCTGGCTAATTTTGTATTTTTGG + Intergenic
1171987734 20:31672301-31672323 CCCAGCTAATTTTGTATTTTTGG - Intronic
1172246984 20:33452389-33452411 CCCGGCTAATTTTTTATTTTTGG - Intergenic
1172288712 20:33759443-33759465 CCCGGCTAATTTTGTATTTTTGG + Intronic
1172327059 20:34044479-34044501 CCCGGCTAATTTCGTATTTTTGG + Intronic
1172375795 20:34439012-34439034 TCTGGGTCATTTAGCATTGTTGG - Intronic
1172659967 20:36561173-36561195 CCCAGCTAATTTTGTATTTTTGG - Intergenic
1172682870 20:36730414-36730436 CCTGGCTAATTTTTGTTTTTTGG + Intronic
1172704731 20:36874717-36874739 CCCAGCTAATTTTGTATTTTTGG - Intergenic
1173482065 20:43409586-43409608 TCTGGCTTGTTTTGGTTTTTTGG - Intergenic
1173610909 20:44367172-44367194 CCTGGCTAATTTTGTATTTTTGG - Intronic
1173789748 20:45820514-45820536 CCTGGCTAATTTTGTATTTTTGG + Intergenic
1173983138 20:47240351-47240373 CCCGGCTATTTTTGTATTTTCGG - Intronic
1174209573 20:48866766-48866788 CTTGGCTAATTTTATATTTTTGG - Intergenic
1174226835 20:49007448-49007470 CCCAGCTAATTTTGTATTTTTGG + Intronic
1174496391 20:50947045-50947067 CCCAGCTAATTTTGTATTTTTGG - Intronic
1174630429 20:51952243-51952265 CCCGGCTAATTTTGTATTTTTGG - Intergenic
1174667503 20:52273819-52273841 TCTGGCTAATTTTTGTATTTTGG + Intergenic
1174816852 20:53694518-53694540 CCTGGCTAATTTTGTATTTTTGG + Intergenic
1174820898 20:53725621-53725643 CCAGGCTAATTTTGCATTTTTGG + Intergenic
1174898263 20:54473370-54473392 CATAGCTAATTTTGTATTTTTGG + Intergenic
1175083208 20:56438125-56438147 GCTGGCTAATTTTTAAATTTTGG - Intronic
1175203836 20:57296064-57296086 CCTGACTAATTTTGTATTTTTGG + Intergenic
1176071315 20:63227933-63227955 CCTGGCTAATTTTGTATCTTTGG + Intergenic
1176349544 21:5781574-5781596 CCTGGAAAATTTTGTATTTTTGG + Intergenic
1176356358 21:5902158-5902180 CCTGGAAAATTTTGTATTTTTGG + Intergenic
1176543865 21:8179644-8179666 CCTGGAAAATTTTGTATTTTTGG + Intergenic
1176562816 21:8362689-8362711 CCTGGAAAATTTTGTATTTTTGG + Intergenic
1176765836 21:13017480-13017502 CCCGGCTAATTTTGTATTTTTGG + Intergenic
1176962443 21:15174763-15174785 TCATGCCAATTTTACATTTTGGG + Intergenic
1176967459 21:15227536-15227558 GCTGGCTAATTTTTGTTTTTTGG + Intergenic
1177013064 21:15752092-15752114 CCTGGCTAATTTTGTATTTTTGG + Intronic
1177039546 21:16090689-16090711 TTTGTCTTTTTTTGCATTTTTGG + Intergenic
1177481732 21:21698371-21698393 CCTGGCTAATTTTATATTTTTGG + Intergenic
1177792078 21:25732820-25732842 CCCGGCTAATTTTGTATTTTTGG - Intronic
1178459255 21:32787132-32787154 TCTGGCTAATTTTGCAATTTTGG - Intergenic
1178565696 21:33682374-33682396 CCCGGCTAATTTTGTATTTTTGG + Intronic
1178982682 21:37278073-37278095 TCCGGCTAATTTTGTATTTTTGG - Intergenic
1179368942 21:40786073-40786095 CCTGGCTAATTTTGTATTTTTGG - Intronic
1180430467 22:15244323-15244345 CCCGGCTAATTTTGTATTTTTGG + Intergenic
1180470046 22:15645415-15645437 CCCAGCTAATTTTGTATTTTTGG + Intergenic
1180484051 22:15779086-15779108 CCTGGCTAATTTTGTATTTTTGG + Intergenic
1180513021 22:16112230-16112252 CCTGGCTAATTTTGTATTTTTGG + Intergenic
1180608498 22:17080004-17080026 TCTGGCTAATTTTTGTATTTTGG + Intergenic
1181081275 22:20417455-20417477 TTTGGTAAATTTTGTATTTTTGG + Intergenic
1181091190 22:20473712-20473734 ACCAGCTAATTTTGTATTTTTGG - Intronic
1181575838 22:23794103-23794125 CCCAGCTAATTTTGTATTTTTGG + Intronic
1181647469 22:24240994-24241016 CCTGGCTAATTTTGTATTTTTGG - Intronic
1181748235 22:24970863-24970885 TCTGGCTCAGTCTGCATTGTTGG - Intronic
1181816466 22:25440855-25440877 CCTAGCTAATTTTATATTTTTGG - Intergenic
1182219500 22:28746736-28746758 CCTGGCTAATTTTGTATTTTAGG - Intronic
1182258620 22:29056260-29056282 CCCAGCTAATTTTGTATTTTTGG + Exonic
1182288642 22:29262865-29262887 CCTGGCTAATTTTTGTTTTTTGG + Intronic
1182288668 22:29263034-29263056 CCTGGCTAATTTTTGTTTTTTGG + Intronic
1182305706 22:29366473-29366495 CCCGGCTAATTTTGTATTTTTGG - Intronic
1182312982 22:29422415-29422437 CCTGGCTAATTTTGTATTTTTGG - Intronic
1182348774 22:29686476-29686498 CCTGGCAAATTTTGTATTTTTGG - Intronic
1182366050 22:29780209-29780231 CCCAGCTAATTTTGTATTTTTGG + Intergenic
1182461430 22:30486425-30486447 CCTGGCTAATTTTTTTTTTTTGG - Intergenic
1182569020 22:31222229-31222251 CCTGGCTAATTTTGTATTTTTGG + Intronic
1182639945 22:31759091-31759113 CCCAGCTAATTTTGCATTTTTGG + Intronic
1182669653 22:31985032-31985054 CCTGGCTAATTTTTTTTTTTTGG - Intergenic
1182837691 22:33357631-33357653 CCTGGCTAATTTTGTATTTTTGG - Intronic
1182979841 22:34658568-34658590 CCTGTCTAATTTTGTGTTTTTGG + Intergenic
1183208042 22:36432906-36432928 CGTGGCTAATTTTCCTTTTTAGG - Intergenic
1183568982 22:38638003-38638025 CCTGGCTAAATTTGCATTTTTGG - Intronic
1183655629 22:39183075-39183097 CCCAGCTAATTTTGTATTTTTGG - Intergenic
1183869639 22:40731480-40731502 ACTGGCTAATTTTGTATTTTTGG + Intergenic
1183899770 22:40996335-40996357 CCCGGCTAATTTTGTATTTTTGG + Intergenic
1183915110 22:41111699-41111721 TACCGCTAATTTTGTATTTTTGG + Intronic
1183939351 22:41284404-41284426 CCCGGTTAATTTTGTATTTTTGG - Intronic
1184057798 22:42064177-42064199 CCTGGCTAATTTTGTATTTTTGG - Intronic
1184481290 22:44748993-44749015 CCCAGCTAATTTTGTATTTTTGG - Intronic
1184494765 22:44832385-44832407 CCTGGCTAATTTTGTATTTTTGG + Intronic
1184511030 22:44933270-44933292 CCTGGCTAATTTTGTATTTTTGG + Intronic
1185263282 22:49883141-49883163 TTTTGCTTATTTTGCAATTTGGG + Intronic
1185356478 22:50375028-50375050 CCTAGCTAATGTTCCATTTTAGG - Intronic
1203248732 22_KI270733v1_random:95865-95887 CCTGGAAAATTTTGTATTTTTGG + Intergenic
1203294369 22_KI270736v1_random:27057-27079 TATGGCTAATTTTCCATTGTAGG - Intergenic
949685683 3:6567051-6567073 CCTGGGTAATTTTGTATTTTTGG - Intergenic
949948554 3:9209938-9209960 GCTGACTAATATTCCATTTTAGG - Intronic
950086570 3:10262694-10262716 CCTGGCTAATTTTGTATTTTTGG + Intronic
950233344 3:11295937-11295959 CCCAGCTAATTTTGTATTTTTGG + Intronic
950592899 3:13951681-13951703 TCTGGCTAATTGGCCATTATTGG + Intronic
950648365 3:14392019-14392041 CCCGGCTAATTTTGTATTTGTGG - Intergenic
950760978 3:15226233-15226255 CCCGACTAATTTTGTATTTTGGG + Intronic
950939087 3:16875090-16875112 TCTGTCTAATTTTGGGTATTAGG - Intronic
951024571 3:17815970-17815992 CCCAGCTAATTTTGTATTTTTGG + Intronic
951209603 3:19960460-19960482 CCCGGCTAATTTTGTATTTTTGG + Intronic
951227040 3:20132211-20132233 CCCAGCTAATTTTGTATTTTTGG - Intronic
951420084 3:22473686-22473708 CCTGGCTCATTTTGTATTGTTGG - Intergenic
951568749 3:24039907-24039929 CCTGGCTAATTTTGTATTTTTGG + Intergenic
951725848 3:25758212-25758234 TCTTGATAATTTTGAATTTAAGG - Intronic
951883422 3:27501503-27501525 CCTGGATAATTTTGTATTTTGGG - Intergenic
951922024 3:27865440-27865462 CCCGGCTAATTTTGTATTTTTGG - Intergenic
952079309 3:29738781-29738803 TAAGGCTAATGTTGCATTTCTGG + Intronic
952460182 3:33516504-33516526 CCCGGCTAATTTTGTGTTTTTGG - Intronic
952485178 3:33802649-33802671 CCTGGCTAATTTTGTATTTTTGG + Intronic
952731278 3:36639075-36639097 CCCAGCTAATTTTGTATTTTTGG + Intergenic
952881488 3:37988699-37988721 CCCGGCTAATTTTGTATTTTTGG - Intronic
952980794 3:38733879-38733901 CCTGGCTAATTTTGTATTTTTGG + Intronic
953020251 3:39108425-39108447 TCTGGCTGCTTTTGCATGTGGGG - Intronic
953835360 3:46338631-46338653 TTTGGCTAATTTTTCCCTTTTGG - Intergenic
954023714 3:47765088-47765110 CCCGGCTAATTTTGCATTTTTGG - Intronic
954064579 3:48095631-48095653 CCCGGCTAATTTTTTATTTTTGG + Intergenic
954114325 3:48456832-48456854 TATGGCTAATATTATATTTTTGG + Intronic
954160967 3:48721799-48721821 CTCGGCTAATTTTGTATTTTTGG - Intronic
954252244 3:49376965-49376987 CCTGGCTAATTTTGTATTTTTGG - Intronic
954376848 3:50199134-50199156 TCTGGCTAATTTTGTATTTTTGG + Intergenic
954565238 3:51594385-51594407 TCTGGATAATCTTGTATGTTAGG + Intronic
954669211 3:52279105-52279127 CCCAGCTAATTTTGTATTTTTGG + Intronic
954760261 3:52868781-52868803 CCTGGCTAATTCTGTATTTTTGG + Intronic
954802744 3:53196515-53196537 CCTGGCTAATTTTGTATTTTTGG + Intergenic
954965910 3:54610788-54610810 CCCGGCTAATTTTGTATTGTTGG + Intronic
955030884 3:55216671-55216693 CCCGGCTAATTTTGTATTTTTGG + Intergenic
955142815 3:56286250-56286272 TCCGGCTAATTTTGTATTTTTGG - Intronic
955324817 3:58001829-58001851 CCAGCCTAATTTTGTATTTTTGG - Intergenic
955355380 3:58226924-58226946 CCTGGCTAATTTTGTATTTTTGG + Intergenic
955540732 3:59973351-59973373 ACTGCCTTATCTTGCATTTTTGG + Intronic
955638217 3:61053495-61053517 CCCGGCTAATTTTGTATTTTTGG - Intronic
956096570 3:65722470-65722492 TCTAGCTAATTTTTTTTTTTTGG - Intronic
956431748 3:69193345-69193367 CCTAGCTAATTTTGTATTTTTGG - Intronic
956472151 3:69578509-69578531 GCTGGCTATTTTTGCATTTTCGG + Intergenic
956629490 3:71301603-71301625 TGTGTCTATTTTTGCATGTTTGG + Intronic
957174893 3:76794800-76794822 TCTGGCTAATTAATCAATTTTGG + Intronic
957287970 3:78241374-78241396 CCTGTTTAATTTTGTATTTTTGG + Intergenic
957314876 3:78564268-78564290 TCTTGTTAATCTTGCATTATAGG - Intergenic
957678952 3:83406457-83406479 CATGCCTAATTTTGTATTTTTGG - Intergenic
957786011 3:84884401-84884423 TCTGGCTAATTTTGTATTTTTGG + Intergenic
957868443 3:86055625-86055647 CCTGGCTAATATTTTATTTTAGG + Intronic
958432581 3:94059893-94059915 CCAGGCTAATTTTGTATTTTTGG - Exonic
958781127 3:98543621-98543643 TCTGACTAATTTTCCATTGCTGG + Intronic
959038812 3:101397002-101397024 CCCAGCTAATTTTGTATTTTCGG + Intronic
959456029 3:106562842-106562864 CCCGGCTAATTTTGTATTTTTGG - Intergenic
959578235 3:107958026-107958048 TCTGGCTGCTTTTGCATCTGTGG - Intergenic
959837927 3:110942832-110942854 TCCGGCTTATTTCCCATTTTTGG - Intergenic
960086887 3:113600986-113601008 TCTGGCTAACGCAGCATTTTTGG - Intronic
960260779 3:115565884-115565906 CCTGGCTAATTTTATATTTTTGG - Intergenic
960314533 3:116160236-116160258 CCTGGCTACTTTTGTATTTTTGG - Intronic
960570378 3:119179668-119179690 CCCGGCTAACTTTGTATTTTTGG + Intronic
960723048 3:120643282-120643304 TCTGGCTAATTTTTGTATTTTGG + Intronic
960789920 3:121417624-121417646 CCCGGCTAATTTTGTACTTTTGG + Intronic
960817164 3:121685677-121685699 TCATGCTTATATTGCATTTTTGG - Intronic
961264931 3:125634254-125634276 CCTGGTTAATTTTGTATTTTGGG - Intergenic
961693075 3:128684488-128684510 CCTGGCTAATTTTGTATTTTTGG + Intergenic
961731371 3:128967538-128967560 TCCGGCTGATTTTGTATTTTTGG - Exonic
961744304 3:129054087-129054109 CCCAGCTAATTTTGTATTTTTGG - Intergenic
961751690 3:129099545-129099567 CCCGGCTAATTTTGTATTTTTGG + Intronic
961846986 3:129773781-129773803 CCTGGCTAATTTTAAATTTTTGG - Intronic
962842269 3:139245835-139245857 CCTGACTAATTTTGTATTTTTGG + Intronic
962874728 3:139527207-139527229 CCTGGATAATTTTGTATTTTTGG - Intronic
963169295 3:142234740-142234762 CCCGGCTAATTTTGTATTTTTGG - Intergenic
963363873 3:144309883-144309905 CCTGACAAATTTTGCATTATTGG - Intergenic
963508310 3:146216067-146216089 CCCGGATAATTTTGTATTTTCGG - Intronic
963782105 3:149496605-149496627 TCCGGCTAATTTTGTATTTTTGG - Intronic
963950263 3:151191743-151191765 CCCGGCTAATTTTGTATTTTTGG - Intronic
964282822 3:155085690-155085712 CCTGGCTAATTCTGTATTTTTGG + Intronic
964357029 3:155860452-155860474 TCTGACAAATTTTGTATTTTTGG + Intergenic
964610798 3:158612995-158613017 CCTGGCTAATTTTGTTTTTTAGG + Intergenic
964629589 3:158795673-158795695 CCCGGCTAATTTTGTATTTTTGG + Intronic
964812555 3:160681642-160681664 CCTGGGTAATTTTGTATTTTTGG + Intergenic
965067434 3:163868938-163868960 TCTAGGTAAATTTGAATTTTAGG - Intergenic
965127224 3:164646905-164646927 CCCGGCTACTTTTGGATTTTTGG + Intergenic
965149044 3:164946729-164946751 CCTGGCCAATTTTTTATTTTTGG - Intergenic
965152635 3:164999543-164999565 TCTGCCTAATTATGTATTTGTGG - Intronic
965852276 3:173042383-173042405 CCCAGCTAATTTTGTATTTTTGG + Intronic
965927036 3:173994266-173994288 CCTGGCTAATTTTGTATTTTGGG + Intronic
966138624 3:176729759-176729781 TCCAGCTAATTTTGTATTTTTGG - Intergenic
966286156 3:178297843-178297865 TCAGGCAAATTATGCCTTTTAGG + Intergenic
966527910 3:180940735-180940757 CCCAGCTAATTTTGTATTTTTGG + Intronic
966598483 3:181750003-181750025 CCCAGCTAATTTTGTATTTTTGG + Intergenic
966763070 3:183434052-183434074 CCTGGCTAATTTTGTATTTTTGG - Intergenic
966894774 3:184435936-184435958 CCTGGCTAATGTTGTATTTTTGG + Intronic
967001611 3:185341050-185341072 TCTGGGTAAATGTGAATTTTGGG + Intronic
967030628 3:185603071-185603093 CCCAGCTAATTTTGTATTTTTGG + Intronic
967057560 3:185842977-185842999 CCCAGCTAATTTTGTATTTTTGG - Intergenic
967073647 3:185983365-185983387 CCCAGCTAATTTTGTATTTTTGG + Intergenic
967081475 3:186053739-186053761 TTTGGTTAATTTTGCCTTTTGGG - Intronic
967092161 3:186144116-186144138 CCTGGCAAATTTTGTATTTTTGG + Intronic
967159386 3:186721952-186721974 CCCAGCTAATTTTGTATTTTTGG - Intronic
967520401 3:190424768-190424790 TCTGGCTAACTTTTTTTTTTTGG - Intergenic
967585904 3:191214849-191214871 CCCAGCTAATTTTGCATTTTTGG - Intronic
968012936 3:195298790-195298812 CCTGGCTAATTTTGTATTTTTGG + Intronic
968028459 3:195462943-195462965 CGTGGCTAATTTTGTATTTTTGG + Intergenic
968078826 3:195832900-195832922 AGTGGCTAATTTTGTATTTTTGG + Intergenic
968324871 3:197805053-197805075 CCTGGCTAATTTTGTATTTTTGG + Intronic
968379825 4:82543-82565 CCTGGCTAATTTTGTAATTTTGG + Intronic
968774069 4:2528692-2528714 CCCGGCTAATTTTGTATTTTTGG - Intronic
968828258 4:2915342-2915364 CCAGCCTAATTTTGTATTTTTGG - Intronic
968861183 4:3171636-3171658 CCTGGCTAATTTTGTATTTTTGG + Intronic
969256558 4:6006318-6006340 TGTGGCTCAATTTGCATTTAAGG - Intergenic
969660448 4:8524424-8524446 CCTGGCTGATTTTGTATTTTTGG - Intergenic
969803705 4:9589629-9589651 CCCAGCTAATTTTGTATTTTTGG - Intergenic
969850644 4:9953968-9953990 CCCGGCTGATTTTGTATTTTTGG + Intronic
969969428 4:11030474-11030496 CCTGGCTAATTTTGTATTTTTGG + Intergenic
970160983 4:13188974-13188996 CCTGCCTAATTTTTCATTTATGG + Intergenic
970281956 4:14466495-14466517 TATTGCTATTTTTGCACTTTGGG + Intergenic
971477472 4:27085825-27085847 TCTGCATAATATTCCATTTTTGG - Intergenic
971613955 4:28763612-28763634 TCTGCCTAATGCTGCACTTTGGG + Intergenic
971991972 4:33910147-33910169 TCTGGGTTATTTTGAGTTTTTGG - Intergenic
972036155 4:34524005-34524027 CCCGGCTAATTTTGTATTTTTGG + Intergenic
972047191 4:34681212-34681234 CCCGGCTAATTTTGTATTTGTGG + Intergenic
972300639 4:37782550-37782572 TCCAGCTAATTTTGTATTTTTGG - Intergenic
972472230 4:39417472-39417494 CCTGGCTAATTTTGTATTTTTGG + Intronic
972502837 4:39694310-39694332 CCTGGCTAATTTTGTATTTTTGG + Intergenic
972517192 4:39819443-39819465 TCTGGCTAATTTTGTATTTTTGG + Intergenic
972546439 4:40084774-40084796 CCCAGCTAATTTTGTATTTTTGG + Intronic
972759539 4:42089576-42089598 CCCGGCTAATTTTGTATTTCTGG + Exonic
972830133 4:42805372-42805394 TTTGGCTTATTTTGAATTCTTGG + Intergenic
973280652 4:48357714-48357736 CCCGGCTAATTTTGCATTTTTGG + Intronic
973580034 4:52334140-52334162 TCTGGCTAATTTTGTATTTTTGG - Intergenic
973694338 4:53475459-53475481 TCTAGTTAATTTTGTATTTGAGG + Intronic
973890202 4:55360847-55360869 CCCAGCTAATTTTGTATTTTTGG + Intronic
974043396 4:56877330-56877352 CCCGGCTAATTTTGTATTTTTGG + Intergenic
974083956 4:57239819-57239841 CCCAGCTAATTTTGTATTTTTGG + Intergenic
974130728 4:57752463-57752485 CCCAGCTAATTTTGTATTTTTGG + Intergenic
974382046 4:61153793-61153815 CCTGGCTAATTTTGTATTTTTGG - Intergenic
974616863 4:64298288-64298310 TTTGTCTAATTTAGCATCTTTGG + Intronic
975136296 4:70877839-70877861 TCTTGCTAATTTTTTAATTTGGG - Intergenic
975777477 4:77803740-77803762 CCCGGCTAATTTTGTATTTTTGG - Intronic
976090493 4:81452269-81452291 CCTGGCTAATTGTGTATCTTTGG + Intronic
976888430 4:90014158-90014180 CCTTGTTAATTTTACATTTTAGG + Intergenic
977101115 4:92816152-92816174 CCCGGCTAATTTTGTATTTTTGG - Intronic
977593955 4:98857861-98857883 CCCGGCTAATTTTGTATTTTTGG - Intergenic
977727597 4:100314983-100315005 CCTGGCTACTTTTGTATTTTTGG + Intergenic
977799372 4:101207663-101207685 CCTGGCTGCTTTTGTATTTTTGG - Intronic
978427069 4:108594009-108594031 CCCAGCTAATTTTGTATTTTTGG + Intergenic
978567023 4:110094086-110094108 CCTGGCTAATTTTGTGTTTTTGG - Intronic
978569225 4:110118117-110118139 CCCGGCTAGTTTTGTATTTTTGG + Intronic
978737311 4:112098645-112098667 CCTGGCTAATTTTGTATTTTTGG - Intergenic
978792273 4:112675122-112675144 CCCGGCTAATTTTGTATTTTTGG + Intergenic
978876086 4:113641846-113641868 CCTGGCTAATTTTGTATTTTTGG - Intronic
979664513 4:123295749-123295771 CCTGGCTAATTTTGTATTTTTGG - Intronic
979738435 4:124118584-124118606 CCTAACTAATTTTGTATTTTTGG - Intergenic
979935935 4:126695579-126695601 TCTTGCTCATTTTCCATTGTAGG + Intergenic
980023206 4:127733433-127733455 TTTGGAGAATTTTGGATTTTTGG + Intronic
980341952 4:131561958-131561980 TTTGGCCAAATGTGCATTTTGGG - Intergenic
980907860 4:138965905-138965927 CCTGGCTAATTTTGTATTTTTGG - Intergenic
981004786 4:139863509-139863531 CTTGGCAAATTTTGTATTTTTGG + Intronic
981569582 4:146137269-146137291 CCTGGCTAATTTTAATTTTTTGG - Intergenic
982186220 4:152803395-152803417 TTTGGGTAATTTTTTATTTTGGG + Intronic
982254442 4:153438335-153438357 CCTGGCTAATTTTGTATTTTTGG - Intergenic
982346791 4:154368675-154368697 CCCGGCTAATTTTGTATTTTTGG + Intronic
982796946 4:159657976-159657998 CCCGGCTAATTTTGTGTTTTTGG + Intergenic
983475401 4:168206363-168206385 CCTGGCTATTTTTGTATTTTTGG + Intergenic
984142054 4:176015438-176015460 CCCGGCTAATTTTGTATTCTTGG + Intergenic
984142413 4:176019900-176019922 CCTGGCTAATTTTGTATTTTTGG + Intergenic
984208490 4:176816391-176816413 CCTGGCTCATTTTGTATTTTTGG + Intergenic
984581615 4:181516613-181516635 TCCAGCTCATTTTGTATTTTGGG - Intergenic
984808138 4:183769951-183769973 CCTAGCTAATTGTGTATTTTTGG - Intergenic
984848313 4:184127594-184127616 CCTGGCTAGTTTTATATTTTTGG - Intronic
985102907 4:186475783-186475805 CCCAGCTAATTTTGTATTTTTGG + Intronic
985183576 4:187291811-187291833 TGTGGCTAGTTTTGTATTGTTGG + Intergenic
985485258 5:145193-145215 CCTGGCTGGCTTTGCATTTTAGG - Intronic
986580321 5:9258981-9259003 CCTGGCTAATTTTGTATTTTTGG + Intronic
986675918 5:10185200-10185222 ACTGGCTAATTTTTTATTTTTGG - Intergenic
986747470 5:10757433-10757455 CCCGACTAATTTTGTATTTTTGG + Intronic
987025698 5:13924512-13924534 CCTGGCTAATTTTGTATTTTTGG - Intronic
987496044 5:18645990-18646012 TTTTTCTAATTTTTCATTTTTGG + Intergenic
987693951 5:21304293-21304315 CCCAGCTAATTTTGTATTTTTGG + Intergenic
987791281 5:22571485-22571507 CCAGACTAATTTTGTATTTTTGG + Intronic
987839257 5:23201562-23201584 CCCGGCTAATTTTGTGTTTTTGG - Intergenic
987846357 5:23292173-23292195 CCCAGCTAATTTTGTATTTTTGG + Intergenic
987883690 5:23783722-23783744 CCTGGCTAATTTTGTATTTTTGG + Intergenic
988067496 5:26240371-26240393 TCTGGCTAGGTTTACAATTTAGG + Intergenic
988799372 5:34682014-34682036 CCCGGCTAATTTTGTATTTTTGG + Intronic
988980247 5:36561207-36561229 CCCGGCTAATTTTTTATTTTTGG + Intergenic
989326594 5:40203798-40203820 TCTTACTAATTTTGCATTTATGG + Intergenic
989369118 5:40687204-40687226 CCCGGCTAATTTTGTATTTTTGG + Intronic
989575823 5:42987240-42987262 CCCGGCTAATTTTGTATTTTTGG + Intergenic
989778421 5:45236256-45236278 CCCGGCTAATTTTGCATTTTTGG + Intergenic
990213807 5:53508674-53508696 CCTGGCTAATTTTGTATTTTTGG + Intergenic
990246158 5:53865279-53865301 CCTGGCTAATTTTGTATTTTTGG + Intergenic
990345856 5:54870706-54870728 TATGGATTATTTTACATTTTTGG - Intergenic
990422660 5:55652195-55652217 CCCAGCTAATTTTGTATTTTTGG - Intronic
990769768 5:59229957-59229979 CCTGGCTAATTTTGTATTTGGGG + Intronic
990806554 5:59669272-59669294 CCCGGCTAATTTTGTATTTTTGG + Intronic
990964962 5:61436038-61436060 CCCGGCTAATTTTGTATTTTTGG - Intronic
991608938 5:68430865-68430887 ACTGGTTAATTTTGTATTTTTGG - Intergenic
991746298 5:69745238-69745260 CCCAGCTAATTTTGTATTTTTGG - Intergenic
991751407 5:69810003-69810025 CCCAGCTAATTTTGTATTTTTGG + Intergenic
991797900 5:70325191-70325213 CCCAGCTAATTTTGTATTTTTGG - Intergenic
991825676 5:70620552-70620574 CCCAGCTAATTTTGTATTTTTGG - Intergenic
991830694 5:70684897-70684919 CCCAGCTAATTTTGTATTTTTGG + Intergenic
991890243 5:71324510-71324532 CCCAGCTAATTTTGTATTTTTGG - Intergenic
992153111 5:73925861-73925883 TCTGGCTTATTTCTAATTTTTGG + Intronic
992439778 5:76788063-76788085 TTTGGCTAATTTTGTATTTTTGG - Intergenic
992498759 5:77321310-77321332 CCTGGCTAATTTTGTATTTTTGG + Intronic
992601336 5:78403802-78403824 CCCAGCTAATTTTGTATTTTTGG - Intronic
992685153 5:79192494-79192516 CCTGGCTAATTTTGCATTTTTGG + Intronic
992719173 5:79542844-79542866 CCCGGCTAATTTTGTATATTTGG - Intergenic
992847802 5:80771316-80771338 CCTGGCTAATTTTATATTTTAGG - Intronic
992850870 5:80806257-80806279 CCTGGCTAATTTTGTATTTTTGG + Intronic
993272328 5:85811806-85811828 CCCAGCTAATTTTGTATTTTTGG + Intergenic
993459150 5:88161670-88161692 CCTGGCCAATTTTGTATTTTTGG - Intergenic
993646247 5:90466974-90466996 TCTGGTGAATTTTGTGTTTTTGG - Intronic
993679683 5:90860459-90860481 CCCGGCTAATATTGTATTTTTGG + Intronic
993709098 5:91205784-91205806 CCTGGCTAATTTTGTATTTTTGG - Intergenic
993741012 5:91539703-91539725 GCTGGCTAATATTCCATTGTAGG + Intergenic
993807779 5:92434598-92434620 TCTGGCATATATTGGATTTTGGG - Intergenic
994469146 5:100180146-100180168 AATGTCTAATTTTGAATTTTTGG - Intergenic
995088497 5:108143258-108143280 TCTGAATAATTTTGCATGGTGGG - Intronic
995207242 5:109494817-109494839 CCCGGCTATTTTTGTATTTTTGG + Intergenic
995230391 5:109754838-109754860 CCTGGCTAATTTTGTATTTTTGG - Intronic
995728903 5:115215157-115215179 CCTGGCTATTTTTGTATTTTTGG + Intronic
995988241 5:118206906-118206928 TCTGTTTAATTTTGTATTTGAGG - Intergenic
996082985 5:119275657-119275679 TCCTGCTTCTTTTGCATTTTGGG + Intronic
996305030 5:122037057-122037079 CCTGGCTAATTTTGTATTTTTGG + Intronic
996333954 5:122363155-122363177 CCTGGCTAATGTCGTATTTTTGG + Intronic
996666936 5:126070921-126070943 TCTGGATAATTTTTTTTTTTTGG - Intergenic
996742524 5:126814054-126814076 CCCTGCTAATTTTGTATTTTTGG + Intronic
996932183 5:128903251-128903273 TCTAACTTATTTTGCATATTTGG + Intronic
996955228 5:129175465-129175487 CCTGGCTAATTTTTCATTTTTGG + Intergenic
997328983 5:133045481-133045503 CCCGGCTAATTTTGTATTTTTGG - Intergenic
997333389 5:133084629-133084651 CCTGGCTAATTTTGTATTTTTGG + Intronic
997534484 5:134607609-134607631 CCCAGCTAATTTTGTATTTTTGG - Intronic
997559887 5:134837132-134837154 CCCGGCTAATTTTGTATTTTTGG + Intronic
998223439 5:140306808-140306830 CCCCGCTAATTTTGTATTTTTGG - Intergenic
998296492 5:140974670-140974692 CCTGGCTAATTTTGTATTTTTGG + Intronic
998485556 5:142498928-142498950 CCTGGCTAATTTTGTATTTTTGG + Intergenic
998493170 5:142564653-142564675 TCTGGCTGCTTCTGCTTTTTTGG + Intergenic
998521510 5:142805261-142805283 CCTGGCTAATTTTGTATTTTTGG + Intronic
998720346 5:144939322-144939344 TTTGGCTATTTGTGCTTTTTTGG - Intergenic
998836958 5:146211640-146211662 CCTGGCTAATTTTGTATTTTTGG + Intronic
999409607 5:151339469-151339491 CCTGGCTAATTTTGTATTTTTGG + Intronic
999442024 5:151609233-151609255 CCTGGCTAATTTTGTATTTTTGG - Intergenic
999464464 5:151788936-151788958 CCTGGCTAATTTTGTGTTTTTGG + Intronic
999755537 5:154661641-154661663 TCCGGCTAATTTTGTATTTTTGG - Intergenic
1000618071 5:163451890-163451912 CCTGGCTAATTTTTAATTTTTGG - Exonic
1000678049 5:164146917-164146939 TTAGGCTCATTTTGCATTTGAGG + Intergenic
1000688714 5:164287614-164287636 TCTACCTCATTTTGCAGTTTGGG + Intergenic
1000909654 5:167006825-167006847 CCTGGCTAATTTTGTATTTTTGG + Intergenic
1001575591 5:172761882-172761904 CCTGGCTAATTTTGTATTTTTGG + Intergenic
1002240940 5:177839693-177839715 CTCGGCTAATTTTGTATTTTTGG + Intergenic
1002348044 5:178561612-178561634 TCTGGCTAGTTTTGGGATTTGGG - Intronic
1002652777 5:180714267-180714289 TCAGGTTAATTTTGCATTCCTGG - Intergenic
1002714185 5:181216144-181216166 CCCAGCTAATTTTGTATTTTTGG + Intergenic
1003044216 6:2718017-2718039 CCCAGCTAATTTTGTATTTTTGG - Intronic
1003509523 6:6767952-6767974 CCTAGCTAATTTTGTATTTTTGG + Intergenic
1003710030 6:8579074-8579096 CCTGGCTAATTTTGTATTTTTGG + Intergenic
1003742312 6:8955400-8955422 CCCGGCTAATTTTGTATTTTTGG + Intergenic
1003884870 6:10512593-10512615 CCCAGCTAATTTTGTATTTTTGG + Intronic
1003927770 6:10893157-10893179 TCTGGCTAATTTTGTATTGTTGG + Intronic
1004074552 6:12332938-12332960 CCCGGCTAATTTTGTATTTTTGG + Intergenic
1004118253 6:12792301-12792323 CCCGGCTAATTTTGTATTTTTGG - Intronic
1004166890 6:13264859-13264881 CCTAGCTAATTTTTAATTTTTGG - Intronic
1004220049 6:13738844-13738866 CCTGGCTAATTTTGTATTTTTGG + Intergenic
1004422297 6:15481672-15481694 TCTGGCTATGTTTGCCATTTGGG + Intronic
1004605463 6:17190513-17190535 TCTAGCTAATTTTTAAATTTTGG + Intergenic
1004726936 6:18319971-18319993 CCTGGCTAATTTTGTATTTTTGG + Intergenic
1004903493 6:20214425-20214447 CCTGGCTAATTTTTGTTTTTTGG - Intergenic
1005083887 6:21983783-21983805 CCCGGCCAATTTTGTATTTTTGG + Intergenic
1005300753 6:24468065-24468087 CCCGGCTAATTTTATATTTTTGG + Intronic
1005556960 6:26995627-26995649 CCCAGCTAATTTTGTATTTTTGG - Intergenic
1005609897 6:27513681-27513703 CCCGGCTAATTTTGTATTTTTGG - Intergenic
1005732638 6:28713554-28713576 CCGGGCTAATTTTGTATTTTTGG + Intergenic
1005903518 6:30240395-30240417 CCTGGCTAATTTTTGAATTTTGG - Intergenic
1005961085 6:30693600-30693622 CCCAGCTAATTTTGTATTTTTGG - Intergenic
1006032711 6:31189003-31189025 CTCGGCTAATTTTGTATTTTTGG + Intergenic
1006036348 6:31215854-31215876 CCTGGCTAATTTTGTATTTTTGG + Intergenic
1006053786 6:31365294-31365316 CCTGGCTAATTTTGTGTTTTTGG - Intergenic
1006078611 6:31550848-31550870 CCCGGCTAATTTTGTATTTTTGG + Intronic
1006086997 6:31603108-31603130 CCCAGCTAATTTTGTATTTTTGG + Intergenic
1006205881 6:32342322-32342344 CCCAGCTAATTTTGTATTTTTGG + Intronic
1006350376 6:33516641-33516663 CCTGGCTAATTTCGTCTTTTTGG + Intergenic
1006427222 6:33973418-33973440 TCTGGTAATTTTTGTATTTTTGG - Intergenic
1006470339 6:34225105-34225127 CCTGACTAATTTTGTATTTTTGG + Intergenic
1006631599 6:35434126-35434148 CCCGGCTAATTTTGTATTTTTGG - Intergenic
1006703715 6:35998392-35998414 CCCAGCTAATTTTGTATTTTTGG - Intronic
1006750694 6:36374906-36374928 CCCGGCTAATTTTGTATTTTTGG - Intronic
1006780164 6:36627181-36627203 CCTGGCTAATTTTGTATTTTTGG + Intergenic
1006800781 6:36758408-36758430 TCTGGCTATTTTTTTTTTTTTGG + Intronic
1006824146 6:36921865-36921887 CCTGGCTAATTTTGTAATTTTGG - Intronic
1006828034 6:36950702-36950724 CCCGGCTAATTTTGCGCTTTTGG + Intronic
1006862141 6:37179108-37179130 CCCAGCTAATTTTGTATTTTTGG - Intergenic
1006974831 6:38090012-38090034 CCTGGCTAATTTTGTATTTTTGG + Intronic
1007447248 6:41916416-41916438 CCCGGCTAATTTTGTATTTTTGG - Intronic
1007563961 6:42834013-42834035 CCCAGCTAATTTTGTATTTTTGG + Intronic
1007579578 6:42949324-42949346 CCTGGCTAATTTTTTTTTTTTGG - Intergenic
1007660084 6:43478697-43478719 TGTGTCTACTTTTGCTTTTTTGG + Intronic
1007671467 6:43557932-43557954 CCCAGCTAATTTTGCATTTTTGG - Intronic
1007683965 6:43653851-43653873 CCCTGCTAATTTTGTATTTTTGG + Intronic
1007879946 6:45153707-45153729 ACTGGCTACTTTTGTATTTTTGG - Intronic
1007999416 6:46343105-46343127 TCTGTTTAATTTAGAATTTTAGG - Intronic
1008186351 6:48395792-48395814 TTTGGCTATTTTGGCTTTTTTGG + Intergenic
1008389500 6:50933143-50933165 CCCAGCTAATTTTGTATTTTTGG - Intergenic
1008604417 6:53126332-53126354 TCCAGCTAATTTTTAATTTTTGG + Intergenic
1008979524 6:57466956-57466978 CCTGGCTAATTTTGTATTTTAGG - Intronic
1009167656 6:60359876-60359898 CCTGGCTAATTTTGTATTTTAGG - Intergenic
1009964020 6:70558645-70558667 CCTAGCTAATTTTTTATTTTTGG - Intronic
1010179267 6:73065983-73066005 CCAGGCTAATTTTGTATTTTTGG - Intronic
1010478367 6:76317922-76317944 CCTCACTAATTTTGTATTTTTGG + Intergenic
1011481429 6:87797552-87797574 TCCGGCTAATTTTGTATTTTTGG + Intergenic
1011891913 6:92174502-92174524 TATGACTAATTTTTCTTTTTAGG - Intergenic
1012037468 6:94160990-94161012 TTTGTCTATTTTTGCTTTTTCGG - Intergenic
1012287812 6:97414546-97414568 CCTGGCTAATATTGTATTTCTGG - Intergenic
1012379313 6:98601032-98601054 TCTGCCTGCTTTAGCATTTTTGG - Intergenic
1012840113 6:104319364-104319386 TCTGTCTTATTTTTTATTTTGGG + Intergenic
1013018577 6:106185627-106185649 AAATGCTAATTTTGCATTTTTGG - Exonic
1013204013 6:107930444-107930466 CCTGGCTAATTTTGTATTTTTGG - Intronic
1013256011 6:108386298-108386320 CCCAGCTAATTTTGTATTTTTGG - Intronic
1013553069 6:111228866-111228888 CCCGGCTAATTTTGTATTTTTGG - Intronic
1013778843 6:113708163-113708185 CCAGGCTAATTTTGTATTTTTGG + Intergenic
1013875313 6:114819568-114819590 CCCAGCTAATTTTGTATTTTTGG - Intergenic
1013981740 6:116137916-116137938 CCTGGCTAATTTTGTATTTTTGG - Intronic
1013992823 6:116274400-116274422 CCCGGCTAATTTTGTGTTTTTGG - Intronic
1014308749 6:119772266-119772288 TCTGTCTAATTTTTCATTCAGGG + Intergenic
1014403868 6:121024412-121024434 CCCGGCTAATTTTGTATTTTTGG - Intergenic
1014438833 6:121450382-121450404 CCCAGCTAATTTTGTATTTTTGG - Intergenic
1014439924 6:121462219-121462241 CCTGGCTAATTTTGTATTTTTGG + Intergenic
1014627658 6:123748687-123748709 GCCGGCTAATTTTGTATTTTTGG - Intergenic
1014816693 6:125943420-125943442 CCTGGCTAATTTTGTATTTTTGG - Intergenic
1015156091 6:130097904-130097926 TCCGGCTAATTTTGTATTTTTGG - Intronic
1015676130 6:135751375-135751397 TCTGGTCAATTTTGCCTCTTTGG - Intergenic
1015827506 6:137330215-137330237 CCTGGCTAGTTTTGTACTTTTGG + Intergenic
1015995348 6:138990640-138990662 CCTGGCTATTTTTGTATTTTTGG - Intergenic
1016031379 6:139342136-139342158 CCTGGCTAATTTTGTATTTTTGG + Intergenic
1016110688 6:140219503-140219525 ACTGGGTAATTATGCATTTTAGG - Intergenic
1016821041 6:148346732-148346754 TCTGGCTGAAACTGCATTTTGGG + Intronic
1016826852 6:148396315-148396337 CCTGGCTAATTTTGTGTTTTTGG - Intronic
1017102767 6:150863313-150863335 CCTGGCTAATTTTGTGTTTTTGG - Intergenic
1017497103 6:154992770-154992792 CCCGGCTAATTTTGTATTTTTGG + Intronic
1017704887 6:157113080-157113102 CCCGGCTAATTTTGTGTTTTTGG + Intronic
1017917153 6:158840267-158840289 CCCAGCTAATTTTGTATTTTTGG + Intergenic
1018062738 6:160103357-160103379 TCTGCCCCATTCTGCATTTTGGG - Intronic
1018126972 6:160691339-160691361 CTTGGCTAATTTTTGATTTTTGG + Intergenic
1018160514 6:161037577-161037599 CCCGACTAATTTTGTATTTTTGG + Intronic
1018504541 6:164450680-164450702 CCTGGCTAATTTTGTATTTTGGG + Intergenic
1018829378 6:167431290-167431312 CCCGGCTAATTTTGTATTTTTGG + Intergenic
1018943055 6:168322705-168322727 CCTGGCTATTTTTGTATTTTTGG - Intergenic
1019393148 7:801171-801193 CCCAGCTAATTTTGTATTTTTGG + Intergenic
1019893735 7:3966844-3966866 CCTGGCTAATTTTTCATTTTTGG + Intronic
1019894409 7:3972525-3972547 TCAGGATAATTTTAAATTTTTGG + Intronic
1019940697 7:4287232-4287254 CCTGGCTAATTTTGTATTTTTGG + Intergenic
1019981552 7:4625098-4625120 CCTGGCTAATTTAAGATTTTTGG - Intergenic
1020102083 7:5399543-5399565 CCCGGCTAATTTTGTATTATTGG - Intronic
1020170490 7:5841086-5841108 TGTGACTTATTTTGTATTTTTGG + Intergenic
1020615671 7:10457796-10457818 ATTGCCTAATTTTGCATATTGGG - Intergenic
1020688535 7:11326183-11326205 TCTGCCTAATTGTTCATTTCTGG + Intergenic
1021122467 7:16812794-16812816 TCTGCATAATTTTGCCTATTAGG + Intronic
1021220676 7:17972286-17972308 CCCGGCTAATTTTGTATTTTTGG - Intergenic
1021241520 7:18207873-18207895 CCCGGCTAATTTTGTATTTTTGG + Intronic
1021796542 7:24260388-24260410 TGTAGCTAAATTTGCATTTGGGG + Intergenic
1022390461 7:29939371-29939393 TCTGGCTAATTTTATTTCTTTGG + Intronic
1022623164 7:32005800-32005822 TACTGCTAATTTGGCATTTTTGG + Intronic
1022756127 7:33292386-33292408 CCTGGCTACTTTTGAATTTTTGG + Intronic
1022850357 7:34255503-34255525 CCCGGCTAATTTTGTACTTTTGG + Intergenic
1023395838 7:39751269-39751291 GCCAGCTAATTTTGTATTTTTGG + Intergenic
1023479958 7:40623341-40623363 TCTGGGTAATTTAGTATTATGGG - Intronic
1023701770 7:42899195-42899217 TCCAGCTTATTTTGTATTTTTGG + Intergenic
1023893063 7:44407402-44407424 CCTGGCTAATTTTGTATTTTTGG - Intronic
1023916710 7:44595342-44595364 CCTGGCTATTTTTGTATTTTTGG + Intergenic
1023957737 7:44901075-44901097 CCCAGCTAATTTTGTATTTTTGG - Intergenic
1024129020 7:46331107-46331129 CCCAGCTAATTTTGTATTTTTGG + Intergenic
1024168191 7:46755966-46755988 CCTGGTTAAATTTGAATTTTAGG - Intronic
1024365368 7:48514287-48514309 TCTGTTAAATTTTGCATTGTGGG - Intronic
1024432549 7:49306139-49306161 GCTGGCTAATTTTTCTATTTTGG + Intergenic
1024642066 7:51337617-51337639 CCTGGCTACTTTTGTATTTTTGG - Intergenic
1024653975 7:51433682-51433704 CCCAGCTAATTTTGTATTTTTGG - Intergenic
1024782947 7:52873678-52873700 TGTGGTTAATTTATCATTTTTGG - Intergenic
1024953117 7:54886132-54886154 CCTAGCTAACTTTGTATTTTTGG + Intergenic
1025614870 7:63109392-63109414 TCTGGCTAATTTTGTATTTTTGG - Intergenic
1025946972 7:66112131-66112153 CCTGGCGATTTTTGTATTTTCGG + Intronic
1026002258 7:66569803-66569825 CCTGACTAATTTGGTATTTTTGG + Intergenic
1026055194 7:66977642-66977664 CCCAGCTAATTTTGTATTTTTGG + Intergenic
1026157265 7:67837522-67837544 CCCAGCTAATTTTGTATTTTTGG - Intergenic
1026164689 7:67899549-67899571 CCCGGCTAATTTTGTATTTTTGG + Intergenic
1026225383 7:68435798-68435820 CCCAGCTAATTTTGTATTTTTGG + Intergenic
1026264202 7:68782321-68782343 CCTGGCTAATTTTATATTTTTGG - Intergenic
1026679523 7:72454990-72455012 CCCAGCTAATTTTGTATTTTTGG + Intergenic
1026721551 7:72835675-72835697 CCCAGCTAATTTTGTATTTTTGG + Intergenic
1026722501 7:72844215-72844237 CCCAGCTAATTTTGTATTTTTGG - Intergenic
1026770585 7:73195359-73195381 CCTGGCTAATTTTGTATTTTTGG - Intergenic
1026938603 7:74273474-74273496 TCCAACTAATTTTGTATTTTTGG - Intergenic
1027011451 7:74748748-74748770 CCTGGCTAATTTTGTATTTTTGG - Intronic
1027076589 7:75197294-75197316 CCTGGCTAATTTTGTATTTTTGG + Intergenic
1027140894 7:75656636-75656658 CCTGGCTAATTTTATATTTTTGG + Intronic
1027239240 7:76316559-76316581 CCTGGCTAATTTTGTAATTTTGG + Intergenic
1027469167 7:78552342-78552364 CCTACCTAATTTTGTATTTTTGG + Intronic
1027587647 7:80077751-80077773 CCCAGCTAATTTTGTATTTTTGG - Intergenic
1028145293 7:87314293-87314315 CCTGTCTAATTTTGTATTTTTGG - Intergenic
1028215284 7:88124544-88124566 TCTGGCAATCTTTGCCTTTTAGG + Intronic
1028546509 7:92008204-92008226 CCCGGCTAATTTTTTATTTTTGG - Intronic
1028653277 7:93174209-93174231 CCTGGCTAATTTTGTATTTTTGG - Intergenic
1028698693 7:93749886-93749908 TCTGTCTAAATTTGTATTTTAGG - Intronic
1028957157 7:96706399-96706421 CCCGGCTAATTTTGTATTTTTGG - Intronic
1028986370 7:97012303-97012325 TTTGGTTAATTTTCAATTTTAGG - Intergenic
1029138919 7:98395867-98395889 CCCGGCTAATTTTTTATTTTTGG - Intronic
1029264052 7:99324992-99325014 CCTGGCTAATTTTTATTTTTTGG - Intergenic
1029292185 7:99510603-99510625 CCAGGCTAACTTTGTATTTTTGG + Intronic
1029421640 7:100474960-100474982 ACTGGCTAATTTTTTATTTTTGG + Intronic
1029471401 7:100756927-100756949 CCCAGCTAATTTTGTATTTTTGG + Intronic
1029571520 7:101372832-101372854 CCTGGCTAATTTTTTATTTTTGG - Intronic
1029624788 7:101713925-101713947 CCTGGCTAATTTTATACTTTCGG + Intergenic
1029682483 7:102121326-102121348 CCTGGCTAATTTTTGCTTTTTGG + Intronic
1029692471 7:102191392-102191414 CCGGGCTAATTTTGTATTTTTGG + Intronic
1030050953 7:105537289-105537311 CCCAGCTAATTTTGTATTTTAGG + Intronic
1030051238 7:105539519-105539541 CTCGGCTAATTTTGTATTTTTGG + Intronic
1030131197 7:106201978-106202000 TTTGGCTAAGTTTTCTTTTTTGG + Intergenic
1030192712 7:106825457-106825479 TCCGGCTAATTTTGTATTTTTGG + Intergenic
1030628346 7:111868547-111868569 CCTGGCCAGTTTTGTATTTTTGG - Intronic
1030819475 7:114078331-114078353 CCCAGCTAATTTTGTATTTTTGG - Intergenic
1030914763 7:115298505-115298527 TCTGGCTATTTTCGGATTTGTGG + Intergenic
1031867303 7:127051602-127051624 TTTGGATAATTTTTCATTGTTGG - Intronic
1032026977 7:128450848-128450870 CCTGGCTAATTTTGTCTTTTTGG + Intergenic
1032157310 7:129479111-129479133 CCTAGCTAATTTTGTATTTTTGG - Intronic
1032413478 7:131717947-131717969 CCTGGATAATTTTGTATTTTTGG + Intergenic
1032536781 7:132671161-132671183 TGTGGCCAGATTTGCATTTTTGG + Intronic
1033064391 7:138140137-138140159 TCTGGCTAATTTTTTTTTTGAGG + Intergenic
1033212378 7:139469603-139469625 TCCCGCTAATTTTGTATTTTTGG + Intronic
1033337649 7:140467136-140467158 CTTGGGTAATTTTGTATTTTTGG + Intronic
1033378608 7:140789889-140789911 CCCGGCTAATTTTTTATTTTTGG + Intronic
1033395506 7:140970345-140970367 CCCGGCTAATTTTGTATTTTTGG - Intergenic
1033421788 7:141210301-141210323 TCCAGCTAATTTTGTATTTTTGG - Intronic
1033451035 7:141462610-141462632 TCTTGCTAATTTTAGTTTTTTGG - Intronic
1033677878 7:143561665-143561687 CCTGGCTAATTTTCCTGTTTTGG - Intergenic
1034179172 7:149124700-149124722 CCAGGCTAATTTTGTATTTTTGG + Intronic
1034431750 7:151044581-151044603 TCCGGCTAATTTTTTTTTTTTGG - Intronic
1034761251 7:153674106-153674128 TCCAGCTAATTTTGTATTTTTGG + Intergenic
1035027875 7:155837702-155837724 CCTGGCTAATTTTGTATTTTTGG + Intergenic
1035103189 7:156417916-156417938 CCCAGCTAATTTTGTATTTTTGG - Intergenic
1035409899 7:158631141-158631163 CCCAGCTAATTTTGTATTTTTGG + Intergenic
1035477573 7:159154189-159154211 TCTGGAAACTTTTGAATTTTTGG - Intergenic
1035595769 8:856347-856369 CCTGGCTAATTTTGTATTTTTGG + Intergenic
1035997224 8:4561519-4561541 GCTGGCTAATTTTTCTGTTTTGG - Intronic
1036110591 8:5896608-5896630 TTTTCCTAATTTTGCATTCTTGG - Intergenic
1036535746 8:9650051-9650073 CCTGGCTAATTTTGTATTTTTGG + Intronic
1036708652 8:11063335-11063357 CCTGGCTAATTTTGTTTTGTGGG - Intronic
1036796720 8:11761434-11761456 CCCGGCTAATTTTGTATTTTTGG - Exonic
1036836961 8:12079727-12079749 CCCAGCTAATTTTGTATTTTTGG - Intergenic
1036858754 8:12325973-12325995 CCCAGCTAATTTTGTATTTTTGG - Intergenic
1037740600 8:21606049-21606071 CCTGGCAAATTTTGTATTTTTGG + Intergenic
1037785992 8:21903604-21903626 CTCGGCTAATTTTGTATTTTTGG - Intergenic
1037863867 8:22427129-22427151 CCCGGCTAATTTTGTATTTTTGG - Intronic
1038001857 8:23398807-23398829 CCTGGCTAATTTTTTTTTTTTGG + Intronic
1038019701 8:23542538-23542560 CACGGCTAATTTTGTATTTTTGG + Intronic
1038187612 8:25289679-25289701 CCCAGCTAATTTTGTATTTTTGG - Intronic
1038435815 8:27535334-27535356 CCCGGCTAATTTTGTATTTTTGG + Intronic
1038459806 8:27706312-27706334 CCCAGCTAATTTTGTATTTTTGG + Intergenic
1038547834 8:28439585-28439607 TCTGGCTAATTGTGGTTTTTGGG - Intronic
1038752228 8:30306085-30306107 CCTGGCTAATTTTGTATTTTTGG + Intergenic
1038793788 8:30692355-30692377 CCCAGCTAATTTTGTATTTTTGG + Intronic
1039041901 8:33416414-33416436 TCTGGCTAATTTTTGTATTTTGG - Intronic
1039061508 8:33575363-33575385 CCTGGCTATTTTTTTATTTTAGG - Intergenic
1039199774 8:35077703-35077725 CTAGGCTAATTTTGTATTTTTGG + Intergenic
1039470641 8:37811635-37811657 CCTGGCTAATTTTGTATTTTTGG + Intronic
1039529111 8:38243962-38243984 CCTGGCTAATTTTGTATTTTTGG + Intronic
1039653259 8:39367907-39367929 TCTCTATAAATTTGCATTTTGGG - Intergenic
1039726363 8:40221051-40221073 CCTGGCTAATTTTTTTTTTTTGG - Intergenic
1039749895 8:40468625-40468647 TTTGTCTATTTTTGCTTTTTGGG - Intergenic
1039772829 8:40705231-40705253 TCTGGCTAATTTCTCCCTTTTGG - Intronic
1039837940 8:41271801-41271823 CCTGGCTAATTTTTTTTTTTTGG - Intronic
1039998196 8:42553489-42553511 TCTGGTTACTGCTGCATTTTTGG + Exonic
1040903074 8:52437415-52437437 TCTGTGTCATTTTGCCTTTTGGG + Intronic
1041062890 8:54053253-54053275 CCCGGCTAATTTTGTATTTTTGG + Intronic
1041141319 8:54822791-54822813 TTTGGCTAATTCACCATTTTGGG - Intergenic
1041232473 8:55767774-55767796 CCCGGCTAATTTTGTATTTTTGG - Intronic
1041242185 8:55857509-55857531 GTTGGCTAATTTTTCTTTTTTGG + Intergenic
1041329226 8:56705707-56705729 TCTGGCTCATTTTTTCTTTTAGG + Intergenic
1041682307 8:60605716-60605738 TTTGGCCAATTTTTCGTTTTTGG + Intronic
1042403889 8:68381327-68381349 TATGGCTAGTATTGTATTTTCGG + Intronic
1042429241 8:68685713-68685735 CCTGGCTAATTTTTGCTTTTGGG - Intronic
1042459061 8:69041206-69041228 CCTGGCTAATTTTGTATTTTTGG + Intergenic
1042500940 8:69508264-69508286 CCCAGCTAATTTTGTATTTTTGG + Intronic
1042565577 8:70106530-70106552 CCCCGCTAATTTTGTATTTTTGG - Intergenic
1042607333 8:70558570-70558592 CCCGGCTAATTTTTTATTTTTGG + Intergenic
1043054358 8:75418886-75418908 CTTGGCTAATTTTGTATTTTTGG + Intronic
1043248146 8:78032774-78032796 TCAGCCTAATTTTGAAGTTTAGG - Intergenic
1043668236 8:82845487-82845509 TCTCACTAATTTTGCAATGTAGG + Intergenic
1043852394 8:85229643-85229665 TCTAACTAATTTTGTATTTTTGG - Intronic
1044671331 8:94684006-94684028 CCCAGCTAATTTTGTATTTTTGG + Intronic
1044913642 8:97089080-97089102 CCTGGCTAATTTTGTATTTTTGG - Intronic
1044989454 8:97782597-97782619 CCTGGCTAATTTTTTATTTTTGG + Intronic
1045033585 8:98160598-98160620 CCTGGCTAATTTTGTATTTTTGG - Intergenic
1045078639 8:98599808-98599830 CCTGGCTAATTTTTGTTTTTTGG - Intronic
1045360176 8:101425601-101425623 CTCGGCTAATTTTGTATTTTTGG - Intergenic
1045542860 8:103103104-103103126 CCCGGCTAATTTTGTATTTTTGG + Intergenic
1046566971 8:115914298-115914320 ACTGGCTAATTTTTCTATTTTGG + Intergenic
1046581536 8:116099105-116099127 CCTGGCTAATTTTTCCTTTTGGG - Intergenic
1046752373 8:117939406-117939428 CCCTGCTAATTTTGTATTTTTGG - Intronic
1046824431 8:118671579-118671601 TCTGGCTAATTTTTGTATTTTGG + Intergenic
1046943723 8:119955625-119955647 CCCAGCTAATTTTGTATTTTGGG + Intronic
1047140565 8:122134313-122134335 CCTAGCTAATTTTGGATTTTTGG - Intergenic
1047275084 8:123399691-123399713 CCCAGCTAATTTTGTATTTTTGG - Intronic
1047373665 8:124276607-124276629 CCTGGATATTTTTGTATTTTTGG + Intergenic
1047472085 8:125185465-125185487 CCCAGCTAATTTTGTATTTTTGG + Intronic
1047755468 8:127914984-127915006 CCCGGCTAATTTTGTATTTTTGG + Intergenic
1047818815 8:128495552-128495574 CCCAGCTAATTTTGTATTTTTGG + Intergenic
1048265942 8:132986257-132986279 TATGTATAATGTTGCATTTTTGG + Intronic
1048570370 8:135649485-135649507 TCAGGCTAATTTTGGCTATTAGG - Intronic
1049137032 8:140912080-140912102 CCTGGCTAATTTTAAAATTTTGG - Intronic
1049494889 8:142925141-142925163 CCAGGCTAATTTTTAATTTTTGG - Intergenic
1049524447 8:143115365-143115387 CCCAGCTAATTTTGTATTTTTGG + Intergenic
1049829751 8:144692918-144692940 CCTGGCTAATTTTGTATTTTTGG + Intergenic
1050090075 9:2009660-2009682 CCCGGCTGATTTTGTATTTTTGG + Intergenic
1050106083 9:2168170-2168192 CCTGGCTAATTTTGTATTTTTGG + Intronic
1050345461 9:4681481-4681503 CCAGGCTGATTTTGTATTTTTGG - Intronic
1050677836 9:8076428-8076450 TCTAGATAATTTTGCAAGTTTGG - Intergenic
1050779999 9:9321392-9321414 CCCGGCTGATTTTGCATTTCTGG - Intronic
1051565710 9:18495559-18495581 TCTGGCAAATTTTGCAGTTTTGG - Intronic
1051623833 9:19079390-19079412 CCTGGCTAATTGTGTCTTTTTGG + Intronic
1051973695 9:22922790-22922812 TCTGGCTATCTTTGGCTTTTGGG - Intergenic
1052127789 9:24799416-24799438 CCTGGCTAATTTTGTATTTTTGG - Intergenic
1052174819 9:25445875-25445897 CCCGGCTAATTTTGTATTTTTGG - Intergenic
1053227544 9:36373850-36373872 CCCGGCTAATTTTGTATTTTTGG + Intronic
1053357636 9:37460274-37460296 CCCGGCTAATTTTTTATTTTTGG - Intronic
1053419108 9:37965734-37965756 CCCAGCTAATTTTGTATTTTGGG + Intronic
1053439078 9:38099957-38099979 TCTAGGAAATTTTCCATTTTAGG - Intergenic
1053709232 9:40788451-40788473 CCCGGCTAATTTTGTATTTTTGG - Intergenic
1054419141 9:64909248-64909270 CCCGGCTAATTTTGTATTTTTGG - Intergenic
1054715895 9:68557479-68557501 CCTGGCTAATTTTTGAATTTTGG - Intergenic
1054989609 9:71308129-71308151 CCTGGCTAATTTTGTATTTTTGG + Intronic
1055107586 9:72528493-72528515 CCTGGCGAATTTTGTATTTTTGG + Intronic
1055333617 9:75209199-75209221 CCTGGCTAATTTTGTATTTTTGG + Intergenic
1055503301 9:76923333-76923355 TCCAGCTAATTTTTTATTTTTGG - Intergenic
1055554444 9:77460700-77460722 TCTGGCTAAAGATGCTTTTTTGG - Intronic
1055639536 9:78308792-78308814 CCTGGATAATTTTGTATTTTTGG - Intronic
1055950593 9:81726215-81726237 CCCAGCTAATTTTGTATTTTTGG + Intergenic
1056104137 9:83330201-83330223 CCGGGCTAATTTTGTATTTTTGG - Intronic
1056654552 9:88498340-88498362 CCCAGCTAATTTTGTATTTTTGG - Intergenic
1056654856 9:88500922-88500944 TCCAGCTAATTTTGCATTTTTGG + Intergenic
1057164744 9:92916704-92916726 CCTGGCTAATTTTGTATTTTTGG - Intergenic
1057444179 9:95102591-95102613 TCTGGCTAATTAAACATTTGCGG - Intronic
1057742868 9:97727215-97727237 CCCGGTTAATTTTGTATTTTTGG - Intergenic
1058234437 9:102471479-102471501 CCTTGCTAATTGTGTATTTTGGG - Intergenic
1058451391 9:105099686-105099708 CCCCGCTAATTTTGTATTTTTGG - Intergenic
1058468005 9:105247456-105247478 TCTGGCTAATTTTGTATTTTTGG + Intronic
1058468923 9:105257255-105257277 CCTGGCTAATTTTGTATTTCTGG + Intronic
1058662135 9:107276220-107276242 CCCGGCTAATTTTGTATTTTTGG + Intergenic
1058903867 9:109465412-109465434 CCTGGCTAGTTTTGTATGTTTGG - Intronic
1059132926 9:111773471-111773493 CCCAGCTAATTTTGTATTTTTGG + Intronic
1059154421 9:111977234-111977256 CCTGGCTAATTTTCTTTTTTTGG - Intergenic
1059412860 9:114144180-114144202 CCTGGCTAATTTTGTATTTTTGG + Intergenic
1060272421 9:122155238-122155260 CCCGGCTAATTTTGTATTTTTGG + Intronic
1060361820 9:122966361-122966383 ACCGGCTAATTTTGTATTTTTGG - Intronic
1060592339 9:124825795-124825817 CCTGGCTAATTTTGGTATTTTGG + Intergenic
1060647755 9:125296513-125296535 CCCGGCTAATTTTGTGTTTTTGG + Intronic
1061120485 9:128639235-128639257 CCCGGCTAATTTTGTATTTTTGG - Intronic
1061174383 9:128984285-128984307 CCCCGGTAATTTTGCATTTTTGG + Intronic
1061264993 9:129499733-129499755 CCCGGCCAATTTTGTATTTTTGG + Intergenic
1061428486 9:130516207-130516229 GCTGGCTAATTTTGTATTTTTGG - Intergenic
1061523088 9:131133463-131133485 CCTGGCTAATTTTTTTTTTTTGG + Intronic
1061525685 9:131159694-131159716 CCCGGCTAATTTTGTGTTTTTGG - Intronic
1061711554 9:132491304-132491326 CCCAGCTAATTTTGTATTTTTGG - Intronic
1062322956 9:135999291-135999313 CCCGGCTAATTTTGTATCTTTGG + Intergenic
1062535532 9:137019581-137019603 CCTGGCTAATTTTGTATTTTTGG + Intronic
1203465132 Un_GL000220v1:79113-79135 CCTGGAAAATTTTGTATTTTTGG + Intergenic
1185561431 X:1063206-1063228 CCCGGCTAGTTTTGTATTTTTGG - Intergenic
1185741419 X:2535990-2536012 CCTGGCTAATTTTGTATTTTTGG + Intergenic
1185817326 X:3168395-3168417 ACAGGCTAATTTTATATTTTAGG + Intergenic
1185887543 X:3796389-3796411 CCTGGCTAATTTCAAATTTTTGG - Intergenic
1186326008 X:8477314-8477336 CCCAGCTAATTTTGTATTTTTGG - Intergenic
1186419794 X:9416253-9416275 TCTGGCAAATATTTCATTTGTGG - Intergenic
1186422120 X:9434734-9434756 TCCGGCTAATTTTGTGTTTTTGG + Intergenic
1186575458 X:10760659-10760681 TCCAGCTAATTTTTTATTTTTGG - Intronic
1186713003 X:12219978-12220000 CCAGGCTAATTTTGTATTTTTGG - Intronic
1186739814 X:12505564-12505586 CCTGGCTAATTTTGTATTTTTGG - Intronic
1186923643 X:14308532-14308554 CCCAGCTAATTTTGTATTTTTGG + Intergenic
1186931631 X:14397627-14397649 CCCAGCTAATTTTGTATTTTTGG + Intergenic
1187084891 X:16031841-16031863 CCCGGCTAATTTTGTATTTTTGG - Intergenic
1187131782 X:16509884-16509906 CCTGGCTTATTTTGTATTTTTGG - Intergenic
1187421080 X:19134231-19134253 TCCAGCTAATTTTTTATTTTTGG - Intergenic
1187889482 X:23920728-23920750 CCCGGCTAATTTTGTATTTTAGG - Intronic
1188182965 X:27077977-27077999 TATGGCTAATTTTGGATTATTGG - Intergenic
1188482122 X:30646927-30646949 CCTGGCTAATTTTTTTTTTTGGG - Intergenic
1188680380 X:32996654-32996676 CCTGGCTAATTTTTTATTTTTGG - Intronic
1188909062 X:35823266-35823288 CCTGGCTAATTTTGTGTTTTTGG + Intergenic
1189014399 X:37081034-37081056 TCTGGCTAATTATCTATTTTAGG + Intergenic
1189153914 X:38735635-38735657 CCTGGCTAATTTTTTATTTTCGG - Intergenic
1189253363 X:39618785-39618807 CCTGGCTAATTTTGTATTTTTGG + Intergenic
1189345601 X:40238963-40238985 CCCAGCTAATTTTGCATTTTAGG + Intergenic
1189493268 X:41486530-41486552 CCGGGCTAATTTTGTATTTTTGG - Intergenic
1190080574 X:47354201-47354223 CCTGGCTAATTTTTAATTTTTGG + Intergenic
1190238205 X:48633590-48633612 CCCGGCTAATTTTGTATTTTCGG + Intergenic
1190630183 X:52378631-52378653 TCTGGCTCATTTTCCTTTCTAGG + Intergenic
1190839559 X:54131597-54131619 CCCGGCTAATTTTGTATTTTGGG + Intronic
1190847208 X:54205052-54205074 GCCAGCTAATTTTGTATTTTTGG - Intronic
1190990074 X:55538286-55538308 TCTTTCTCATTTTGCATTTAAGG + Intergenic
1191112817 X:56821087-56821109 CCCAGCTAATTTTGTATTTTTGG + Intergenic
1191640071 X:63421944-63421966 CCCAGCTAATTTTGTATTTTTGG + Intergenic
1191857856 X:65641971-65641993 CCCAGCTAATTTTGTATTTTTGG - Intronic
1192353576 X:70378565-70378587 CCCAGCTAATTTTGTATTTTTGG - Intronic
1192378666 X:70590908-70590930 CCTGGCTAACTTTGTATTTTTGG + Intronic
1192396960 X:70791962-70791984 CCCGGCTAATTTTGCATTTTTGG - Intronic
1192414216 X:70963621-70963643 TCTTCCTAATTTGGCATTTGAGG + Intergenic
1192788735 X:74358959-74358981 CCCAGCTAATTTTGTATTTTTGG + Intergenic
1193126571 X:77876850-77876872 CCTGGCTAATTTTGTATTTTTGG - Intronic
1193192929 X:78594278-78594300 TATAGCTACTCTTGCATTTTTGG + Intergenic
1193755050 X:85398485-85398507 TCTGGCTAATTTTTGTATTTTGG - Intergenic
1194019791 X:88673538-88673560 CCCAGCTAATTTTGTATTTTTGG - Intergenic
1194070018 X:89310962-89310984 TGTGGCTACATATGCATTTTAGG + Intergenic
1194270636 X:91810301-91810323 TCTGAATAATTTTAGATTTTGGG - Intronic
1194656274 X:96577700-96577722 TCTGGAAGATCTTGCATTTTTGG - Intergenic
1194686879 X:96930437-96930459 TCTGCCCACTTTTGCAATTTGGG + Intronic
1194895355 X:99433037-99433059 TATGGCCAATTTCGCCTTTTTGG + Intergenic
1195028428 X:100901836-100901858 CCTGGCTAATTTTGTATTTTTGG - Intergenic
1195076542 X:101332331-101332353 CCCAGCTAATTTTGTATTTTTGG - Intergenic
1195257015 X:103100957-103100979 TGTGGCTAATTTTTTTTTTTAGG + Intergenic
1195443514 X:104923510-104923532 TCTGGCATATTTTTCATTTAAGG - Intronic
1195529171 X:105932098-105932120 TCTGGCTTATTTCACTTTTTAGG + Intronic
1195549322 X:106149353-106149375 TCTGGGTTATTTTCAATTTTTGG - Intergenic
1195550339 X:106162162-106162184 TCTGGGAAATTTTGAATCTTGGG + Intergenic
1195690152 X:107617577-107617599 CCCGGCTAATTTTGTATTTTTGG - Intergenic
1195739409 X:108048162-108048184 CCCGGCTAATTTTGTATTTTTGG + Intronic
1196009403 X:110871105-110871127 TCTGCCTACCTTTGTATTTTGGG - Intergenic
1196078309 X:111602046-111602068 TCTGGGTAGTTTTGACTTTTTGG + Intergenic
1196421218 X:115523659-115523681 TGTTGCTCATTTTGTATTTTTGG - Intergenic
1196537642 X:116866608-116866630 CCCAGCTAATTTTGTATTTTTGG + Intergenic
1196868907 X:120094764-120094786 TCAGCCTAAATTAGCATTTTTGG - Intergenic
1196923916 X:120613085-120613107 CCCGGCTAATTTTGTATTTTTGG + Intronic
1197211151 X:123829107-123829129 CCTGGCTAATTTTGTATTTTTGG - Intergenic
1197295444 X:124713427-124713449 CCCGGCTAATTTTGTATTTTTGG + Intronic
1197610424 X:128632218-128632240 TCTGGCTAAATTTTCAGTTCTGG + Intergenic
1197657543 X:129133594-129133616 CCTGGCTAATTTTGTATTTTTGG + Intergenic
1197773912 X:130108045-130108067 CCCGGCTAATTTTGTATTTTTGG - Intronic
1197778632 X:130137899-130137921 CCTGGCTAATTTTGTATTTTTGG - Intronic
1197840741 X:130743630-130743652 CCTGGCTAATTTTTTTTTTTTGG + Intronic
1197934097 X:131723051-131723073 CCCGGCTAATTTTGTATTTTTGG - Intergenic
1197934136 X:131723362-131723384 CCAGGCTAATTTTGTATTTTTGG + Intergenic
1198055563 X:132991350-132991372 CCTGGATAATTTTTAATTTTTGG - Intergenic
1198173838 X:134135037-134135059 CCCAGCTAATTTTGTATTTTTGG + Intergenic
1198244520 X:134817011-134817033 TCCAACTAATTTTGTATTTTTGG - Intronic
1198339857 X:135703020-135703042 CCCGGCTCATTTTGTATTTTGGG - Intergenic
1198458406 X:136839714-136839736 CCCGGCTAATTTTGTATTTTAGG + Intergenic
1198584087 X:138100286-138100308 TCTGTCTAATGCTGCATTTGGGG - Intergenic
1198588617 X:138150350-138150372 TCTGGCTAATTTCTCCATTTTGG + Intergenic
1198689824 X:139268719-139268741 CCTGGCTAATTTTTTATTTTTGG + Intergenic
1198940310 X:141947360-141947382 CCTGGCTAGTTTTGTACTTTTGG - Intergenic
1198944516 X:141995727-141995749 CCTGACTAATTTTGTATTTTGGG - Intergenic
1199197278 X:145046163-145046185 CCTGGCTATTTTTGTATGTTTGG - Intergenic
1199326459 X:146504060-146504082 TCTGCCTAATTTGGTATTCTGGG + Intergenic
1199372923 X:147072819-147072841 TCTCACTTATTTTGCATTTTGGG + Intergenic
1199752749 X:150836486-150836508 CCCAGCTAATTTTGTATTTTTGG + Intronic
1199808033 X:151320907-151320929 CCCGGCTAATTTTGTATTTTTGG + Intergenic
1200387648 X:155908978-155909000 CCTGGCTAATTTTTGTTTTTTGG + Intronic
1200410270 Y:2853990-2854012 CCGGGCTAATTTTGTATTTTTGG + Intronic
1200438144 Y:3178189-3178211 TCTGAGGAATTTTGTATTTTTGG + Intergenic
1200587869 Y:5031734-5031756 TCTGAATAATTTTAGATTTTGGG - Intronic
1200656025 Y:5902779-5902801 CCTGGCTAAATTTGTATTTTTGG + Intergenic
1200774816 Y:7160697-7160719 CCTGGCTAATTTCAAATTTTTGG + Intergenic
1200878872 Y:8190567-8190589 TCCAGCTAATTTTGTATTTTTGG + Intergenic
1201009792 Y:9539581-9539603 TCTGGTAATTTTTGTATTTTTGG - Intergenic
1201057305 Y:10008085-10008107 TCTGGGTAATTTTCTATTTTTGG + Intergenic
1201187220 Y:11416148-11416170 CCTGGCTAATTTTGTATTTTAGG + Intergenic
1201435898 Y:13958327-13958349 CCTGGCTAATTTTGTATTTTTGG + Intergenic
1201492787 Y:14560807-14560829 TCTGCCTAAGCTTTCATTTTGGG + Intronic
1201508655 Y:14733588-14733610 TCTTGTTTATTTTGCATGTTGGG - Intronic
1201691531 Y:16771515-16771537 CCTGGCTAATTTTGTATGTTTGG + Intergenic
1201773561 Y:17641670-17641692 CCTAGCTAATTTTGTATTTTTGG + Intergenic
1201786465 Y:17787497-17787519 TCTGGCTAATTTTGTATTTCTGG - Intergenic
1201815088 Y:18118491-18118513 TCTGGCTAATTTTGTATTTCTGG + Intergenic
1201827994 Y:18264316-18264338 CCTAGCTAATTTTGTATTTTTGG - Intergenic
1201851540 Y:18488229-18488251 TGTGGCTAATTTTGTATTTTTGG + Intergenic
1201881780 Y:18832151-18832173 TGTGGCTAATTTTGTATTTTTGG - Intergenic
1201894470 Y:18978921-18978943 TCTGGCGAGTTTTGCATATTAGG - Intergenic
1201988834 Y:20002060-20002082 TCTTGCTATTTTTGAATTCTTGG + Intergenic
1202329996 Y:23739341-23739363 CCTGGCTAATTTTGTATTTTTGG - Intergenic
1202347076 Y:23942752-23942774 CCTGGTTAATTCTGTATTTTTGG - Intergenic
1202523695 Y:25727338-25727360 CCTGGTTAATTCTGTATTTTTGG + Intergenic
1202540774 Y:25930713-25930735 CCTGGCTAATTTTGTATTTTTGG + Intergenic