ID: 1133289435

View in Genome Browser
Species Human (GRCh38)
Location 16:4709261-4709283
Sequence CAGGCATGTGCCACCACGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291235
Summary {0: 179, 1: 4914, 2: 27317, 3: 82543, 4: 176282}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133289435_1133289439 -2 Left 1133289435 16:4709261-4709283 CCAGACGTGGTGGCACATGCCTG 0: 179
1: 4914
2: 27317
3: 82543
4: 176282
Right 1133289439 16:4709282-4709304 TGTAATCCCAGCTACTAGGGAGG 0: 4457
1: 105533
2: 254011
3: 236169
4: 467796
1133289435_1133289436 -6 Left 1133289435 16:4709261-4709283 CCAGACGTGGTGGCACATGCCTG 0: 179
1: 4914
2: 27317
3: 82543
4: 176282
Right 1133289436 16:4709278-4709300 TGCCTGTAATCCCAGCTACTAGG 0: 52453
1: 101789
2: 153905
3: 227834
4: 315316
1133289435_1133289446 30 Left 1133289435 16:4709261-4709283 CCAGACGTGGTGGCACATGCCTG 0: 179
1: 4914
2: 27317
3: 82543
4: 176282
Right 1133289446 16:4709314-4709336 GAGAATCGCTTGAACCCGGGAGG 0: 18679
1: 97986
2: 210130
3: 185373
4: 111476
1133289435_1133289444 26 Left 1133289435 16:4709261-4709283 CCAGACGTGGTGGCACATGCCTG 0: 179
1: 4914
2: 27317
3: 82543
4: 176282
Right 1133289444 16:4709310-4709332 GCAGGAGAATCGCTTGAACCCGG 0: 41236
1: 112059
2: 146946
3: 86404
4: 46144
1133289435_1133289445 27 Left 1133289435 16:4709261-4709283 CCAGACGTGGTGGCACATGCCTG 0: 179
1: 4914
2: 27317
3: 82543
4: 176282
Right 1133289445 16:4709311-4709333 CAGGAGAATCGCTTGAACCCGGG 0: 41137
1: 134699
2: 211581
3: 171799
4: 128801
1133289435_1133289443 8 Left 1133289435 16:4709261-4709283 CCAGACGTGGTGGCACATGCCTG 0: 179
1: 4914
2: 27317
3: 82543
4: 176282
Right 1133289443 16:4709292-4709314 GCTACTAGGGAGGCTGAGGCAGG 0: 6336
1: 175987
2: 235818
3: 172632
4: 171596
1133289435_1133289441 4 Left 1133289435 16:4709261-4709283 CCAGACGTGGTGGCACATGCCTG 0: 179
1: 4914
2: 27317
3: 82543
4: 176282
Right 1133289441 16:4709288-4709310 CCCAGCTACTAGGGAGGCTGAGG 0: 7518
1: 202677
2: 272816
3: 187311
4: 194142
1133289435_1133289437 -5 Left 1133289435 16:4709261-4709283 CCAGACGTGGTGGCACATGCCTG 0: 179
1: 4914
2: 27317
3: 82543
4: 176282
Right 1133289437 16:4709279-4709301 GCCTGTAATCCCAGCTACTAGGG 0: 3551
1: 119062
2: 256286
3: 228049
4: 381809

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133289435 Original CRISPR CAGGCATGTGCCACCACGTC TGG (reversed) Intronic
Too many off-targets to display for this crispr