ID: 1133289436

View in Genome Browser
Species Human (GRCh38)
Location 16:4709278-4709300
Sequence TGCCTGTAATCCCAGCTACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 851297
Summary {0: 52453, 1: 101789, 2: 153905, 3: 227834, 4: 315316}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133289430_1133289436 22 Left 1133289430 16:4709233-4709255 CCTGTCTCTCCCAAAAATGCAAA 0: 3
1: 201
2: 11536
3: 190954
4: 221603
Right 1133289436 16:4709278-4709300 TGCCTGTAATCCCAGCTACTAGG 0: 52453
1: 101789
2: 153905
3: 227834
4: 315316
1133289435_1133289436 -6 Left 1133289435 16:4709261-4709283 CCAGACGTGGTGGCACATGCCTG 0: 179
1: 4914
2: 27317
3: 82543
4: 176282
Right 1133289436 16:4709278-4709300 TGCCTGTAATCCCAGCTACTAGG 0: 52453
1: 101789
2: 153905
3: 227834
4: 315316
1133289431_1133289436 13 Left 1133289431 16:4709242-4709264 CCCAAAAATGCAAAATTAGCCAG 0: 4
1: 90
2: 158
3: 472
4: 3611
Right 1133289436 16:4709278-4709300 TGCCTGTAATCCCAGCTACTAGG 0: 52453
1: 101789
2: 153905
3: 227834
4: 315316
1133289432_1133289436 12 Left 1133289432 16:4709243-4709265 CCAAAAATGCAAAATTAGCCAGA 0: 1
1: 19
2: 289
3: 443
4: 909
Right 1133289436 16:4709278-4709300 TGCCTGTAATCCCAGCTACTAGG 0: 52453
1: 101789
2: 153905
3: 227834
4: 315316
1133289429_1133289436 23 Left 1133289429 16:4709232-4709254 CCCTGTCTCTCCCAAAAATGCAA 0: 2
1: 102
2: 5455
3: 79857
4: 178198
Right 1133289436 16:4709278-4709300 TGCCTGTAATCCCAGCTACTAGG 0: 52453
1: 101789
2: 153905
3: 227834
4: 315316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133289436 Original CRISPR TGCCTGTAATCCCAGCTACT AGG Intronic
Too many off-targets to display for this crispr