ID: 1133289441

View in Genome Browser
Species Human (GRCh38)
Location 16:4709288-4709310
Sequence CCCAGCTACTAGGGAGGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 864464
Summary {0: 7518, 1: 202677, 2: 272816, 3: 187311, 4: 194142}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133289435_1133289441 4 Left 1133289435 16:4709261-4709283 CCAGACGTGGTGGCACATGCCTG 0: 179
1: 4914
2: 27317
3: 82543
4: 176282
Right 1133289441 16:4709288-4709310 CCCAGCTACTAGGGAGGCTGAGG 0: 7518
1: 202677
2: 272816
3: 187311
4: 194142
1133289432_1133289441 22 Left 1133289432 16:4709243-4709265 CCAAAAATGCAAAATTAGCCAGA 0: 1
1: 19
2: 289
3: 443
4: 909
Right 1133289441 16:4709288-4709310 CCCAGCTACTAGGGAGGCTGAGG 0: 7518
1: 202677
2: 272816
3: 187311
4: 194142
1133289431_1133289441 23 Left 1133289431 16:4709242-4709264 CCCAAAAATGCAAAATTAGCCAG 0: 4
1: 90
2: 158
3: 472
4: 3611
Right 1133289441 16:4709288-4709310 CCCAGCTACTAGGGAGGCTGAGG 0: 7518
1: 202677
2: 272816
3: 187311
4: 194142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133289441 Original CRISPR CCCAGCTACTAGGGAGGCTG AGG Intronic
Too many off-targets to display for this crispr