ID: 1133289443

View in Genome Browser
Species Human (GRCh38)
Location 16:4709292-4709314
Sequence GCTACTAGGGAGGCTGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 762369
Summary {0: 6336, 1: 175987, 2: 235818, 3: 172632, 4: 171596}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133289435_1133289443 8 Left 1133289435 16:4709261-4709283 CCAGACGTGGTGGCACATGCCTG 0: 179
1: 4914
2: 27317
3: 82543
4: 176282
Right 1133289443 16:4709292-4709314 GCTACTAGGGAGGCTGAGGCAGG 0: 6336
1: 175987
2: 235818
3: 172632
4: 171596
1133289432_1133289443 26 Left 1133289432 16:4709243-4709265 CCAAAAATGCAAAATTAGCCAGA 0: 1
1: 19
2: 289
3: 443
4: 909
Right 1133289443 16:4709292-4709314 GCTACTAGGGAGGCTGAGGCAGG 0: 6336
1: 175987
2: 235818
3: 172632
4: 171596
1133289431_1133289443 27 Left 1133289431 16:4709242-4709264 CCCAAAAATGCAAAATTAGCCAG 0: 4
1: 90
2: 158
3: 472
4: 3611
Right 1133289443 16:4709292-4709314 GCTACTAGGGAGGCTGAGGCAGG 0: 6336
1: 175987
2: 235818
3: 172632
4: 171596

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133289443 Original CRISPR GCTACTAGGGAGGCTGAGGC AGG Intronic
Too many off-targets to display for this crispr