ID: 1133290352

View in Genome Browser
Species Human (GRCh38)
Location 16:4716567-4716589
Sequence CAGAGTCAAAAGTAGGATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 269}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133290352_1133290360 29 Left 1133290352 16:4716567-4716589 CCCCCATCCTACTTTTGACTCTG 0: 1
1: 0
2: 2
3: 26
4: 269
Right 1133290360 16:4716619-4716641 TTAAAAAATAATTTATAGGCCGG 0: 1
1: 4
2: 76
3: 472
4: 2824
1133290352_1133290361 30 Left 1133290352 16:4716567-4716589 CCCCCATCCTACTTTTGACTCTG 0: 1
1: 0
2: 2
3: 26
4: 269
Right 1133290361 16:4716620-4716642 TAAAAAATAATTTATAGGCCGGG 0: 2
1: 10
2: 106
3: 738
4: 3707
1133290352_1133290358 25 Left 1133290352 16:4716567-4716589 CCCCCATCCTACTTTTGACTCTG 0: 1
1: 0
2: 2
3: 26
4: 269
Right 1133290358 16:4716615-4716637 TGCCTTAAAAAATAATTTATAGG 0: 1
1: 0
2: 5
3: 98
4: 872

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133290352 Original CRISPR CAGAGTCAAAAGTAGGATGG GGG (reversed) Intronic
901924687 1:12558630-12558652 CAGAGACAGAAGTAGATTGGGGG + Intergenic
909869201 1:80718104-80718126 GGAAGTCAAAAGTAGAATGGAGG - Intergenic
910677977 1:89833911-89833933 GAGAGCCCAAAGTAGGAGGGGGG - Intronic
911115186 1:94238809-94238831 CAGAACCAAAAGTAGGGTAGCGG + Intronic
911779814 1:101861966-101861988 CAGGGTTAAAAATAGGATTGGGG + Intronic
915036433 1:152930175-152930197 AAGTGTCAAAAGTAAGATGATGG - Intergenic
915075567 1:153306036-153306058 CAGCGACAACAGCAGGATGGTGG + Intronic
915864223 1:159481112-159481134 CAAAGTCAAAAGGAGGAAGACGG + Intergenic
916811525 1:168309618-168309640 CAGAGTTAAGTGTAGCATGGGGG + Intronic
919123776 1:193372368-193372390 TAAAGTCACAAGGAGGATGGGGG - Intergenic
919773667 1:201179302-201179324 GAGAGTCACATGGAGGATGGAGG - Intergenic
920141941 1:203822411-203822433 GGGGGTCAAAAGTAGGATGTTGG - Intronic
922994081 1:229942192-229942214 CAGATTAAAAAGTAGAATAGAGG + Intergenic
923052161 1:230396424-230396446 GAGAGTGAAAGGGAGGATGGTGG - Intronic
923642081 1:235773593-235773615 ATTAGTCAAAAGTAGAATGGTGG + Intronic
923791871 1:237118525-237118547 CAGAGACAACGGTAGAATGGTGG + Intronic
1062940518 10:1417462-1417484 CTGACTCAAAAGAAGGATGAAGG + Intronic
1063161299 10:3420814-3420836 CAGAGCCAGAGGTAGGATGTAGG + Intergenic
1063914134 10:10864193-10864215 TAGGGTCAAAAGTTGGTTGGTGG - Intergenic
1065170184 10:23019212-23019234 CAGAGTAAAAAGTGGGGTGCAGG + Intronic
1065187740 10:23185414-23185436 CAGACTCAGAAGTGGGGTGGTGG + Intergenic
1065251263 10:23816809-23816831 CATAGTCAGAAGGAGAATGGTGG + Intronic
1065358538 10:24867250-24867272 CAGAGTTAAATGAAGGAGGGAGG - Intronic
1067958464 10:50819932-50819954 AAGAGTTAAAAGTTGGTTGGAGG - Intronic
1067989377 10:51193346-51193368 CAGAGTCAAGAGTAGGGTCAGGG + Intronic
1068000489 10:51328159-51328181 AAAAGTAAAAAGTAGAATGGTGG - Intronic
1068721153 10:60247544-60247566 CGGAGACAAAAGTAGGATGGTGG - Intronic
1074031267 10:109691124-109691146 CATATTCAAAAGTTGGGTGGAGG - Intergenic
1077539833 11:3141322-3141344 CAGAGTCACAGGGAGGATGCTGG - Intronic
1080866312 11:36198571-36198593 CAGAGGCAGGAGTGGGATGGGGG - Intronic
1080930497 11:36805144-36805166 CAGAGTCCACACTAGCATGGAGG + Intergenic
1081415126 11:42805593-42805615 TAGAGACAGAAGTAGAATGGTGG + Intergenic
1084663595 11:70562624-70562646 AAGAGTTAAAAGTAAGAAGGTGG - Intronic
1085252906 11:75155277-75155299 GAGAGTCAAAGGCAGGAAGGGGG - Intronic
1086693537 11:89817038-89817060 CAGGGTCAGTAGTAGGAGGGAGG - Intergenic
1087610775 11:100431895-100431917 CAGAAGCAAAAGTGGGATGAGGG + Intergenic
1090903558 11:131053694-131053716 CAGAGGACAAGGTAGGATGGGGG - Intergenic
1091214017 11:133889085-133889107 CAGAGACAAAGAAAGGATGGAGG + Intergenic
1091638663 12:2217214-2217236 TAGAGACAGAAGTAGAATGGTGG + Intronic
1091913991 12:4254698-4254720 CAGAGTCCCAGGTAGGATGATGG - Intergenic
1091976035 12:4826379-4826401 CAGAGGCAAAAGCAGAAAGGAGG + Intronic
1092156225 12:6283390-6283412 CAGAGACAGAAGTAGAATGGCGG + Intergenic
1092288265 12:7142522-7142544 AAGAGTCAAAACAAGGAGGGAGG - Intronic
1093780142 12:23126058-23126080 CAGAGTCAACAGGAGGAATGTGG - Intergenic
1095213649 12:39523685-39523707 CAGAGTCAGGATTAGGATTGTGG - Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1099988504 12:89697760-89697782 CAGAGTAGAAAATGGGATGGGGG - Intronic
1100613279 12:96210115-96210137 AAGAATCAAAAGTAGTATGAGGG + Intronic
1101183547 12:102248557-102248579 CAAAATCAAAAGTGGGATGTTGG + Intergenic
1102708735 12:114906298-114906320 CAGAGGCAAAAGTTGTATTGGGG - Intergenic
1104200840 12:126587214-126587236 TAGAGACAGAAGTAGAATGGTGG + Intergenic
1104428369 12:128696361-128696383 GAGAATCAGAGGTAGGATGGGGG - Intronic
1106203109 13:27560478-27560500 CTGAGTCAAAAGTAGGATATCGG + Intronic
1107829191 13:44359415-44359437 GAGGGTGAAAAGTAGGAGGGAGG - Intergenic
1108317173 13:49248142-49248164 CAGAGCGAAAGGTAGGGTGGCGG - Intronic
1109103272 13:58213916-58213938 CAAAGTAAAAAGTATGATGTGGG + Intergenic
1109745028 13:66613557-66613579 CAGAGTGTAAAGCAAGATGGAGG - Intronic
1110681497 13:78319011-78319033 CAGAATCTACAGTAGGACGGTGG + Intergenic
1112393786 13:99009688-99009710 CAGACACACAAGCAGGATGGGGG + Intronic
1112493570 13:99887767-99887789 CCTTGTCAAAAGTAGAATGGTGG + Intronic
1112952961 13:105024171-105024193 CAGAGTCTAAGGTAATATGGTGG + Intergenic
1113366472 13:109681226-109681248 CATAGCCAAAAGGAGGATGTGGG - Intergenic
1119653310 14:76398886-76398908 CCGAATCAAATGCAGGATGGTGG - Intronic
1120187788 14:81412545-81412567 CAGAATAGAAAGTAGAATGGTGG + Intronic
1120421918 14:84298317-84298339 CAGAGGAAAAGGTAGGAGGGAGG + Intergenic
1120867319 14:89306729-89306751 CAAAGTCAGAACTAGGACGGGGG + Intronic
1120968081 14:90185025-90185047 CAGAGGCCAGAGTAGAATGGAGG + Exonic
1121957014 14:98223463-98223485 CAGAGGGAAGAGTAAGATGGCGG + Intergenic
1122030150 14:98906171-98906193 CAGAGTCAACATTAGGATAGAGG - Intergenic
1122149906 14:99719592-99719614 CAGAGACAGAAGTGGAATGGTGG - Intronic
1122193917 14:100070408-100070430 CAGAGTCAAGGGTAGAATCGAGG + Intronic
1123681098 15:22764668-22764690 CTGAGACAAAAGTAGAATGGTGG - Intergenic
1123802177 15:23832625-23832647 TAGATGTAAAAGTAGGATGGTGG - Intergenic
1124333315 15:28839129-28839151 CTGAGACAAAAGTAGAATGGTGG - Intergenic
1126806185 15:52351711-52351733 CAGAGTCAAATGTAGTATTCTGG + Intronic
1128434271 15:67630079-67630101 AAAAGTAAAAAGTAGCATGGTGG + Intronic
1128747505 15:70124909-70124931 AGGAGTCCCAAGTAGGATGGGGG - Intergenic
1128909672 15:71501817-71501839 CAAAATCAAAATTAGGGTGGGGG - Intronic
1131522408 15:93126445-93126467 CAGAGTTAAAAATAGGATTTTGG + Intergenic
1133031887 16:3014949-3014971 CAGAGACCTGAGTAGGATGGGGG + Exonic
1133290352 16:4716567-4716589 CAGAGTCAAAAGTAGGATGGGGG - Intronic
1133960850 16:10492173-10492195 CCTCGTCAAAAGTTGGATGGAGG + Intergenic
1133973774 16:10585482-10585504 CAGAGTGGCAAGGAGGATGGAGG + Intergenic
1135770583 16:25215147-25215169 TAGAGACAGAAGTAGAATGGTGG - Intergenic
1136577508 16:31133191-31133213 GAAAGTCAAAAGTGGGCTGGAGG - Intronic
1138301693 16:55935637-55935659 CAGAGTGAAAAGGAGTGTGGTGG - Intronic
1139239514 16:65376611-65376633 CAGAGTCTAAAGAAAGAGGGAGG + Intergenic
1139717873 16:68828162-68828184 CAGAATCAGAACTGGGATGGTGG - Exonic
1140128916 16:72140800-72140822 CTGAGTCATAGTTAGGATGGAGG - Intronic
1141464831 16:84198543-84198565 CAGAGACAAAAGGGGGTTGGAGG - Intergenic
1141703188 16:85651675-85651697 CAGAGTCAGAAGAGGGCTGGAGG - Intronic
1142121396 16:88388254-88388276 CAGAGCCAGAGGCAGGATGGGGG + Intergenic
1144909415 17:18668722-18668744 CAGAGGCAGTAGTAGCATGGGGG - Intronic
1146961263 17:36982031-36982053 CAGAGAGAAAAGCAGAATGGTGG - Intronic
1149386862 17:56151002-56151024 CAGAGTGAGAGGCAGGATGGAGG + Intronic
1150638897 17:66936220-66936242 TAGAGACAAAAGTAGAATGGTGG - Intergenic
1151504294 17:74516429-74516451 CTGAGACAAAAGGATGATGGTGG + Intergenic
1203171336 17_GL000205v2_random:149785-149807 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1153843120 18:9024585-9024607 CAGATGCAGAAGTAGAATGGAGG + Intergenic
1153849034 18:9076345-9076367 AAGAGACATAATTAGGATGGAGG + Intergenic
1155494903 18:26433139-26433161 AAGAGTCAGAGGTACGATGGAGG - Intergenic
1156884708 18:42121653-42121675 CAGGGTAAAAAGTAGATTGGAGG - Intergenic
1156986356 18:43355352-43355374 CAGGGTCAACAGTAGGATCTGGG - Intergenic
1157119638 18:44896757-44896779 AAGAGTCAAAATTTGGATGTAGG - Intronic
1158578032 18:58656768-58656790 TCTAGTCAAAAGTAGAATGGTGG - Intergenic
1159195529 18:65109344-65109366 CAAAGTCAAAAGTTAGCTGGTGG + Intergenic
1159697913 18:71584042-71584064 CAGTATCAAGAGTAGGATGCTGG - Intergenic
1160835288 19:1122070-1122092 CGGAGGGAAAAGGAGGATGGAGG - Intronic
1161855644 19:6763426-6763448 CAGAGCCAAGAGTAGTTTGGGGG + Intronic
1161865220 19:6828308-6828330 CAGGGTCAGCAGTACGATGGAGG + Intronic
1162985830 19:14268983-14269005 CAGGGGAAAAAGTAGGGTGGGGG - Intergenic
1163902542 19:20117452-20117474 CAGAGCCAGAAGAAGGAAGGAGG - Intronic
1164446400 19:28321270-28321292 GAGATTCAAAAGCAGGAGGGTGG + Intergenic
927503765 2:23599951-23599973 CAGAATGAAAAGGGGGATGGGGG - Intronic
927571969 2:24167762-24167784 CAGAGTCCACAGTGGGAGGGAGG + Intronic
927659595 2:24981626-24981648 TAGAGACAAAAGTAGAATGATGG - Intergenic
927806865 2:26155794-26155816 CAAAATCAAAAGCAGAATGGTGG + Intergenic
928887448 2:36165960-36165982 TAGAGACACAAGTAGAATGGGGG + Intergenic
929595896 2:43175633-43175655 CAGGGGCAAGAGAAGGATGGAGG + Intergenic
929738044 2:44572173-44572195 CAGAGACAAAAGTAGAATGGTGG - Intronic
930450299 2:51527477-51527499 CAGAAGCAAAGGTACGATGGTGG - Intergenic
933279710 2:80319663-80319685 CAGAGTGAAAAGCAGAATTGTGG - Intronic
936889924 2:117357363-117357385 CAGAGTAGAAAGTAGTTTGGTGG - Intergenic
937408431 2:121651353-121651375 CAGAGACAGAACTAGAATGGAGG - Intergenic
937562357 2:123241661-123241683 TAGAGCCAGAAGTAGAATGGTGG + Intergenic
937689434 2:124738235-124738257 CAGAGTGAAAAGAAAGAGGGAGG - Intronic
940545975 2:155085861-155085883 CAGACTCAGAAGGAGGAGGGTGG + Intergenic
941388930 2:164887910-164887932 TAAAGTCAAGAGTAGAATGGTGG - Intergenic
941915119 2:170807086-170807108 CAAAGCAAAAAGTAGAATGGTGG - Intergenic
942572139 2:177325304-177325326 CAAAGTCAGAGGTAGGAGGGAGG + Intronic
943322625 2:186464450-186464472 GAGACTCAGAAGTAGGAGGGTGG + Intergenic
945339561 2:208635822-208635844 GAGATTAAAAAGTAGAATGGTGG + Intronic
945641480 2:212436881-212436903 CAGAGACAAGAATAGGTTGGAGG + Intronic
947762891 2:232616642-232616664 GAGAGACAGAAGTAGAATGGTGG + Intronic
948127604 2:235576200-235576222 CAGTGGCAAAGGTAGGATAGGGG + Intronic
948513941 2:238491139-238491161 CATAGTCATGAGTAGGAAGGAGG - Intergenic
1169515136 20:6308645-6308667 TAGAGTAGAAAGTAGAATGGTGG - Intergenic
1169932861 20:10852975-10852997 CAGTGTGGAGAGTAGGATGGAGG + Intergenic
1172452586 20:35038028-35038050 CAGAGAAAAAAGCAGAATGGTGG + Intronic
1172924706 20:38522469-38522491 CAAAGTCTAAAGTATAATGGTGG - Intronic
1173611987 20:44375609-44375631 CAGAGCCAAGACTAGAATGGTGG + Intronic
1173975046 20:47180607-47180629 CATAGTGAAATGTAGTATGGGGG - Intronic
1175377477 20:58538794-58538816 AAGATTCAAAAGTATCATGGTGG - Intergenic
1176327320 21:5511613-5511635 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1176400437 21:6309338-6309360 CAGAGGAAAAAGGAGCATGGAGG + Intergenic
1176436720 21:6679766-6679788 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1176460982 21:7006836-7006858 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1176484543 21:7388614-7388636 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1177938769 21:27382781-27382803 CAGAGTCCAAAGTGGGATTTTGG - Intergenic
1178841650 21:36142455-36142477 CAGGGTCCAAAGTAGGATCATGG - Intronic
1181498930 22:23304812-23304834 AAGAGTTAAAAGTGGGATAGAGG + Intronic
1182529180 22:30942046-30942068 CAGAATCACAAGTAGTGTGGGGG - Intronic
1184048722 22:41988704-41988726 CAGAGCCTGAGGTAGGATGGGGG + Intronic
1184429949 22:44436783-44436805 TAGAGACAGAAGTAGAATGGTGG - Intergenic
1184474080 22:44711328-44711350 CAGAGGGAACAGCAGGATGGAGG + Intronic
949153786 3:803381-803403 CAGATTAAAAAGTAGTATGTTGG - Intergenic
949169363 3:980406-980428 CAGAGTCCAGAGGAGGATTGTGG + Intergenic
949200130 3:1367333-1367355 CATAGTAAAGAGTAGCATGGTGG - Intronic
950634324 3:14304241-14304263 CAGAGTCACAGGGAGGACGGAGG - Intergenic
951684224 3:25326239-25326261 TAAAGTCAAAAGTGGGAGGGAGG + Intronic
952196056 3:31076258-31076280 GAGCGTGAAAAGCAGGATGGTGG + Intergenic
954053934 3:48006304-48006326 CAAAGTGAAAGGTTGGATGGAGG - Intronic
955940425 3:64142168-64142190 CAGTGTCAGAAGAAAGATGGTGG - Intronic
956148111 3:66212669-66212691 TAGAGATAAAAGTAGCATGGTGG - Intronic
956175151 3:66465889-66465911 TAGAGACAGAAGTAGAATGGTGG - Intronic
957291193 3:78280525-78280547 CTGAGTTAAAAGGAAGATGGCGG - Intergenic
959912541 3:111779803-111779825 CAAAGGCAAAAAGAGGATGGAGG - Intronic
961955578 3:130799611-130799633 GAGACTCAGAAGGAGGATGGTGG + Intergenic
966616285 3:181916714-181916736 CAGAGTTAGGAGCAGGATGGAGG - Intergenic
968354791 3:198097565-198097587 CAGAAACAACAATAGGATGGTGG + Intergenic
969031066 4:4214756-4214778 CATAGACAGAAGTAGAATGGTGG + Intronic
969173380 4:5381587-5381609 CAGAGTCCCATATAGGATGGTGG - Intronic
970566102 4:17334085-17334107 CAGAGTCTGAGGCAGGATGGAGG - Intergenic
971829578 4:31673444-31673466 CAGAGTCAAAATTTGCATGAGGG + Intergenic
972279605 4:37589588-37589610 GAGAGCCAAAAGGAGGAAGGAGG - Intronic
975058821 4:69970997-69971019 CAGAGGTAAAATTAGGAGGGGGG + Intergenic
976242679 4:82974882-82974904 TAGATACAAAAGTGGGATGGTGG + Intronic
976263802 4:83171473-83171495 CTGAGTAAAAAGAAAGATGGTGG - Intergenic
976501943 4:85801204-85801226 CTGAGTAAAAAGTAGGATATAGG - Intronic
977967948 4:103177417-103177439 AAGAGTCAAGAGAAGAATGGTGG - Intronic
978460507 4:108946670-108946692 CAGAGTGATAAGTATTATGGTGG + Intronic
980973398 4:139587919-139587941 CAGAGTCAAAGATAGAATGCTGG + Intronic
981611244 4:146596091-146596113 CAGAGTCAATACTAGAATGCAGG - Intergenic
984169491 4:176343514-176343536 CAGTGCCCAAAGTCGGATGGGGG + Intergenic
984359741 4:178713071-178713093 ACAAATCAAAAGTAGGATGGCGG + Intergenic
984559057 4:181246937-181246959 CAGAGAGCAAAGGAGGATGGAGG + Intergenic
984724483 4:183007752-183007774 TAGACACAAAAGTAGAATGGGGG + Intergenic
986392091 5:7296659-7296681 CTGAGACAAAAGTAGAATGGTGG - Intergenic
987605815 5:20134744-20134766 CAAAGTCAAAAGGAGGAAGGAGG - Intronic
988990504 5:36665748-36665770 CAGAGCCAAAAGTAGAATCCAGG + Intronic
992064299 5:73091452-73091474 CACAGTCATAAGTAGGTTTGAGG + Intergenic
992351373 5:75932439-75932461 CAGAGTGCAAAGTGGGATCGGGG + Intergenic
995315014 5:110759814-110759836 CAGGGTCAGAAGTAGGAAGATGG + Intronic
995591305 5:113702603-113702625 GAGACTCAAAACTAGGATGAAGG - Intergenic
996369827 5:122741425-122741447 CAAGGTGAATAGTAGGATGGAGG - Intergenic
996985149 5:129552992-129553014 GAGAGTCAACAGTAGGAAGATGG - Intronic
997814631 5:137004128-137004150 CAGAGTCTAAGGTAAGATGGTGG + Intronic
997823177 5:137084181-137084203 CAGTTTCAGAAGTGGGATGGAGG - Intronic
997875649 5:137544498-137544520 CTGAGTCAACAGTGGGATGTGGG - Intronic
999794569 5:154977009-154977031 CAGAGACAGAAGTAGAATGGTGG - Intergenic
1001519981 5:172384539-172384561 TAGAGACAGAAGTAGAATGGTGG - Intronic
1001621918 5:173093944-173093966 GAGAGTAAAAAGTAGAATGGAGG - Intronic
1002337547 5:178490404-178490426 CAGAGGCAGAAGTAGAATAGAGG + Intronic
1005986143 6:30876751-30876773 CAGAGCCAAAGCTAGGCTGGAGG - Intronic
1006876850 6:37305161-37305183 AAGAGTCAGATGTAAGATGGAGG - Intronic
1007141213 6:39576449-39576471 CAGAGTCAAAGATGGGAAGGGGG - Intronic
1008025233 6:46628634-46628656 CAGAGTACAAAGTAGGAGAGAGG + Intronic
1008265886 6:49425790-49425812 CAGAGAAAAAAGTAGAATGGTGG - Intergenic
1008372064 6:50744189-50744211 GAGGGTAAAAAGTAGGAGGGTGG - Intronic
1008927503 6:56902539-56902561 CAGAGTCAAAAGTAGCAATGAGG + Intronic
1010081064 6:71863224-71863246 AAAAGTAAAGAGTAGGATGGTGG - Intergenic
1011088644 6:83570868-83570890 CAGAGGGAAATGTGGGATGGGGG + Intronic
1011540846 6:88426729-88426751 CAGAAACAAAAGTAGGGTGGTGG + Intergenic
1013285959 6:108681957-108681979 CAGAGGCACTAGTAGCATGGGGG + Exonic
1013317020 6:108952993-108953015 CAGAGTCAAAAGTGCAAAGGGGG - Intronic
1016778947 6:147937120-147937142 CAGAGACAAAGGTGGGTTGGTGG - Intergenic
1016828189 6:148407262-148407284 TACAGACAAAAGTAGAATGGTGG - Intronic
1017028582 6:150201677-150201699 CAGAGTGGAAACTGGGATGGCGG + Intronic
1017367035 6:153655139-153655161 CAGTGTAAAAAGGTGGATGGGGG - Intergenic
1017612317 6:156201768-156201790 CAGAAACAAAAGTAGAACGGTGG + Intergenic
1017971753 6:159317822-159317844 AAGGGGCAAAAGCAGGATGGAGG + Intergenic
1018230956 6:161674880-161674902 AAGAGTCAAGGGTAGGAAGGAGG + Intronic
1018784208 6:167095505-167095527 CAGAGACAAAAGTAGAATAAGGG - Intergenic
1018834917 6:167475678-167475700 GAGATTCTAATGTAGGATGGTGG + Intergenic
1019507584 7:1400348-1400370 TAGAGACAGAAGTAGGAAGGTGG - Intergenic
1019725683 7:2601236-2601258 GAGAGGCAGAATTAGGATGGCGG - Intronic
1021928278 7:25554113-25554135 ATGAGTCAAGAGGAGGATGGGGG - Intergenic
1023560667 7:41470306-41470328 CAGAGTCTGAAGGAGGAGGGAGG - Intergenic
1023694636 7:42832129-42832151 CAGAGTGAATTGTAGGATGGAGG - Intergenic
1023908721 7:44539445-44539467 CAGGGACAAAAGCAAGATGGTGG - Exonic
1024272800 7:47655295-47655317 CAGAGTCAACAGAAGGAAGACGG + Exonic
1026540404 7:71275208-71275230 CAGAGTCAGAAGTTGCAGGGGGG + Intronic
1029056576 7:97751157-97751179 CATGGTCCCAAGTAGGATGGGGG - Intergenic
1029624182 7:101709436-101709458 CAGTTTCAAAAGATGGATGGGGG + Intergenic
1029699771 7:102238710-102238732 CAGAGTGAAAAGTGGGGTGGGGG - Intronic
1031909742 7:127503212-127503234 AGCAGTCAAAAGTAGGAAGGTGG - Intergenic
1031982254 7:128135674-128135696 CCGGGCCAAAAGGAGGATGGAGG + Intergenic
1032338534 7:131049075-131049097 CAAAGTCATAAGAAGGATTGAGG - Intergenic
1032680203 7:134174667-134174689 CAGAGAAGAAAGTGGGATGGTGG + Intronic
1034826671 7:154271546-154271568 CAGTGCCAAAGGTAAGATGGAGG - Intronic
1035228644 7:157447510-157447532 CAGAGACAGAAGTAGAATGGTGG - Intergenic
1035371683 7:158383263-158383285 CAGAGGCAAAAGCAGCATGCAGG + Intronic
1035475254 7:159139263-159139285 CAGTGTCAAAAGGAGGCTGCTGG - Intronic
1035909504 8:3550011-3550033 CAGAGTTAAATGTAAGAAGGTGG - Intronic
1037475662 8:19254699-19254721 CAGAGTCTCAAGTAGGATTGAGG + Intergenic
1037531967 8:19785161-19785183 CAGAGACAAAAGTAGAACAGAGG + Intergenic
1038423200 8:27447019-27447041 GAGAGTCAAAGGCAGGAGGGTGG - Intronic
1038432153 8:27509056-27509078 TAGAGAAAAAAGCAGGATGGGGG - Intronic
1041170485 8:55137194-55137216 CAAAGTCAAAAGAAAGTTGGAGG + Intronic
1041691395 8:60691486-60691508 CAGTGAGAAAAGGAGGATGGGGG - Intronic
1041881881 8:62761208-62761230 GAGAGTCAAAAGTCAGGTGGAGG + Intronic
1043337896 8:79199682-79199704 CAGAGTCAGAAGAAGGATAATGG - Intergenic
1044998113 8:97856244-97856266 TAGAGTAAAAAATAGGAAGGGGG - Intergenic
1045661920 8:104446996-104447018 CAAAGCCAAAAGTATGCTGGAGG + Intronic
1045760175 8:105596425-105596447 CAGGGTAAAAACTAGGATGGTGG - Intronic
1046350621 8:113006341-113006363 CAGAGTTAAAAGAAGACTGGTGG + Intronic
1046553965 8:115753144-115753166 CAGATGAAAAACTAGGATGGAGG + Intronic
1046872387 8:119218074-119218096 CAGTCTCAAAATGAGGATGGTGG + Intronic
1050056624 9:1661810-1661832 CAGAGTCCAACATGGGATGGAGG - Intergenic
1050912046 9:11083395-11083417 CATGGGCAAAAGTAGGATGGGGG - Intergenic
1051722192 9:20048850-20048872 AATAGTTAAAAATAGGATGGGGG - Intergenic
1051993830 9:23189002-23189024 CAAAGTAAAAAGTAAGATGGGGG - Intergenic
1052299734 9:26940551-26940573 AAGAGTTAAAAGATGGATGGTGG + Intronic
1055760219 9:79599089-79599111 CAGTGCCAAGAGGAGGATGGAGG + Intronic
1056220710 9:84448310-84448332 CAGAGTCAGAAGTAGGAGACAGG + Intergenic
1056503432 9:87233265-87233287 CAGAGTCAAAAGGAAGATACTGG - Intergenic
1056623125 9:88231842-88231864 CAGAGTAAAAAGTAGGTTCAAGG - Intergenic
1056798973 9:89678217-89678239 CAGAGACAAAAGGAGGGAGGGGG + Intergenic
1058990439 9:110250543-110250565 CAGAGTGTAAAGTAGAATGTAGG + Intronic
1060723685 9:125994203-125994225 CAGAGCTAAGAGCAGGATGGAGG - Intergenic
1060844336 9:126823679-126823701 AATAATAAAAAGTAGGATGGGGG - Intronic
1061928803 9:133821663-133821685 GAGACTAAAAAGTTGGATGGGGG + Intronic
1062415656 9:136448317-136448339 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415665 9:136448355-136448377 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415676 9:136448392-136448414 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415687 9:136448429-136448451 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415695 9:136448466-136448488 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415706 9:136448504-136448526 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415740 9:136448650-136448672 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415758 9:136448724-136448746 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415769 9:136448762-136448784 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415778 9:136448800-136448822 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415786 9:136448836-136448858 CAGAGACACCAGGAGGATGGAGG + Intronic
1203434793 Un_GL000195v1:128893-128915 CAGAGGAAAAAGGAGCATGGAGG + Intergenic
1186545404 X:10444083-10444105 TTGAGTCAAAATTAGGAAGGAGG + Intergenic
1187438334 X:19293325-19293347 CAGAGTCAAATGCAGCATTGAGG + Intergenic
1188001048 X:24982187-24982209 CAGCATCAAAAGTAGAATGGTGG - Intronic
1190255051 X:48756102-48756124 CAGAGTGAAATGAATGATGGAGG + Intergenic
1193179341 X:78435150-78435172 CTGAGTGAAAAGTTAGATGGTGG - Intergenic
1194696500 X:97058500-97058522 CAGTGTCAAAAGTAGCAGGAAGG - Intronic
1196550214 X:117015588-117015610 TAGAGACAAAAGTAGAATAGTGG + Intergenic
1197383785 X:125779225-125779247 AAGAGTGGAGAGTAGGATGGTGG - Intergenic
1197571315 X:128154159-128154181 GAGACTCAGAAGTAGGAGGGTGG + Intergenic
1197708674 X:129651330-129651352 CAGAATCAAAAGTAGGAAACAGG - Intronic
1199154678 X:144533610-144533632 CAGAGGCAAAAGTGGGTTAGAGG + Intergenic
1199665824 X:150095659-150095681 CAGAGTCAGGAGGAGGATGGTGG - Intergenic