ID: 1133292141

View in Genome Browser
Species Human (GRCh38)
Location 16:4729275-4729297
Sequence CCTCCATGGCAGAAGCTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 262}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133292133_1133292141 8 Left 1133292133 16:4729244-4729266 CCAGAGGCACTGAAAGCCCAGCC 0: 1
1: 0
2: 2
3: 31
4: 226
Right 1133292141 16:4729275-4729297 CCTCCATGGCAGAAGCTAGAGGG 0: 1
1: 0
2: 1
3: 33
4: 262
1133292131_1133292141 10 Left 1133292131 16:4729242-4729264 CCCCAGAGGCACTGAAAGCCCAG 0: 1
1: 0
2: 5
3: 32
4: 317
Right 1133292141 16:4729275-4729297 CCTCCATGGCAGAAGCTAGAGGG 0: 1
1: 0
2: 1
3: 33
4: 262
1133292132_1133292141 9 Left 1133292132 16:4729243-4729265 CCCAGAGGCACTGAAAGCCCAGC 0: 1
1: 0
2: 2
3: 31
4: 252
Right 1133292141 16:4729275-4729297 CCTCCATGGCAGAAGCTAGAGGG 0: 1
1: 0
2: 1
3: 33
4: 262
1133292135_1133292141 -9 Left 1133292135 16:4729261-4729283 CCAGCCTCTCTCCTCCTCCATGG 0: 1
1: 0
2: 11
3: 112
4: 867
Right 1133292141 16:4729275-4729297 CCTCCATGGCAGAAGCTAGAGGG 0: 1
1: 0
2: 1
3: 33
4: 262
1133292134_1133292141 -8 Left 1133292134 16:4729260-4729282 CCCAGCCTCTCTCCTCCTCCATG 0: 1
1: 0
2: 8
3: 79
4: 776
Right 1133292141 16:4729275-4729297 CCTCCATGGCAGAAGCTAGAGGG 0: 1
1: 0
2: 1
3: 33
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133292141 Original CRISPR CCTCCATGGCAGAAGCTAGA GGG Intronic
903601775 1:24547207-24547229 CTCCCATGGCAGCATCTAGAGGG - Intergenic
904889682 1:33770539-33770561 CTTCCATGGAGGAAGCCAGAGGG - Intronic
906613269 1:47218173-47218195 CCTCGAAGGCAGAGCCTAGAGGG + Exonic
910060786 1:83089176-83089198 ATTCCATGGCAGAAGGCAGAAGG - Intergenic
911145451 1:94548101-94548123 TCTCCATGGCAGAAGGGACAAGG + Intergenic
912367328 1:109145179-109145201 CTCACATGGCAGAAGGTAGAAGG - Intronic
912416963 1:109515505-109515527 CCCCCATGGCAGGAGCTCCAAGG - Intergenic
915595765 1:156895506-156895528 CCTACAGGGGAGAAGCCAGAAGG + Intronic
915712766 1:157917122-157917144 CCTCCCTGGCAGCAGAAAGATGG + Intergenic
917050620 1:170918236-170918258 CTCACATGGCAGAAGGTAGAAGG - Intergenic
917172214 1:172189776-172189798 CCACCATGGCAGAAGGTGAAAGG + Intronic
917486644 1:175461008-175461030 CTTGCATGGCTGAAGCCAGAAGG + Intronic
917864160 1:179177328-179177350 CCTCTTTGGCAGAGGCCAGAAGG - Intronic
918740619 1:188126706-188126728 CTCACATGGCAGAAGGTAGAGGG + Intergenic
922377847 1:224987550-224987572 GTTCCATGGAAGAAGGTAGAAGG + Intronic
922718971 1:227890701-227890723 CCTCCAGGGCAGAAAGAAGAGGG + Intergenic
924445645 1:244127892-244127914 CCCCCTTGCCAGATGCTAGATGG - Intergenic
924626772 1:245702178-245702200 CCTCCATGGCTGGAGGTAGGGGG + Intronic
1063498598 10:6532671-6532693 TCTCCAGAGCAGAAGGTAGATGG + Intronic
1064010071 10:11728551-11728573 CGGTCATGGCAGAAGCTAAAGGG + Intergenic
1064928770 10:20599971-20599993 CATCCAAGGCAGAAGGTGGAAGG - Intergenic
1066413943 10:35201657-35201679 CTTTCATGTCAGGAGCTAGATGG + Intronic
1068343212 10:55736227-55736249 GTTCCATGCCAGAAGCTAGTAGG - Intergenic
1069412098 10:68164246-68164268 ATTCCATGGCAGAAGGCAGAAGG + Intronic
1073417055 10:103392929-103392951 CCTCCATGGGAGAAGGGAGAAGG + Intronic
1074905438 10:117858817-117858839 TCTCTATGGCAGAAGATATAGGG - Intergenic
1076471205 10:130719552-130719574 CCATCATGGCAGAAGGCAGAAGG - Intergenic
1077115089 11:880523-880545 CCTCCATGGCAGATGGCAGGTGG - Intronic
1078093190 11:8280311-8280333 ATCCCATGGCAGAAGGTAGAAGG + Intergenic
1078422758 11:11225699-11225721 CCTACATGGCAGAAGGTGGAAGG + Intergenic
1079399123 11:20091561-20091583 ACTCCATGGCAGAAGGTGGGAGG - Intronic
1079554171 11:21739218-21739240 CATTCATGGCAGAAGGTAAAGGG + Intergenic
1080656684 11:34263859-34263881 CCTCCATGGCAGATACCAGTGGG - Intronic
1081324676 11:41729481-41729503 CTTACATGGCAGCAGCAAGAGGG - Intergenic
1081394472 11:42569476-42569498 CCCACATGGCAGAAGGCAGAAGG + Intergenic
1081397434 11:42603370-42603392 CATCCTTGGCAGAAGGTAGAAGG + Intergenic
1082882921 11:58055856-58055878 CTTACATGGCTGAAGATAGAAGG - Exonic
1083310063 11:61779484-61779506 CCTGCATGGCTGCAGCAAGAGGG - Exonic
1084678210 11:70649222-70649244 TCTCCATGGCAGGACCTAGGGGG - Intronic
1085817542 11:79756174-79756196 CCTCCATAACAGCAGCTAGGGGG + Intergenic
1087238200 11:95744689-95744711 CTCACATGGCAGAAGGTAGAAGG - Intergenic
1087875007 11:103344491-103344513 GCTCCAAGGCAGAAGCTCAAGGG - Intronic
1088673299 11:112165717-112165739 CTTCCATTGCATAAGCTAAATGG - Intronic
1089107901 11:116029947-116029969 ATTCCATGGCAGAAGGTGGAAGG - Intergenic
1090805642 11:130200393-130200415 CATCCATGGCAGAAGGTGAAGGG + Intronic
1093269491 12:17041769-17041791 CTCACATGGCAGAAGGTAGAAGG - Intergenic
1094550785 12:31449131-31449153 TTTGCATGGCAGAAGCCAGAAGG + Intronic
1094671570 12:32575330-32575352 CATTCATGGCAGAAGATAAAGGG + Intronic
1094738701 12:33264102-33264124 CCTCTATGGCATAAGGTGGAAGG - Intergenic
1095648854 12:44582963-44582985 ATCCCATGGCAGAAGTTAGAAGG - Intronic
1096499481 12:52056224-52056246 CCTCCAGGGCAGAAGCCTGGGGG - Intronic
1097249076 12:57622497-57622519 GGTCCCTGGCAGAAGCTAGAAGG - Intronic
1097533748 12:60839108-60839130 TCTGCATGGCAGAAGGCAGAAGG + Intergenic
1098348588 12:69532503-69532525 CTTGCATGGCAGAAGGTGGAGGG + Intronic
1099478037 12:83132248-83132270 CCTCAATGGCAGACTCCAGAAGG + Exonic
1101370982 12:104130068-104130090 CCAACATGGCAGATCCTAGAAGG + Intronic
1101600324 12:106204089-106204111 CCGTCATGGCAGAAGGCAGAGGG - Intergenic
1103074930 12:117974433-117974455 CATCCATGGGTGAAGCTGGAAGG - Intergenic
1105712545 13:23026457-23026479 CCTGCATGGCAGGAGCAGGAGGG - Intergenic
1106875657 13:34069657-34069679 ACTCCATGGCAGAAGGCAGGAGG - Intergenic
1107260547 13:38485425-38485447 ATCCCATGGCAGAAGGTAGAAGG + Intergenic
1108249317 13:48549260-48549282 CTCCTATGGCAGAAGATAGAAGG - Intergenic
1109349002 13:61152676-61152698 ATTCCATGGCAGAAGGCAGATGG - Intergenic
1109416732 13:62050678-62050700 CTTTCATGGCAGCAGGTAGAAGG - Intergenic
1110051265 13:70902664-70902686 ATTCCATGGCGGAAGGTAGAAGG - Intergenic
1110372621 13:74756685-74756707 TCTACATGGCAGAAGGCAGAAGG + Intergenic
1110890024 13:80687918-80687940 CTTACATGGCAGGAGCAAGAGGG + Intergenic
1116375225 14:44190799-44190821 CCGTCATGGCAGAAGCTGAAGGG - Intergenic
1116694712 14:48158195-48158217 CCTTCATGGCAATAACTAGAAGG - Intergenic
1117514315 14:56485398-56485420 CTTACATGGCAGAAGATGGAAGG + Intergenic
1118627340 14:67671781-67671803 ACCCCATGGCAGAAGATGGAAGG + Intronic
1118742391 14:68748988-68749010 CCTCCATGGCATAAGCTTCCTGG - Intergenic
1118859519 14:69651659-69651681 CCACAATGGGAGAAGATAGAAGG + Intronic
1120217180 14:81692778-81692800 CTTCCATGGGAGAAGATAAAAGG - Intergenic
1120398064 14:83993411-83993433 TCTCCATGGCAGGAGCGAGGGGG - Intergenic
1120566836 14:86070323-86070345 CCTCCATGACACAGTCTAGAGGG - Intergenic
1121187056 14:91982713-91982735 CCTGCATGGCAGCAGCTGGGCGG + Intronic
1121420984 14:93814069-93814091 ATTCCATGGCAGAAGGTGGAAGG + Intergenic
1121758956 14:96427339-96427361 CAACCATGGCAGAAGATAAAGGG + Intronic
1122521063 14:102344099-102344121 CCTCCAGGGCAGGACCTGGAAGG - Intronic
1125966794 15:43881233-43881255 CCTCTGAGGCTGAAGCTAGAGGG - Intronic
1126367852 15:47914496-47914518 CATCCATGGTGGAAGGTAGAGGG + Intergenic
1126804519 15:52333008-52333030 CTTACATGGCAGAAGGTGGAAGG - Intronic
1126954570 15:53918195-53918217 ACTCCATCGCAGAAGCAACAGGG + Intergenic
1127103815 15:55592321-55592343 CTTACAAGGCAGAAGCTAGAAGG + Intergenic
1127262523 15:57336756-57336778 CCTCCATGCCTGAATCTAAAGGG + Intergenic
1127492084 15:59474407-59474429 CTTACATGGCAGAAGGTGGAAGG + Intronic
1127525639 15:59790108-59790130 CTTACATGGCAGCAGCAAGAGGG - Intergenic
1127729864 15:61789824-61789846 CCACCTAGGCAGAAGCCAGAGGG - Intergenic
1128151192 15:65364508-65364530 CCTCCATGGCAGATTGCAGAGGG - Intronic
1129350621 15:74954104-74954126 CCTGCATGGTAGAAGCTTAAGGG - Intergenic
1129785970 15:78310369-78310391 ATTCCATGGCAGAAGGCAGAAGG + Intergenic
1133292141 16:4729275-4729297 CCTCCATGGCAGAAGCTAGAGGG + Intronic
1136714916 16:32271025-32271047 CAACCATGGCAGAAGGAAGAGGG + Intergenic
1137018888 16:35402905-35402927 CCTCCATGACAGAAGGGACAAGG - Intergenic
1137384233 16:48026801-48026823 CTTACATGGCAGAAGGCAGAAGG + Intergenic
1137516499 16:49149025-49149047 CCTCCATGGGACAAGCTTTAGGG + Intergenic
1138331772 16:56221109-56221131 CTCCCATGGCAGAAGGTAGAAGG - Intronic
1138522778 16:57580897-57580919 CCACCGTGACAGAAGCTAGGAGG + Intronic
1139022814 16:62772864-62772886 CTCACATGGCAGAAGGTAGAAGG + Intergenic
1139180917 16:64747621-64747643 CTTACATGACAGCAGCTAGATGG + Intergenic
1140035467 16:71368162-71368184 CCACCATGGCAGGACCTAGCTGG + Intronic
1141509962 16:84505535-84505557 ACTCCAGGGCAGAAGCCAGAAGG - Intronic
1142252951 16:89001118-89001140 ACACCAGGGCAGAAGCTGGATGG - Intergenic
1203055137 16_KI270728v1_random:918744-918766 CAACCATGGCAGAAGGAAGAGGG - Intergenic
1142782310 17:2190718-2190740 CTCCCAGGGCAGCAGCTAGAAGG + Intronic
1146567231 17:33923915-33923937 ACTACATGGCAGAAGATACAGGG + Intronic
1147139156 17:38451954-38451976 CCACCCTGGCGGAAGCCAGATGG - Intronic
1147457534 17:40547591-40547613 CCACCATGGCAGCAGGTGGAGGG - Intergenic
1149654316 17:58302333-58302355 GCCCCAGGGCAGAAGCGAGAAGG - Exonic
1150248823 17:63694895-63694917 CCTCCAGGGGAGGAGCTACAAGG - Exonic
1151052999 17:71000537-71000559 CCTACATGCCAGAAGCTATCTGG + Intergenic
1151082553 17:71345357-71345379 ATTCCATGGCAGAAGATGGAAGG - Intergenic
1151294100 17:73171106-73171128 CCCCAAGGGCAGAGGCTAGAAGG - Intergenic
1152293198 17:79452523-79452545 GCTGCATGCCAGAAGCCAGAGGG - Intronic
1152316201 17:79581822-79581844 GCTCCATGGCAGATGCTCCATGG - Intergenic
1153063134 18:1014439-1014461 GCTCCATGGCAGAAGCTCTCAGG - Intergenic
1153775490 18:8449998-8450020 CTTCTAGGGCAGAAGCTAAAAGG - Intergenic
1158015477 18:52777864-52777886 TATCTATGGCAGAAGGTAGATGG + Intronic
1164743567 19:30594687-30594709 CCTCCCTGGCTGCAGCTAGCCGG + Intronic
1166503357 19:43356538-43356560 CTTCCATGGCAGCACCTAAATGG - Intronic
1166507097 19:43378223-43378245 CTTCCATGGCAGCACCTAAATGG + Intergenic
1167288926 19:48614193-48614215 CCTCCACTGCAGCAGCTGGAAGG - Intronic
1168134520 19:54341513-54341535 TCTCCATGGCAGAGGCTGGAGGG + Intergenic
925468378 2:4132533-4132555 CCTCCATTGCCAAAGCCAGAAGG - Intergenic
926223328 2:10950395-10950417 CCTACATGGCAGGAGAAAGAGGG - Intergenic
926410117 2:12594371-12594393 CCTCTATGGCCGGGGCTAGAAGG + Intergenic
926800575 2:16656533-16656555 CCTCCGTGGTGGAAGCTACATGG + Intronic
927218286 2:20682584-20682606 CCTCCCTGGCAAAAGGTGGAAGG + Intergenic
927305722 2:21570383-21570405 TCTCCATGTCAAAGGCTAGATGG + Intergenic
927776372 2:25906990-25907012 ACCCCATGGCAGAAGGCAGAAGG - Intergenic
929386955 2:41420449-41420471 ACTCCAAGGCAGAAACTAAAGGG - Intergenic
930239650 2:48922876-48922898 CTCACATGGCAGAAGCTGGAAGG + Intergenic
931831190 2:66053178-66053200 CATCCATGGCAGAAGGCAGAGGG + Intergenic
932471247 2:71960870-71960892 TCCCCATGGCAGAAGCATGAGGG + Intergenic
932562099 2:72882269-72882291 ATTCCATGGCAGAAGGCAGAAGG + Intergenic
933370833 2:81413382-81413404 CCACCATGGCAGAAGGCAAAGGG + Intergenic
933685831 2:85140481-85140503 CCTCCATGGTGGAAGCTGGAGGG + Intronic
934145267 2:89087247-89087269 CCTCCATCACAGCAGCTAGAAGG - Intergenic
934223986 2:90113308-90113330 CCTCCATCACAGCAGCTAGAAGG + Intergenic
935523798 2:104141887-104141909 CCTCCATGTCGAAGGCTAGAAGG - Intergenic
938778108 2:134559767-134559789 CCCCCATAGCAGCAGCTCGAGGG - Intronic
938786646 2:134635968-134635990 CCTCCATATCAGAAGGTATATGG + Intronic
939577771 2:143916748-143916770 CCTCAAGGGCAGAAGGCAGAAGG + Intergenic
940041186 2:149362664-149362686 ATCCCATGGCAGAAGGTAGAAGG + Intronic
940298869 2:152158783-152158805 CTTACATGGCAGAAGGTAGAAGG + Intronic
940478723 2:154200629-154200651 CTCACATGGCAGAAGGTAGAAGG + Intronic
941000965 2:160203601-160203623 CCTCCCTGGCAGCCGCTAGCAGG + Intronic
942211948 2:173680017-173680039 ACCCCATGGCAGAAGGTAGAAGG - Intergenic
943130153 2:183843690-183843712 CCTCCATGGCAGAAGAGAGTGGG + Intergenic
943512127 2:188839352-188839374 ATTCCATGGCAGAAGGCAGAAGG + Intergenic
943539377 2:189193027-189193049 ATCCCATGGCAGAAGGTAGAAGG - Intergenic
944339543 2:198580147-198580169 CCGCCCTGGGAGAAGCCAGAAGG + Intergenic
945084274 2:206115449-206115471 CTCCCATGGCAGAAGATGGAAGG - Intronic
945386003 2:209202004-209202026 GCACCATGGCAGAAGGTAGATGG + Intergenic
947052729 2:226064674-226064696 CTTACATGGCAGGAGCAAGACGG - Intergenic
947665644 2:231903887-231903909 CTCACATGGCAGAAGCTGGAAGG + Intergenic
948176245 2:235945844-235945866 CCATCATGGCAGAAGGCAGAGGG + Intronic
948331157 2:237166680-237166702 TCCCCATGGCACAAGATAGAGGG - Intergenic
948426978 2:237894617-237894639 CCTCCATCCCAGAAGCCAGGCGG + Intronic
949017808 2:241723347-241723369 GCTCCATGGCAGAATCTTGCCGG + Intronic
1169496449 20:6120430-6120452 CCCTCATGGGAGAAGCTAGCAGG + Intronic
1169624745 20:7552669-7552691 CCCACATGGCAGAAGATGGAAGG + Intergenic
1169846226 20:9994905-9994927 ATTCCTTGGCAGAAGGTAGAAGG + Intronic
1172080807 20:32339113-32339135 ACTCCATGGCTCAAGTTAGAGGG + Intergenic
1173089325 20:39955310-39955332 CCTCCATGGCAGAAGGGCTAGGG + Intergenic
1174698180 20:52581293-52581315 CCTCCAGGGTAGAAGCTAAATGG - Intergenic
1176512301 21:7758097-7758119 TTTACATGGCAGAATCTAGAAGG - Intronic
1178610639 21:34075608-34075630 GCCCCATGGCAGTAGATAGAAGG + Intronic
1178646413 21:34388621-34388643 TTTACATGGCAGAATCTAGAAGG - Exonic
1178842919 21:36152415-36152437 CTACCATGGCAGAAGGCAGAAGG + Intergenic
1179097961 21:38332493-38332515 CCCCCATGGCAGAAGGTGGAAGG + Intergenic
1181469776 22:23130963-23130985 CCTCCCTGGCAGATGCTCTAGGG + Intronic
1181756023 22:25025674-25025696 CTTCCATGGCAGAAACAAGAAGG - Intronic
1182363065 22:29758919-29758941 CCTCCATGGCAGCCTCCAGAGGG - Intronic
1182376248 22:29850530-29850552 CTTGCATGGCAGAAGGAAGAAGG + Intergenic
1184559784 22:45255549-45255571 CTCACATGGCAGAAGGTAGAAGG + Intergenic
1185071333 22:48658362-48658384 TGTCCATGGCAGACGCCAGATGG + Intronic
951256362 3:20453976-20453998 ATTCCATGGCAGAAGGCAGAAGG - Intergenic
951393383 3:22134771-22134793 ATACCATGGCAGAAGGTAGAAGG + Intronic
952049807 3:29370883-29370905 CCTACATGGCAGAGGCTAGAGGG + Intronic
953152776 3:40340293-40340315 CCCACATGGCAGAAGCGATATGG - Intergenic
954630687 3:52046260-52046282 GATCCTTGGCAGAAGCCAGAGGG - Intergenic
954973028 3:54667378-54667400 CCTCCAAGGCAGAGGCTGGAAGG + Intronic
957703769 3:83753358-83753380 CCACCATGGCAGAAGGTGGAAGG + Intergenic
958455069 3:94320481-94320503 CTTCCATGGCATAATGTAGAAGG + Intergenic
960353088 3:116617508-116617530 ACTCCATTCCAAAAGCTAGATGG - Intronic
961351808 3:126308885-126308907 GCTCCAGGGAAGAAGCCAGAAGG + Intergenic
962847642 3:139285920-139285942 CCACCATGGCAGAGGCTAATGGG + Intronic
964046656 3:152336402-152336424 CCTCTATGGCAGAATCCAAATGG - Intronic
964810598 3:160659717-160659739 ACTTCATGGCAGAAGGTAGAAGG - Intergenic
965629033 3:170711607-170711629 CATTCATGGCAGAAGGTAAAGGG - Intronic
967275919 3:187774413-187774435 ACTCCATGTCAGAAGTTAAAAGG - Intergenic
968022922 3:195410890-195410912 CCTCAATGGCAGAAGGTGGAAGG - Intronic
968110860 3:196045455-196045477 CCATCATGGCAGAAGGCAGAGGG + Intronic
968551890 4:1228127-1228149 CCTCCATGGACGAAGCAAGACGG + Intronic
971194131 4:24455770-24455792 ATTTCATGGCAGAAGGTAGAAGG - Intergenic
974456052 4:62130604-62130626 CCTCCATGGCAAAACCTGCAGGG - Intergenic
974495436 4:62620198-62620220 TCTCCTTGGCAGAACATAGAAGG + Intergenic
974871921 4:67654350-67654372 CCTCCATGCCAGAAGAGAGTGGG + Intronic
975740897 4:77427837-77427859 CTCACATGGCAGAAGGTAGAGGG + Intronic
976983690 4:91265955-91265977 CTTACATGGCAGCAGCAAGAGGG + Intronic
977421417 4:96804755-96804777 ATTCCATGGTAGAAGGTAGAAGG - Intergenic
980883398 4:138737355-138737377 GCTCCATGACAGAAGAGAGAAGG + Intergenic
981154464 4:141417477-141417499 CATTCATGGCAGAAGGCAGAGGG - Intergenic
981342201 4:143634553-143634575 GCTCCAAGCCAGAAGCAAGATGG + Intronic
981756094 4:148142950-148142972 CCATCATGGCAGAAGCTGAAGGG - Intronic
981918456 4:150060504-150060526 ATCCCATGGCAGAAGATAGATGG + Intergenic
982331361 4:154185192-154185214 CCTACATGGCAGAAGGCAGAGGG - Intergenic
984058765 4:174965189-174965211 CCTCCGTGGCAGAAAGCAGAAGG + Intronic
985127966 4:186714139-186714161 CAGCCAGGGCAGAAGCTGGAGGG + Intronic
986036014 5:3940756-3940778 GCTCCCTGACAGAAGCTTGAGGG + Intergenic
988257251 5:28836541-28836563 ACCCCATGGCAGAAGGCAGAAGG + Intergenic
988538346 5:32088152-32088174 CGTCCCTGGCAGAAGCTCGTGGG - Exonic
989763517 5:45050068-45050090 CAATCATGGCAGAAGCTGGAGGG + Intergenic
992212865 5:74497477-74497499 CTTACATGGCAGAAGGAAGAGGG - Intergenic
992943261 5:81784002-81784024 CCACCATGGCAGAAAAGAGATGG - Intergenic
992985572 5:82225521-82225543 CCTACAAAGCAGCAGCTAGATGG - Intronic
993443900 5:87988968-87988990 CCTCCTTGGCAGCATCTAAAGGG + Intergenic
995911508 5:117193246-117193268 CATTCATGGCAGAAGGTAAAGGG - Intergenic
998781886 5:145666345-145666367 CCTCCATCGCTGAAGCAGGAAGG + Intronic
999045159 5:148459328-148459350 CCTCCCTGTCAGAAGCATGAGGG - Intronic
1001927166 5:175646336-175646358 ACCCCATGGCAAAAGGTAGAAGG + Intergenic
1003172173 6:3728541-3728563 GCTGCATGGCATGAGCTAGAGGG + Intronic
1003385768 6:5666023-5666045 GCTCCATGGCAGGATCTGGAGGG + Intronic
1004004695 6:11628157-11628179 CCTCGAGGGCAGAAGATAGTGGG + Intergenic
1006698095 6:35948913-35948935 CCCACATGGCAGAAGGTGGAAGG - Intronic
1007633383 6:43284799-43284821 CCTCCAGGGCAGGACCTCGAGGG - Intronic
1009658788 6:66581994-66582016 CTTGCATGGCAGAAGGCAGAAGG + Intergenic
1010012835 6:71069143-71069165 ATTCCATGGCAGAAGGCAGAAGG + Intergenic
1012443618 6:99286162-99286184 CCTGCATGACAGATGCTAAAAGG - Intronic
1012712117 6:102619785-102619807 CCCCCATGTCTAAAGCTAGAGGG - Intergenic
1016029403 6:139322312-139322334 CTCACATGGCAGAAGGTAGAAGG + Intergenic
1016948990 6:149562186-149562208 CCACCATCACAGGAGCTAGAGGG - Intergenic
1017286850 6:152685843-152685865 TCAACATGGCAGAAGGTAGAAGG - Intergenic
1020205783 7:6114275-6114297 CATCCATGGCAGATGTTACAAGG + Intronic
1021976935 7:26020216-26020238 CTCACATGGCAGAAGGTAGAAGG - Intergenic
1022151165 7:27608284-27608306 CCTCCAAGGCAAAAGACAGAAGG + Intronic
1023264472 7:38391783-38391805 CCTCCCTTGCAGATGCTAGCTGG + Exonic
1023977019 7:45038020-45038042 CCTCCATGCCAGAGGCTGCATGG + Intronic
1026085563 7:67260242-67260264 CATCCGTGGCTGAAGGTAGAAGG - Intergenic
1026691604 7:72554641-72554663 CATCCATGGCTGAAGGTAGAAGG + Intergenic
1027201897 7:76069251-76069273 CCTGGAAGGCAGGAGCTAGAGGG - Intergenic
1027300249 7:76826981-76827003 CCATCATGGCAGAAGGTAAAAGG + Intergenic
1027782622 7:82538420-82538442 ATTCCATGGCAGAAGACAGAGGG + Intergenic
1029413280 7:100428694-100428716 CCTCATTGGCAGAAGCTGGGGGG + Intronic
1029446025 7:100613118-100613140 CCTCCGGGGCAGAAGGCAGAGGG + Intronic
1031426194 7:121608436-121608458 CAACCATGGCAGAAGGTAAAGGG - Intergenic
1031897277 7:127365217-127365239 TAGCAATGGCAGAAGCTAGAAGG + Intronic
1033785051 7:144719889-144719911 CCTCCAAGACTGAAGCTGGAGGG - Intronic
1033864866 7:145677318-145677340 CATCCATGGCAGAAGACAGAAGG - Intergenic
1034206249 7:149318494-149318516 CCACCATTTGAGAAGCTAGAGGG - Intergenic
1034382903 7:150714506-150714528 CAATCATGGCAGAAGCCAGAGGG - Intergenic
1036615986 8:10388025-10388047 GCTCCATTGGAGAACCTAGAAGG - Intronic
1036679498 8:10860670-10860692 CTTTCAGGGCAGAATCTAGATGG - Intergenic
1037740645 8:21606335-21606357 CTTACATGGCAGAAGGCAGAAGG - Intergenic
1038090987 8:24252762-24252784 TCCCCATGGCAGAAGGTGGAAGG + Intergenic
1040531483 8:48269926-48269948 CCTCCCTTGCACAAGCTTGATGG + Intergenic
1040739731 8:50558231-50558253 GCTCCATGGCAGCAGCTGCATGG + Intronic
1041673984 8:60519338-60519360 ACTCAATGGCAGAAGCAAGGTGG - Intronic
1041815171 8:61962299-61962321 CTTACATGGCAGAAGGTGGAAGG + Intergenic
1042004447 8:64165827-64165849 GCTCCATGGCAGCATCTAGGGGG - Intergenic
1044067037 8:87711287-87711309 CATCCATGGGAGAAGTTAGATGG + Intergenic
1044171657 8:89060402-89060424 CATCTATGGCAGCAGCAAGAGGG - Intergenic
1044831391 8:96253402-96253424 CCTACAGGACAGAAGGTAGAAGG - Intronic
1046731003 8:117726335-117726357 TCTCCATGTGAGAAGCCAGAGGG + Intergenic
1048263958 8:132968971-132968993 CCACCACGGAAGAAGATAGAAGG - Intronic
1048841966 8:138574539-138574561 CCCACATGGCAGAAAGTAGAAGG + Intergenic
1048877363 8:138847352-138847374 CCTCCAGGGCAGGAGCTCAAGGG - Intronic
1049447045 8:142635960-142635982 CTCCCATGGCAGAAGGCAGAGGG - Intergenic
1050981423 9:12020624-12020646 CCTCCATGGCACAAGTATGAAGG - Intergenic
1051336444 9:16070444-16070466 GCTCCCTTGCAGAAGCCAGAAGG + Intergenic
1051375731 9:16400539-16400561 CCCCCATGGCTGAAGGTGGAAGG + Intergenic
1051422893 9:16906014-16906036 CCTCCTTTGCAGAAGCTGGCTGG - Intergenic
1056955418 9:91077200-91077222 ACTCCATGGCAGAAGGTGGAAGG + Intergenic
1057949059 9:99355498-99355520 CCTCAATGGCAGAAGATACTTGG - Intergenic
1059201631 9:112422898-112422920 CTTCAATGCCAGAAACTAGAAGG + Intronic
1059825686 9:118026263-118026285 ATTCCATGGCAGAAGGTAGATGG + Intergenic
1061718280 9:132534942-132534964 TCCCCATGCCAGAAGCAAGAAGG - Intronic
1062667110 9:137680653-137680675 CAACCATGGCAGAAGGTAGTTGG + Intronic
1186434339 X:9529973-9529995 CCTCCATGGCAGATGCATGGAGG + Intronic
1187316710 X:18202515-18202537 CTCACATGGCAGAAGGTAGAAGG - Intronic
1188448829 X:30287128-30287150 GCTAAATGGCAGAAGCTAAAGGG - Intergenic
1189116602 X:38349547-38349569 ATTCCATGGCAGAAGGTAAAGGG - Intronic
1189201226 X:39197253-39197275 CCTTCATGGCAGAGGCTGGATGG + Intergenic
1189486517 X:41437038-41437060 CTTGCATGGCAGAAGGCAGAAGG + Intergenic
1191004783 X:55699816-55699838 TCCCCCTGTCAGAAGCTAGATGG + Intergenic
1192279345 X:69667841-69667863 ACTCCATGGCAGAAGGTGGAAGG + Intronic
1195265920 X:103179643-103179665 CTTACATGGCAGAAGGTGGAAGG + Intergenic
1197367159 X:125578406-125578428 CTTCCATGGCAGAAGGTGGGAGG + Intergenic
1198742747 X:139858089-139858111 GCCCCATGGCAGAAGGTGGAAGG - Intronic
1199378224 X:147137451-147137473 CTCCCATGGCAGAAGACAGAAGG - Intergenic
1199549173 X:149039932-149039954 ACTCCATGGCAGAAGGCAGAAGG + Intergenic
1200382978 X:155859123-155859145 ATCCCATGGCAGAAGGTAGAAGG - Intergenic
1200756361 Y:6993698-6993720 CCTCCATCTCAGAATCAAGAAGG - Intronic
1201188002 Y:11422424-11422446 CCACCACTGCAGAAGCTAAAGGG + Intergenic
1201478542 Y:14411315-14411337 AAGCCATGGCAGAAGCAAGAAGG - Intergenic