ID: 1133293234

View in Genome Browser
Species Human (GRCh38)
Location 16:4736470-4736492
Sequence CTTCTCAGTGCACCATAATC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 1, 2: 1, 3: 13, 4: 158}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133293234_1133293237 -7 Left 1133293234 16:4736470-4736492 CCGGATTATGGTGCACTGAGAAG 0: 1
1: 1
2: 1
3: 13
4: 158
Right 1133293237 16:4736486-4736508 TGAGAAGGCATCTGGAAGCCTGG 0: 1
1: 0
2: 4
3: 27
4: 366
1133293234_1133293239 3 Left 1133293234 16:4736470-4736492 CCGGATTATGGTGCACTGAGAAG 0: 1
1: 1
2: 1
3: 13
4: 158
Right 1133293239 16:4736496-4736518 TCTGGAAGCCTGGGCCCTCATGG 0: 1
1: 0
2: 2
3: 30
4: 314
1133293234_1133293238 -6 Left 1133293234 16:4736470-4736492 CCGGATTATGGTGCACTGAGAAG 0: 1
1: 1
2: 1
3: 13
4: 158
Right 1133293238 16:4736487-4736509 GAGAAGGCATCTGGAAGCCTGGG 0: 1
1: 0
2: 1
3: 28
4: 359
1133293234_1133293243 19 Left 1133293234 16:4736470-4736492 CCGGATTATGGTGCACTGAGAAG 0: 1
1: 1
2: 1
3: 13
4: 158
Right 1133293243 16:4736512-4736534 CTCATGGCATCCAACGATAAAGG 0: 1
1: 0
2: 0
3: 3
4: 39
1133293234_1133293244 24 Left 1133293234 16:4736470-4736492 CCGGATTATGGTGCACTGAGAAG 0: 1
1: 1
2: 1
3: 13
4: 158
Right 1133293244 16:4736517-4736539 GGCATCCAACGATAAAGGCATGG 0: 1
1: 0
2: 0
3: 9
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133293234 Original CRISPR CTTCTCAGTGCACCATAATC CGG (reversed) Exonic
902491259 1:16782496-16782518 CTGCTCTGAGCACCATGATCTGG - Intronic
904079624 1:27863791-27863813 CTTCTCACTGCATCATAACATGG - Intergenic
905941208 1:41864916-41864938 CTTCACAGAGCTCCTTAATCTGG + Intronic
905948924 1:41928811-41928833 CTTCTCAGTGCATCAAACTGGGG + Intronic
906084711 1:43121552-43121574 CTCCTCAGTGCAACACAGTCAGG - Intergenic
907057676 1:51386395-51386417 CTTCTCAGTGAAGCTTATTCAGG - Intronic
907999649 1:59668052-59668074 CTTCTCAGCTCATCAGAATCAGG + Intronic
909485654 1:76170408-76170430 CTTCTCTGTGCCCCATAAGCAGG + Intronic
910411451 1:86950171-86950193 CTTCTCAGCGCACCATATCAAGG - Intronic
912154904 1:106905435-106905457 CTTCTCATTGGACAATAATTTGG - Intergenic
913429200 1:118770946-118770968 CTTCTCAGTGCATCATATTGGGG + Intergenic
915956758 1:160226771-160226793 CTTCTCAGTCCATCCTAATCTGG + Intronic
916321384 1:163508746-163508768 CTTCTCAACGCATCATAATTTGG - Intergenic
917990937 1:180378160-180378182 CTTCTTAGTGCATCATATTAAGG - Intronic
918336720 1:183522699-183522721 CTTCTCAATCCACTCTAATCAGG - Intronic
920207919 1:204306498-204306520 CTTCTCAGTGCCTCAGAATTGGG - Intronic
920707479 1:208264882-208264904 ATTCTCAGTGCTCCAGAATAAGG - Intergenic
921366614 1:214380465-214380487 CTTCTCAGTGCATCAACTTCTGG + Intronic
922886392 1:229024096-229024118 CTTGTCAGTGCACCAGGTTCTGG + Intergenic
923395236 1:233555327-233555349 CTTCCCTGGGCATCATAATCAGG + Intergenic
923529180 1:234800042-234800064 CTGCTCTGAGCACCATGATCTGG + Intergenic
1062868158 10:875363-875385 CTTCAAAGTCCCCCATAATCTGG + Intronic
1063755470 10:9002184-9002206 CTTCTAAGTGCACCTTGAACTGG - Intergenic
1067019576 10:42782869-42782891 CTTCCCAGTGCCCCAGAACCAGG - Intronic
1067580801 10:47444255-47444277 CTTCTCTGTGCCCCACACTCTGG + Intergenic
1067863466 10:49878060-49878082 CTTCTCAGTGCACCGTATCAGGG - Intronic
1071348329 10:84714755-84714777 CTTCTCATTGCATCATCATGTGG + Intergenic
1075434369 10:122422462-122422484 CTTCTCAGTGGACCACTATTAGG - Intronic
1077676205 11:4195087-4195109 CTTCTCAGTGCATTGTTATCAGG + Intergenic
1079668188 11:23134399-23134421 CTTCTCCGTGCCCCACAAACAGG + Intergenic
1080581103 11:33644706-33644728 CTTCTCTGTGCACCTTTATGGGG + Intronic
1081036404 11:38151900-38151922 CTTCTTAGTGCATCATATCCTGG + Intergenic
1087309249 11:96521241-96521263 CTTCTCTGTGCCCCACAAGCAGG + Intergenic
1087637288 11:100716308-100716330 CTTCACAGTGAACCACAAGCAGG - Intronic
1088666191 11:112096330-112096352 ATTCACAGAACACCATAATCTGG - Intronic
1088945157 11:114504327-114504349 CTTCTCTGTGCCCCATAAGCAGG - Intergenic
1091552107 12:1543954-1543976 CTTCTCAGTGCATCATATCAAGG + Intronic
1093651263 12:21648303-21648325 CCTCTGAGTGTACCAAAATCTGG + Intronic
1095323403 12:40858181-40858203 CTTCTCACTGCACCTTCATTTGG + Intronic
1111546861 13:89749213-89749235 CCTCTCATTGCACAAGAATCTGG - Intergenic
1113228479 13:108185058-108185080 CTGTTCAGTGAATCATAATCTGG + Intergenic
1114995374 14:28344458-28344480 GATGTCAGTGCACCATGATCAGG - Intergenic
1116716617 14:48435151-48435173 TTTCTCAGTGCTCCTTAATATGG + Intergenic
1117388463 14:55240264-55240286 CTTCTCAGTGCAGCATCAGAAGG + Intergenic
1117505244 14:56395861-56395883 CATCTCAGTGCATCATATTGGGG - Intergenic
1118481280 14:66168849-66168871 CTTCTCAGTGCATCATATCAAGG - Intergenic
1120662801 14:87270688-87270710 CTGGTCAATGCACCATAGTCTGG - Intergenic
1121112904 14:91324489-91324511 GGTGTCAGTGCACTATAATCTGG + Intronic
1122097967 14:99385179-99385201 CTCCTCAGTGCCCCATATGCGGG + Intergenic
1124077808 15:26462276-26462298 GTTCTCTGTGCACCACAGTCAGG - Intergenic
1124888466 15:33709651-33709673 CTTCTCACTGCATCATAACATGG - Intronic
1125954185 15:43777738-43777760 GGTCTCAGTGCACCAGGATCTGG - Intronic
1126033895 15:44529641-44529663 CATCTTAGCGCACTATAATCTGG - Intergenic
1126225057 15:46261222-46261244 CTTCTCTGTGCCCCACAAGCAGG + Intergenic
1127125767 15:55810443-55810465 CTTCTCAGTGCCTCATATTAGGG + Intergenic
1127953195 15:63830272-63830294 CTTCTCAATGCATCATATTGGGG - Intronic
1133293234 16:4736470-4736492 CTTCTCAGTGCACCATAATCCGG - Exonic
1137766702 16:50983005-50983027 CTTGTTACTGCAGCATAATCAGG + Intergenic
1139832695 16:69812754-69812776 CTTCTCAGTGCAGCATATCTGGG + Intronic
1142758352 17:2028873-2028895 CTTCTCCCTGCACCTTAATTAGG + Intergenic
1143940407 17:10535040-10535062 CTTCAGAATACACCATAATCAGG + Intronic
1146613245 17:34327208-34327230 CTTCTCAGTGCACCATTATCAGG - Intergenic
1151006668 17:70445650-70445672 CTTCTCAGTGCATCATATCATGG - Intergenic
1155519266 18:26652807-26652829 CTTCTCACTGCTACTTAATCTGG + Intronic
1155600282 18:27538114-27538136 CTTCTCAGTGCATCATATCAAGG - Intergenic
1157438889 18:47695058-47695080 CTTTTAAGTGCACAATAGTCTGG + Intergenic
1158154365 18:54408773-54408795 CTTCTCAGTGCACCAAATTGTGG + Intergenic
1159988989 18:74880199-74880221 CTTCCCACTGCAGCATATTCAGG - Intronic
1161366223 19:3881238-3881260 CCTCTAAGTGCACCATTTTCAGG + Intronic
1162727136 19:12696451-12696473 GTTCTCAGTCCGCCAAAATCCGG - Exonic
1165336811 19:35176371-35176393 CTTCTCCCTCCACCCTAATCAGG - Intergenic
1165376454 19:35446174-35446196 CCCCTCAGTCCACCCTAATCTGG - Intronic
925439597 2:3873103-3873125 CTTCTAAATGCACTTTAATCAGG + Intergenic
925886601 2:8398938-8398960 CCTCTCAGAGCACCATGCTCTGG + Intergenic
925925560 2:8667656-8667678 CTTCTCAGTGCAACCTATTGGGG + Intergenic
928126419 2:28619794-28619816 CTTCTGAGGTCACCATAATCTGG - Intronic
928886827 2:36158836-36158858 CTTCTCAGTGCACCAGATCAGGG + Intergenic
929705891 2:44211456-44211478 CTTCTCAGTGCATCACAATCAGG + Intronic
929732447 2:44510403-44510425 CTTCTCAGTGAATCATACTGGGG + Intronic
929784772 2:44981453-44981475 CTTGTCAGTCCACCATAGTGAGG - Intergenic
939129778 2:138221292-138221314 TTTCTCTGAGCACCAAAATCTGG + Intergenic
939617684 2:144379047-144379069 CCTCTGAGTGCACCATTTTCTGG + Intergenic
941841507 2:170089440-170089462 CTTCTCAGTGAATCATATTTAGG - Intergenic
942525913 2:176852734-176852756 CTTTTAAGTGCACCATATTGAGG + Intergenic
947063943 2:226198803-226198825 CTTCTCGGTCCACTGTAATCTGG - Intergenic
947696139 2:232191073-232191095 CTCCTCAGTTGACTATAATCTGG - Intronic
948230265 2:236344141-236344163 CTGCTAAGTGCACCACATTCGGG - Intronic
1169795132 20:9454223-9454245 CTTCTCAGTCCACGATATTGGGG + Intronic
1172496651 20:35390814-35390836 CTTCTCAGTGCATCATATCAGGG - Intronic
1173054541 20:39598241-39598263 CTTCTCAGTTCACACTAATCTGG + Intergenic
1173443348 20:43096661-43096683 CTTCTCAGTGCATCTGGATCTGG - Intronic
1173850005 20:46211678-46211700 CTTCACAGAGCAGCAGAATCAGG - Intronic
1177750372 21:25275346-25275368 CTTCTCAGTTCTCCAAAATTTGG - Intergenic
1178470040 21:32884422-32884444 CTGCCCAGGGCACCATCATCTGG - Intergenic
1179005836 21:37513274-37513296 CTTCTCAGTGCACCTTGGTTAGG - Intronic
1182673454 22:32017525-32017547 TTTCTCAGTGCAGAATTATCAGG - Intergenic
1183758057 22:39789371-39789393 CTCCTCAAAACACCATAATCTGG + Intronic
1184186327 22:42867636-42867658 CTTCTGAGTGGACCAGGATCTGG + Intronic
949696199 3:6699152-6699174 TTTCTCAATCCACCAAAATCAGG + Intergenic
951673079 3:25206443-25206465 CTACTCAGGGCAGCATAATGAGG + Intronic
954157982 3:48698135-48698157 CTTCTCAGAGCTCCATCTTCTGG - Intronic
955963088 3:64361159-64361181 CTTCTCAGTGCAGCATGTTGGGG - Intronic
961981698 3:131086071-131086093 CTTCTCAGTACATCATATTAAGG + Intronic
964062111 3:152537514-152537536 CTTCTCTGTGCCCCACAAGCAGG + Intergenic
964459494 3:156908086-156908108 CTTCTCAGTGCATCATATCAGGG + Intronic
966457352 3:180132964-180132986 CTTGTCAATGCACCACAATGTGG + Intergenic
966714234 3:183000085-183000107 CTTCTCTGTGCCCCACAAACAGG + Intergenic
969495433 4:7523608-7523630 CTGCTCAGTCCACCATGAGCCGG + Intronic
974603709 4:64122398-64122420 CTTCTCTGTGTACCACAAGCAGG + Intergenic
977836887 4:101655647-101655669 GATCTGTGTGCACCATAATCTGG - Intronic
979503786 4:121469971-121469993 CTACTCAGTGCATCATACTGTGG + Intergenic
980427249 4:132642154-132642176 TTTCTCAGTGCATCATATTTTGG + Intergenic
984176908 4:176430322-176430344 CTTCTCAATGCACCCTCACCTGG - Intergenic
985277627 4:188253669-188253691 TTTCTCTGTGCATCGTAATCAGG + Intergenic
986790452 5:11154564-11154586 CTTCTCAGTGCTGCATCCTCAGG + Intronic
987418618 5:17691972-17691994 CTCCTCAGGGCACCAGGATCTGG - Intergenic
987513593 5:18875443-18875465 CTTCTCAGTTGATTATAATCTGG - Intergenic
988220397 5:28338403-28338425 CTGCTCAGTGCACCTTCATGTGG - Intergenic
988421977 5:31016839-31016861 CTCCTCAGTCCACTTTAATCTGG - Intergenic
988927522 5:36004562-36004584 CTTCTCAGTTCTCCAGTATCTGG - Intergenic
989249951 5:39301151-39301173 ATTCTCAGTGCATCATATTATGG - Intronic
990781755 5:59372592-59372614 CTTCTCTGTGCCCCACAAGCAGG - Intronic
993395405 5:87381036-87381058 CTGCTCATTGTACCATAATTAGG + Intronic
994736022 5:103557480-103557502 CTCATCAGTCTACCATAATCTGG + Intronic
995088149 5:108140005-108140027 CTCCTCAGTGTATTATAATCTGG + Intronic
999270739 5:150295107-150295129 CTTCTCAGGGCACCAGGAACAGG + Intergenic
1005053860 6:21711305-21711327 CTTCTCACTGCAGTATAGTCTGG - Intergenic
1006269818 6:32955583-32955605 CTTCTCAGCCCACCACAATCTGG - Intronic
1008701931 6:54111114-54111136 CTTCTCATTGCTGCACAATCTGG + Intronic
1010567812 6:77438919-77438941 CTTCTCAGTGCATTATATTAAGG - Intergenic
1012350439 6:98243737-98243759 CTTTTAAGTGTACCACAATCTGG + Intergenic
1012926280 6:105271350-105271372 CTTCTCAGTGCATCCTATTGGGG - Intergenic
1013293566 6:108739223-108739245 CTTCCAAGTGCCCCATAAACTGG + Intergenic
1013888389 6:114998713-114998735 CTTCTCACTGTGCCATGATCTGG - Intergenic
1013934452 6:115576863-115576885 TTTCTCACTGCAACATAAGCTGG - Intergenic
1014295279 6:119610054-119610076 CTTCTCAGCCCACTACAATCTGG - Intergenic
1015325561 6:131919215-131919237 CTTCTCTGTGCCCCACAAGCAGG - Intergenic
1016051969 6:139539179-139539201 CTCCTCAGTGAACCAGAAACTGG - Intergenic
1018014517 6:159699888-159699910 GTTCTCAGTGGACCACAATCTGG - Intronic
1020603037 7:10300474-10300496 CCTCTCCCTGCATCATAATCAGG + Intergenic
1021061279 7:16116215-16116237 CTTCTCAGTGCATCATATCAGGG - Intronic
1022241708 7:28518588-28518610 CTTCTCAGTGCTCTAGAATGTGG + Intronic
1024572190 7:50732542-50732564 CCTCTCAGGGCACCATAGTTGGG - Intronic
1031756033 7:125643840-125643862 CTTCTTATTGCTCCAGAATCTGG + Intergenic
1035469954 7:159103364-159103386 CTTCTCAATGCCCCAGAATGTGG + Intronic
1035632485 8:1119144-1119166 CATCTCAGTGCAAAATAATATGG - Intergenic
1037332462 8:17756838-17756860 CTTCTCAGTGTACCCTAATTTGG - Intronic
1039859883 8:41448004-41448026 TTTCTCAGTGTCCCAGAATCTGG + Intergenic
1040089816 8:43386358-43386380 CTGCTCACTGCACCATAGCCTGG + Intergenic
1041253026 8:55953183-55953205 CTTCACAGGGCACCATAGTGGGG - Intronic
1043283901 8:78504894-78504916 CTTCTCAGTGTGCCATATTAGGG - Intergenic
1043508845 8:80930380-80930402 CTCCCCAGTGCAACAAAATCAGG - Intergenic
1043649305 8:82568723-82568745 CTTCTCTCTGCACTATAGTCTGG - Intergenic
1050391234 9:5146516-5146538 CTTCTCTGTGCCCCATAAGCAGG + Intronic
1053785608 9:41650561-41650583 CTCCTCAGTCCACCAGATTCTGG + Intergenic
1054159425 9:61663616-61663638 CTCCTCAGTCCACCAGATTCTGG - Intergenic
1054174327 9:61864527-61864549 CTCCTCAGTCCACCAGATTCTGG + Intergenic
1054449184 9:65393572-65393594 CTCCTCAGTCCACCAGATTCTGG + Intergenic
1054479197 9:65594621-65594643 CTCCTCAGTCCACCAGATTCTGG - Intergenic
1054663211 9:67716264-67716286 CTCCTCAGTCCACCAGATTCTGG - Intergenic
1056907360 9:90665363-90665385 CTTCTCTGTGCCCCACAAGCAGG + Intergenic
1060464599 9:123891934-123891956 CCCCTCCTTGCACCATAATCTGG - Intronic
1187451924 X:19405301-19405323 CTTCTCAGTGCCTCATAACAAGG - Intronic
1187631657 X:21179536-21179558 TTTATCAGTGCATCATAATATGG - Intergenic
1191642396 X:63441633-63441655 CGTCTCAGTGCTCCACAATCAGG - Intergenic
1192620708 X:72677240-72677262 CTTCTCAGTGCATCATAGCAGGG + Intronic
1193530123 X:82645975-82645997 CTTCTCAGTGGACCATAGAGGGG + Intergenic
1195346440 X:103954712-103954734 CTTCTCTGTGCCCCACAAGCAGG - Intronic
1195567809 X:106363204-106363226 CTTCTCTGTGCCCCACAAGCAGG + Intergenic
1196100870 X:111845847-111845869 CTTCTCCTTGCACATTAATCTGG + Intronic
1197404208 X:126029771-126029793 CTTCTCTGTGCACCACAAGCAGG + Intergenic
1197480859 X:126984217-126984239 ATTCTAAGTGCACCACAACCAGG - Intergenic
1198644052 X:138787264-138787286 TTTCTCTGTGCAGCAAAATCTGG - Intronic
1200175853 X:154115749-154115771 TTTCTCAGTGCGCCAAACTCAGG - Intergenic