ID: 1133298474

View in Genome Browser
Species Human (GRCh38)
Location 16:4767160-4767182
Sequence CGTGCGGGTGGGCCCGCAGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 142}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133298462_1133298474 10 Left 1133298462 16:4767127-4767149 CCGAAGACCCTAAACCAGGGGTG 0: 1
1: 0
2: 0
3: 15
4: 113
Right 1133298474 16:4767160-4767182 CGTGCGGGTGGGCCCGCAGGCGG 0: 1
1: 0
2: 0
3: 12
4: 142
1133298457_1133298474 22 Left 1133298457 16:4767115-4767137 CCAGAGCCGGGGCCGAAGACCCT 0: 1
1: 0
2: 0
3: 12
4: 77
Right 1133298474 16:4767160-4767182 CGTGCGGGTGGGCCCGCAGGCGG 0: 1
1: 0
2: 0
3: 12
4: 142
1133298466_1133298474 -4 Left 1133298466 16:4767141-4767163 CCAGGGGTGCAAACCAGGCCGTG 0: 1
1: 0
2: 2
3: 9
4: 98
Right 1133298474 16:4767160-4767182 CGTGCGGGTGGGCCCGCAGGCGG 0: 1
1: 0
2: 0
3: 12
4: 142
1133298463_1133298474 3 Left 1133298463 16:4767134-4767156 CCCTAAACCAGGGGTGCAAACCA 0: 1
1: 0
2: 0
3: 3
4: 94
Right 1133298474 16:4767160-4767182 CGTGCGGGTGGGCCCGCAGGCGG 0: 1
1: 0
2: 0
3: 12
4: 142
1133298458_1133298474 16 Left 1133298458 16:4767121-4767143 CCGGGGCCGAAGACCCTAAACCA 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1133298474 16:4767160-4767182 CGTGCGGGTGGGCCCGCAGGCGG 0: 1
1: 0
2: 0
3: 12
4: 142
1133298464_1133298474 2 Left 1133298464 16:4767135-4767157 CCTAAACCAGGGGTGCAAACCAG 0: 1
1: 0
2: 0
3: 14
4: 149
Right 1133298474 16:4767160-4767182 CGTGCGGGTGGGCCCGCAGGCGG 0: 1
1: 0
2: 0
3: 12
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133298474 Original CRISPR CGTGCGGGTGGGCCCGCAGG CGG Exonic