ID: 1133300233

View in Genome Browser
Species Human (GRCh38)
Location 16:4777982-4778004
Sequence GGTCTTGGAGGTGGGAGCTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 822
Summary {0: 1, 1: 1, 2: 7, 3: 80, 4: 733}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133300233 Original CRISPR GGTCTTGGAGGTGGGAGCTG GGG Exonic
900330224 1:2130465-2130487 GGTCTCCGAGGTGGGAGTTTTGG - Intronic
900422185 1:2560453-2560475 AGTCTTGGAGGTGGGGCCTGGGG - Intronic
900566852 1:3337558-3337580 GGCCCTTGGGGTGGGAGCTGGGG + Intronic
900708325 1:4094409-4094431 GGCCGTGGGGGTGGGAGGTGAGG + Intergenic
900765482 1:4502164-4502186 GGTCCAGGGGGTGGGTGCTGGGG - Intergenic
900906288 1:5561875-5561897 GGTGGTGGTGGTGGGAGGTGTGG + Intergenic
901031565 1:6310182-6310204 CCACTTGGAGGCGGGAGCTGAGG + Intronic
901036001 1:6336657-6336679 GGTATTGCAGGTGGGGGCAGAGG - Intronic
901133202 1:6975788-6975810 GGGCTTGGGGGTGATAGCTGAGG - Intronic
901386144 1:8910552-8910574 AGTCTTGGAGGTGGGAGGAGAGG + Intergenic
901686743 1:10947561-10947583 CGGCCTGGAGGTGGGGGCTGGGG - Intronic
901843772 1:11969664-11969686 GGTCATTGAGGTGTCAGCTGGGG + Intronic
902408328 1:16198646-16198668 GGTTTCGGAGGCGGGCGCTGAGG + Exonic
902695061 1:18134664-18134686 GGTCTTTGTGGTGGGTGCTGTGG - Intronic
903026889 1:20435737-20435759 TGTCTTTGAGTTGGGATCTGTGG - Intergenic
903298175 1:22359137-22359159 AGTGTTGGAGGTGGGGCCTGGGG + Intergenic
903371870 1:22841680-22841702 AGTCTTGAAGGTGGGAGCAGGGG + Intronic
903650247 1:24917535-24917557 CTTCATGGAGGAGGGAGCTGAGG + Intronic
903658459 1:24963046-24963068 GGTCTGAGAGCTGAGAGCTGTGG - Intronic
903792140 1:25901157-25901179 CCTCTTTGAGGTGGGGGCTGGGG - Intronic
904200861 1:28818289-28818311 GGTCTGGGCAGTGAGAGCTGAGG - Intronic
904578796 1:31524280-31524302 AGTCCGGGAGTTGGGAGCTGAGG - Intergenic
904627460 1:31815069-31815091 GGTCTTGGAGCTGCTAGCTGTGG - Exonic
904882398 1:33710857-33710879 GGACTTGGTGGTGGGACATGTGG - Intronic
905217006 1:36415935-36415957 GGCCTTGGAGGTGGGCCGTGAGG - Intronic
905410410 1:37764647-37764669 GTGATTGGAGGTGGGAGGTGCGG - Intronic
905649531 1:39647035-39647057 GGGGGTGGGGGTGGGAGCTGGGG + Intergenic
906289755 1:44612013-44612035 GGTCTGGGAGGTGGGAGATGAGG - Intronic
906369135 1:45237259-45237281 AGTGTTGGAGGTGGGACCCGGGG + Intronic
906708478 1:47912070-47912092 TCTCTTGGAGGAGGGGGCTGAGG + Intronic
907027189 1:51131976-51131998 AGTCTAGGAATTGGGAGCTGAGG + Intronic
907187011 1:52617224-52617246 TGGATTGGAGGAGGGAGCTGGGG - Intergenic
907439995 1:54473110-54473132 GAGCTTGGATGTGGGGGCTGGGG + Intergenic
907459321 1:54595967-54595989 GGGCTTGGAGGCCGGAGCTGGGG + Intronic
907492352 1:54816197-54816219 GGTTTTGGAGGTGCCAGCAGAGG - Intronic
907559721 1:55377568-55377590 GGTATGGGAGCTGGGAGGTGAGG - Intergenic
907782797 1:57582653-57582675 GGTGCTGGATGTGGCAGCTGAGG + Intronic
908355882 1:63324234-63324256 GGGCTCGGCGGTGGGCGCTGGGG + Exonic
908395936 1:63725691-63725713 AGTATTGGAGGTGGGGCCTGGGG - Intergenic
908546407 1:65166598-65166620 AGTCTGGGAGGTTGAAGCTGCGG - Intronic
908919549 1:69172702-69172724 GTTCTGGGAGGTGGGAGAAGAGG + Intergenic
909415500 1:75401613-75401635 GGGCTGGGTGGTGTGAGCTGGGG + Intronic
909576584 1:77183438-77183460 GGTGTTGGAGGTGGCTCCTGAGG - Intronic
909945983 1:81663346-81663368 GATCCGGGAGGTGGGAGGTGAGG - Intronic
910201291 1:84702624-84702646 GGGCTGGGGGTTGGGAGCTGCGG - Intergenic
910348038 1:86263483-86263505 GGCCGTGGAAGTGGGAGCAGAGG + Intergenic
910769129 1:90813120-90813142 GGTGTAGGGGGTGGGTGCTGAGG - Intergenic
910952537 1:92666456-92666478 AGGCTGGGAGGTGGGGGCTGAGG + Intronic
910952550 1:92666483-92666505 GGGCTGGGAGGTGGGGGCTGAGG + Intronic
911017068 1:93345442-93345464 GGGCTTGGGGGTGGGAGGTGGGG - Intergenic
911585515 1:99685707-99685729 GGTCCAGGAGGTGACAGCTGTGG - Intronic
913011332 1:114686793-114686815 GGTCTGGTAGGTTGGAGATGAGG + Exonic
913059792 1:115194348-115194370 GGTCAGGGAGGTGGGAGAGGGGG + Intergenic
913446774 1:118958671-118958693 TCTCTGGGAGGTGGGAGGTGGGG - Intronic
914386676 1:147175944-147175966 GGACTTGGGGGTGGGGGGTGGGG + Intronic
914462427 1:147897562-147897584 TGTGTTGGAGGGGGGAACTGGGG - Intergenic
915033652 1:152905059-152905081 GTTCTTGGATCTGAGAGCTGTGG - Intergenic
915105963 1:153535351-153535373 GGGCTTGGAGCTGGCAGCAGAGG + Exonic
915128529 1:153681640-153681662 GGGCATGGAGGTGGGAGCTGTGG - Intronic
915280588 1:154819709-154819731 GGGCTGGGTGGTGGGAGCTCAGG + Intronic
915317786 1:155039316-155039338 GGTGTTGCAGGTGGGTGCTCTGG + Intronic
915322675 1:155064175-155064197 GGTCTTGGAGCATGGAGCTGGGG + Intronic
915396622 1:155590037-155590059 AGTGTTGGAGGTGGGGGCGGGGG + Intergenic
915759100 1:158292783-158292805 GATCCTGGAGGTGGCATCTGAGG + Exonic
916365037 1:164017233-164017255 GGGCTTGGAGGTTGGGGCTGAGG - Intergenic
916373795 1:164129331-164129353 GTACTTGGAGGTGGGAGCTTTGG - Intergenic
916723662 1:167504001-167504023 GGACTTGGAGGGAGGAGTTGAGG - Intronic
916792006 1:168133349-168133371 GTTCCTGGACGTGGGATCTGTGG - Intronic
916812521 1:168317966-168317988 GGTTCTGGAGGATGGAGCTGTGG + Intergenic
917074649 1:171191734-171191756 GGTCTTGGGGCTGGGCGCAGTGG + Intronic
917445039 1:175099701-175099723 GGTTAGGGAGGAGGGAGCTGGGG + Intronic
917636602 1:176943203-176943225 GGTCCGGGAGGTGCCAGCTGGGG + Intronic
917650274 1:177069488-177069510 GCAGTTGGGGGTGGGAGCTGTGG + Intronic
917817711 1:178726323-178726345 GAGCTTCGAGGGGGGAGCTGGGG - Intronic
918087643 1:181259012-181259034 GGTGGTGGGGGTGGGAGGTGGGG + Intergenic
919124976 1:193382575-193382597 GGTGTTGGGGGTGGGTCCTGAGG + Intergenic
919973148 1:202593643-202593665 GGCTTTGGAAGTGGAAGCTGAGG - Exonic
920408228 1:205736364-205736386 GGTCGTGGGGGTGGGAGATATGG + Intronic
920457184 1:206110218-206110240 GGACTTGGAGCTGGCAGATGGGG - Exonic
920536818 1:206742793-206742815 AGTGTTGGCGGTGGGGGCTGAGG + Intergenic
921046982 1:211484819-211484841 GGCCTTGGAGGTGAAAGCTGGGG - Intronic
922348777 1:224718737-224718759 GTTCTTTGATGTGGGAGCAGAGG + Intronic
922629508 1:227091294-227091316 AGTGTTGGAGGTGGGGCCTGGGG + Intronic
923047968 1:230369365-230369387 GGTCATGGAGGGGTGAGCAGAGG - Intronic
923201542 1:231717375-231717397 GGTGTTGGTAGTGGTAGCTGGGG + Intronic
923342137 1:233016895-233016917 GGTCAGGGAGGTGGGGGCTGAGG - Intronic
923475196 1:234325288-234325310 TGTCTGGGAGGGGGCAGCTGGGG + Intergenic
923917900 1:238529765-238529787 GGTCATGGTGGGGGGAGCAGGGG + Intergenic
924243006 1:242057783-242057805 GGTCATGGCTGTGGGAACTGTGG + Intergenic
924747739 1:246852876-246852898 AACCTTGGAGGTGGGTGCTGTGG - Intronic
1063056779 10:2513484-2513506 TGGCTTGGAGGTGGCAGGTGTGG + Intergenic
1063361551 10:5463292-5463314 GCTGCTGGAGATGGGAGCTGGGG - Intergenic
1063557180 10:7091984-7092006 AGTGTTGGAGGTGGGGCCTGGGG - Intergenic
1063624553 10:7676886-7676908 GGTCTTGCAGGTGGGAGAAGGGG - Intergenic
1065705457 10:28468096-28468118 GATGTGAGAGGTGGGAGCTGTGG - Intergenic
1065871355 10:29959034-29959056 GTATTTGGAGGTGGGACCTGGGG + Intergenic
1066298509 10:34076542-34076564 GGTATTGGAGGTGGAGGCTTGGG + Intergenic
1066626286 10:37409160-37409182 AGGTTGGGAGGTGGGAGCTGTGG + Intergenic
1067092158 10:43273047-43273069 GGTCTTGGAGGGGACAGCTAAGG + Intergenic
1067414611 10:46094058-46094080 TGTGTAGGAGGTGAGAGCTGCGG - Intergenic
1067419700 10:46134847-46134869 GTTCCTGGAGGTGTGGGCTGGGG - Intergenic
1067426318 10:46214564-46214586 GTTCCTGGAGGTGTGGGCTGGGG + Intergenic
1067439060 10:46298053-46298075 TGTGTAGGAGGTGAGAGCTGCGG + Exonic
1067510024 10:46886880-46886902 GGGCAAGGAGGTGGGAGCTCAGG + Intergenic
1067652230 10:48164978-48165000 GGGCAAGGAGGTGGGAGCTCAGG - Intronic
1067677701 10:48399357-48399379 GTTCTTGTAAGTGGCAGCTGTGG + Intronic
1068577207 10:58697918-58697940 TGTCATGGGGGTGGGAGGTGGGG - Intronic
1069059920 10:63884796-63884818 ACACTTGGAGATGGGAGCTGGGG - Intergenic
1069176724 10:65298988-65299010 GGCCTTGGTGGTGGAAGTTGGGG - Intergenic
1069819160 10:71217018-71217040 GGACTTGGGGGTGGGAGCCTGGG + Intronic
1070028700 10:72656473-72656495 GGTCTTGGGGCTGGGCGCGGTGG + Intergenic
1071266109 10:83966318-83966340 GGGCTGGGAGCTTGGAGCTGGGG - Intergenic
1071527181 10:86365572-86365594 GGTCTGGGTGGTGGGAGCCGAGG - Intronic
1071564134 10:86662877-86662899 GGCCCTGGAGATGGGAGATGTGG + Intronic
1072048458 10:91680477-91680499 GGAGTTGGAGACGGGAGCTGGGG - Intergenic
1072405001 10:95142802-95142824 CCTCTTGGAGCAGGGAGCTGGGG + Intergenic
1072464621 10:95651751-95651773 AGTGTTGGAGGTGGGGCCTGTGG - Intronic
1072773539 10:98165799-98165821 GGTGTTGGAGGTGGGGCCTTTGG + Intronic
1072791657 10:98322252-98322274 GCTCTTGGAGGAGGAAACTGAGG + Intergenic
1073287204 10:102396178-102396200 AGACTTGGAGATGGGAGGTGGGG + Intronic
1073653538 10:105387510-105387532 GGATTTGGAGGTGGGATCTTTGG + Intergenic
1073696883 10:105879566-105879588 AGTCTTGGAGGTGGGGACTAAGG - Intergenic
1074171763 10:110946783-110946805 AGTCTTGGAGGTTGGAGGTAAGG + Intronic
1074493519 10:113959393-113959415 TCTCTTGGATTTGGGAGCTGGGG - Intergenic
1075721953 10:124592622-124592644 TGCCCAGGAGGTGGGAGCTGTGG + Intronic
1076312211 10:129516699-129516721 GTTATTGGTGGTGGGGGCTGGGG - Intronic
1076378296 10:130007334-130007356 AGTGTTGAAGGTGGGACCTGTGG + Intergenic
1076387936 10:130071996-130072018 ATTCTAGGAGGTGGGAGGTGGGG - Intergenic
1076672586 10:132131356-132131378 GGTGTGGGAGATGGGAGCTCTGG + Intronic
1076761109 10:132606177-132606199 GGACTTGCTGGTAGGAGCTGGGG + Intronic
1076771801 10:132670118-132670140 GGTCTTGGGGGTGGAGGCTGAGG - Intronic
1076776228 10:132699618-132699640 GCTCTTGGGGGTGGGGGCCGAGG + Intronic
1076916622 10:133425626-133425648 GGACGTGGAGGTGGGAGCGGGGG + Intergenic
1076936726 10:133570421-133570443 GGACGTGGAGGTGGGAGCGGGGG + Intergenic
1077101203 11:823407-823429 GGTTTTGGGGTTGGGAGCTGCGG + Intronic
1077328045 11:1972091-1972113 GGTCTTGGAGGAGGTAGGGGAGG + Intronic
1077405097 11:2379215-2379237 GGACCTGGGGGTGGGGGCTGAGG + Intronic
1077405109 11:2379246-2379268 GGACCTGGGGGTGGGGGCTGAGG + Intronic
1077613380 11:3658852-3658874 GGTATTGGAGGTGGGAACTGAGG - Intronic
1077634929 11:3835922-3835944 GGGCTGGGAGGAGGAAGCTGGGG + Intronic
1078108647 11:8374265-8374287 GGGGTTGGGGGTGGGAGCTAGGG - Intergenic
1079458712 11:20660768-20660790 GGTCTTGGATGTGGGCTCAGGGG + Intergenic
1079927944 11:26519698-26519720 GTTCTTGGAGGTGGGGCCTTTGG - Intronic
1081110140 11:39125944-39125966 GGTGTTGGAGGTGGCTCCTGAGG - Intergenic
1081608710 11:44545405-44545427 GGTGTTGGAGGTGGCTTCTGAGG - Intergenic
1081616457 11:44594341-44594363 GGTCATGGAGGTGAGGGGTGAGG + Intronic
1081727068 11:45337635-45337657 GGTATTACAGGTGTGAGCTGTGG + Intergenic
1082808049 11:57462335-57462357 GGCTGAGGAGGTGGGAGCTGAGG - Intronic
1082986337 11:59173317-59173339 GGTCCTGGGTGTGGGAACTGGGG + Intronic
1083363947 11:62130135-62130157 GCCCTGGGAGGTTGGAGCTGTGG - Exonic
1083736921 11:64686652-64686674 TGGCTTGGAGTAGGGAGCTGGGG - Intronic
1084267582 11:68012790-68012812 TGTGAGGGAGGTGGGAGCTGAGG + Intronic
1084615306 11:70231847-70231869 GGTCTTGGAAGTGGGAGCCAAGG - Intergenic
1084757745 11:71250467-71250489 GGATTGGTAGGTGGGAGCTGTGG - Intronic
1085404619 11:76254622-76254644 GAGCTGGGTGGTGGGAGCTGTGG - Intergenic
1085413455 11:76305532-76305554 GGCCCTGGAGGGGTGAGCTGGGG + Intergenic
1085711306 11:78831336-78831358 GAGCTGGGAGCTGGGAGCTGGGG - Intronic
1086071592 11:82805664-82805686 GGTCTTAGAGGTGGAAGAGGAGG + Intergenic
1086141674 11:83506522-83506544 GGTGTTGGAGGTGGCTCCTGAGG + Intronic
1086306660 11:85486903-85486925 GGTCTTGGTGGTGGCAGTGGTGG - Intronic
1086337006 11:85810626-85810648 GGGCTTGGGGCTGGGTGCTGGGG - Intronic
1087234827 11:95706287-95706309 GGGCTGGGTGTTGGGAGCTGAGG + Intergenic
1088449025 11:109962899-109962921 GGTGTTGGGGGTGGGTCCTGAGG - Intergenic
1088909744 11:114181852-114181874 TGACATGGAGGTGGGAGATGCGG - Intronic
1089325666 11:117655140-117655162 GGGCATGGAGATGGCAGCTGGGG - Intronic
1089750868 11:120650160-120650182 TGTACTGGAGATGGGAGCTGCGG + Intronic
1089781424 11:120875678-120875700 TGGCATGGGGGTGGGAGCTGTGG - Intronic
1091267755 11:134283731-134283753 GGTCTTGCAGGAGCCAGCTGGGG - Exonic
1202811024 11_KI270721v1_random:27271-27293 GGTCTTGGAGGAGGTAGGGGAGG + Intergenic
1091468936 12:709832-709854 GAGGTTGGAGGTGGGAGGTGAGG + Intergenic
1093602084 12:21039886-21039908 AGGATTGGAGGTGGGAGGTGGGG - Intronic
1093807356 12:23450644-23450666 TACCTTGAAGGTGGGAGCTGTGG + Intergenic
1093964227 12:25308497-25308519 GGTGTTGGGGGTGGGTCCTGAGG - Intergenic
1094300401 12:28958212-28958234 GGTCTTGGTGGTGGTAACTGAGG + Intergenic
1094301303 12:28967643-28967665 GGCCTTGGAGCTGAGGGCTGAGG - Intergenic
1094496028 12:30989949-30989971 GGTGCTGGAGGTGGCAGATGGGG - Intronic
1095262810 12:40116904-40116926 AGTATTGGAGGTGGGGCCTGTGG - Intergenic
1095615954 12:44188704-44188726 GCTGTGGGAGGTGGGAGCAGAGG - Intronic
1095633914 12:44408906-44408928 GGGCTGGGAAGTGGGAGATGGGG + Intergenic
1095702281 12:45202636-45202658 GGGGTTGGGGGTGGGAGGTGAGG - Intergenic
1096235859 12:49925867-49925889 GGCCTTGGACAGGGGAGCTGGGG + Intergenic
1096244529 12:49976710-49976732 GGGCTGTGGGGTGGGAGCTGGGG - Exonic
1096365807 12:51027259-51027281 GGCCTGGGAGGTGGAGGCTGCGG + Intronic
1096526074 12:52211144-52211166 GAGCATGGAGGTGGGAGCTGAGG + Intergenic
1096965090 12:55619672-55619694 GGAATGGGAGGTGGGGGCTGAGG + Intergenic
1096983498 12:55742574-55742596 GGTCATGGAGATGGGAACAGCGG - Intergenic
1097195249 12:57239362-57239384 TGTCTTGGAGGCGGGAGTGGCGG - Intronic
1098786731 12:74767819-74767841 GGTCTGGGAGGTGGGAGAAATGG + Intergenic
1099813984 12:87621665-87621687 GGTGTTGGAGGTAGGCCCTGAGG + Intergenic
1100049903 12:90435482-90435504 GGTGTTGGGGGTGGGTCCTGAGG - Intergenic
1101051332 12:100867062-100867084 GGGGCTGGAGGTGGGAGGTGAGG + Intronic
1101190122 12:102324073-102324095 GGAATTGGAGCTGGGATCTGAGG + Intergenic
1101901134 12:108792123-108792145 GTCCCTGGAGATGGGAGCTGGGG + Intronic
1102173750 12:110861186-110861208 AGTGTTGGAGGAGGGACCTGGGG - Intronic
1102231227 12:111263909-111263931 GGACTTTGAGGTGGGATGTGGGG + Intronic
1102581296 12:113889968-113889990 AGCCTTGGAGCAGGGAGCTGGGG - Intronic
1102681925 12:114696646-114696668 GGCCTTTGAGCTGGGAGCTGGGG - Intergenic
1102887637 12:116533818-116533840 GGGTGGGGAGGTGGGAGCTGGGG + Intergenic
1102910810 12:116712668-116712690 GGCTTTGGAGGTGGGAGTTGAGG - Exonic
1103034655 12:117646835-117646857 GGACTTGGAGGTGGTGGCTGGGG - Intronic
1103336561 12:120194567-120194589 GGCGTTGGAGGTGGTGGCTGTGG - Intronic
1103396183 12:120609000-120609022 GGTGTTGGTGGTGGGTCCTGAGG - Intergenic
1103556271 12:121768615-121768637 GGACTGGGAGGTGGAGGCTGGGG - Intronic
1103772058 12:123335049-123335071 GGGCATGGTGGTGGGACCTGTGG + Intronic
1103922023 12:124404103-124404125 TCTTTTGGAGGTGGAAGCTGGGG + Intronic
1103954659 12:124569233-124569255 GGTCTTGGAGAGGGAAGCGGGGG + Intergenic
1103992805 12:124810459-124810481 GGTCTGGGAGGGGGAAGCTGTGG - Intronic
1104468001 12:129005650-129005672 TGGCTTGGAGGGGGAAGCTGAGG + Intergenic
1104475015 12:129063932-129063954 GGTCATGGAAGTGGAAGTTGGGG + Intergenic
1104771778 12:131368437-131368459 GGCCTTTGAGGTTGGGGCTGGGG + Intergenic
1104923185 12:132301655-132301677 GCCCTTGGAGGAGGGACCTGGGG + Intronic
1105436135 13:20379947-20379969 AGTTTTGGAGGGGGAAGCTGAGG - Intergenic
1106146660 13:27055261-27055283 GGGGTTGGAGGTGGGGGCTCGGG - Intergenic
1107994924 13:45850576-45850598 AGTCAGGGAGGTGGGGGCTGGGG - Intronic
1108073470 13:46653742-46653764 GGTCTGGGAGGTTGAAGCTGCGG + Intronic
1108149118 13:47512945-47512967 GTTCTTGGCGGTGAAAGCTGTGG + Intergenic
1108677586 13:52750571-52750593 GTACTTGGAGGTGGGACCTTTGG + Intergenic
1110969196 13:81739748-81739770 GGTCTAGGAGCTGGGTGGTGGGG - Intergenic
1112091567 13:96089975-96089997 GGGCTCGGAGGAGGCAGCTGGGG - Intergenic
1112277805 13:98037056-98037078 GGTATTGGAGGTGGGGCCTTCGG + Intergenic
1112363669 13:98739422-98739444 ATTGTTGGAGGTGGGACCTGGGG + Intronic
1113675292 13:112202755-112202777 GGACTCAGATGTGGGAGCTGCGG - Intergenic
1113847939 13:113403149-113403171 GGCCATGGGGGTGGGAGGTGCGG - Intergenic
1114126294 14:19730046-19730068 GGGCTTTGTGGTGGGATCTGGGG + Intronic
1114552071 14:23538542-23538564 GGTCTTGGGGGTGGCAGGAGGGG - Intronic
1114633989 14:24177355-24177377 GGAGCTGGAGGTGGGAGCCGCGG - Exonic
1114918466 14:27296437-27296459 TGTCTTGGATGTGGGACATGGGG - Intergenic
1115137884 14:30132982-30133004 AGTATTGGAGGTGGGACCTGGGG + Intronic
1115754548 14:36518833-36518855 GGACTTGGGTGCGGGAGCTGGGG - Intronic
1116340839 14:43721873-43721895 GATGTTGAAGGTGGGACCTGAGG - Intergenic
1118839273 14:69499026-69499048 GCTCTTGGGGGAGGGAGCTGAGG + Intronic
1119445258 14:74658025-74658047 AGTCTTGGAGGTAGGAGAGGAGG - Intronic
1119603268 14:75992141-75992163 GGTAGTGGAGTTGGGAGCTCTGG + Intronic
1121916158 14:97838523-97838545 GGGCCTGGGGGTGGGAGGTGAGG - Intergenic
1122215008 14:100197405-100197427 TGTCTTGGAAGTGGGTCCTGGGG - Intergenic
1122316134 14:100827059-100827081 GGTCTGGACGCTGGGAGCTGGGG + Intergenic
1122397077 14:101441388-101441410 GGGCTTGTAGGTGGGAGCTGAGG - Intergenic
1122717067 14:103702222-103702244 GGGCTTGGAGGAGGGACCTATGG - Intronic
1123062777 14:105601785-105601807 GGGCCTGGATGGGGGAGCTGGGG + Intergenic
1202891482 14_KI270722v1_random:163301-163323 AGTGTTGGAGGTGGGTCCTGGGG + Intergenic
1123973139 15:25527957-25527979 GGTCGTGGAGGTGGACACTGTGG + Intergenic
1124051105 15:26198227-26198249 AGTGTTGGAGGTGGGGGCTGGGG - Intergenic
1124583881 15:30987860-30987882 GGTGTTGGGGGTGGGGGATGAGG - Intronic
1124637028 15:31371880-31371902 GCTCTTGGAGGTGGGGCATGTGG + Intronic
1125017510 15:34950674-34950696 GTTCTTGGTGGTGGGGGCAGGGG + Intronic
1125269435 15:37921816-37921838 GCTCTTGGGGGTGGGGGCGGAGG - Intergenic
1125666343 15:41433410-41433432 AGTCTGGGAGGTGGGGGTTGCGG - Intronic
1125780637 15:42263382-42263404 GGTCTTGGGGTTGGAAGGTGGGG + Intronic
1125796734 15:42409029-42409051 GCTCTTGCAGGTGGGGACTGGGG + Intronic
1126161740 15:45620162-45620184 GGTGTTGGAGGTGTGAGTGGTGG - Intronic
1126704638 15:51396047-51396069 AGTGTTGGAGGTGGGGTCTGTGG - Intronic
1127304341 15:57690478-57690500 GGACATGCAGGTGTGAGCTGCGG + Intronic
1127995311 15:64150463-64150485 GGGCTGAGAGGTGGGAGCAGAGG + Intergenic
1128147020 15:65337500-65337522 GGCCCTGGGGGTGGGAGGTGGGG + Intronic
1128453561 15:67820972-67820994 GGTCGTGGGGGTAGGAGCTGGGG - Intronic
1128517349 15:68350978-68351000 GGTCTGGGAGCTGGGAGGTTTGG + Intronic
1128685483 15:69681332-69681354 GGTCTGTGAGGTGGGGGCAGTGG + Intergenic
1128934629 15:71734842-71734864 GGGCATGGGGTTGGGAGCTGTGG - Intronic
1128995392 15:72290973-72290995 GGTGGTGGAGGTGGGAGTTAAGG - Intronic
1129093782 15:73181731-73181753 AGTGTTGGAGGTGGAACCTGGGG - Intronic
1129229120 15:74186955-74186977 GGCCCTGGAGGAGGGAGCTAGGG - Intronic
1129763114 15:78143357-78143379 GGTCTGGGAGAGGGGAGATGGGG + Intronic
1129871764 15:78945609-78945631 GGACATGGGGGTGGGAGGTGGGG - Intronic
1130072895 15:80664012-80664034 GGGGTGGGGGGTGGGAGCTGGGG + Intergenic
1130353053 15:83107955-83107977 GGTCTTGGAGCCGGGCCCTGAGG + Intronic
1132354602 15:101162100-101162122 GGTTTTGGAGGTGGGATCTTTGG - Intergenic
1132563510 16:609863-609885 GTGCCTGGAGGGGGGAGCTGAGG + Intronic
1132655831 16:1041340-1041362 GGTCTGGGAGGTGGGAGCTGGGG - Intergenic
1133001861 16:2855888-2855910 GGTCTGGGAGGAGGTACCTGGGG + Intronic
1133031854 16:3014792-3014814 AGTGTTGGAGGTGGGGGCGGGGG + Exonic
1133285496 16:4688777-4688799 CGTCCTGCAGGTGGGAGCAGAGG - Exonic
1133296330 16:4754283-4754305 GGTCCTGGAGATGGGAGGGGAGG - Intronic
1133300233 16:4777982-4778004 GGTCTTGGAGGTGGGAGCTGGGG + Exonic
1133526609 16:6611812-6611834 GGCCTTGGAGGAGGGCCCTGAGG - Intronic
1134467506 16:14492425-14492447 GGTCCAGGCGGTGGGATCTGTGG - Intronic
1134626267 16:15724893-15724915 TGTCCTGGAGCTGGGAACTGAGG + Exonic
1135380847 16:21995072-21995094 GGTGTTGGAGGAGGGGCCTGGGG + Intronic
1135676682 16:24421042-24421064 AGTGTTGGAGGTGGGGCCTGGGG + Intergenic
1136062148 16:27734015-27734037 GGAGGTGGAGGTGGGGGCTGGGG + Intronic
1136065587 16:27756049-27756071 GTTCCTGGGGGTGGGAGGTGGGG + Intronic
1136250259 16:28999752-28999774 CTGCTTGGAGGAGGGAGCTGGGG + Intergenic
1136253909 16:29025503-29025525 GCTCCTGCAGGTGGGAGGTGGGG + Intergenic
1136394110 16:29983573-29983595 GGTGGTGGAAGTGGGAGCTGGGG - Exonic
1136496940 16:30650757-30650779 GGAGCCGGAGGTGGGAGCTGCGG + Intronic
1137546658 16:49409336-49409358 GCTCTTTGAGGTGAGAACTGGGG - Intergenic
1137595361 16:49720074-49720096 GCTCTGGGAGGTGGAAGGTGGGG - Intronic
1138332023 16:56222977-56222999 GGTGCTGGAGCTGGGTGCTGGGG - Intronic
1138486790 16:57350533-57350555 GGTCTGGGAGGTGGGGAATGGGG - Intergenic
1139351415 16:66338575-66338597 AGTGTTGGAGGTGGGGTCTGGGG - Intergenic
1139446139 16:66999944-66999966 GGGCTTGGAGGTGGGAGGCAAGG + Intronic
1140410619 16:74738500-74738522 TGTCCTGGAGGGAGGAGCTGGGG - Intronic
1141474945 16:84266588-84266610 GGTCATGGTGGTGGCATCTGGGG + Intergenic
1141497140 16:84418169-84418191 CGTCTTGGAGGTGGGGGCACCGG + Intronic
1141525389 16:84607702-84607724 GGTGTTGGAAGTGGGAGGCGGGG + Intronic
1141708549 16:85683667-85683689 GCTGATGGAGGTGGGAGATGTGG - Intronic
1142134036 16:88443561-88443583 GGTGTTTGAGCTGGGAGCAGAGG + Intergenic
1142146733 16:88495918-88495940 CGCCTGTGAGGTGGGAGCTGGGG + Intronic
1142842825 17:2647248-2647270 GGTGAGGGAGGTGCGAGCTGAGG + Intronic
1142945933 17:3427075-3427097 GGTGTTGGGGGTGGGCCCTGAGG + Intergenic
1143249846 17:5515101-5515123 GGGATTGGAGGTGGAGGCTGTGG - Intronic
1143351948 17:6295394-6295416 GGGATTGGAGGTGAGGGCTGTGG - Intergenic
1143468618 17:7156442-7156464 GGTGTTGGCGGTGGGATGTGGGG - Intergenic
1143520314 17:7440790-7440812 GATATGGGGGGTGGGAGCTGAGG - Intronic
1143908191 17:10226594-10226616 GGACTTGGAGGTGGGCGCACTGG - Intergenic
1144243682 17:13340710-13340732 GTTCTAGGAGGTGGGGCCTGTGG + Intergenic
1145065022 17:19756170-19756192 GGACTTGGAGGAGGGGGCTGAGG + Intergenic
1145247707 17:21280437-21280459 TGGCTGGGTGGTGGGAGCTGAGG - Intergenic
1145883284 17:28366918-28366940 GGTCTTGGAGGAGAGAGAAGGGG - Intronic
1145930859 17:28684299-28684321 GGTCTTAGAGGTGGTCCCTGTGG - Intronic
1146296302 17:31653309-31653331 AGTGTTGGAGGTGGGGGCTCAGG - Intergenic
1146552385 17:33792410-33792432 GGTGGTGGAGGGGGGAGGTGAGG + Intronic
1146633959 17:34490681-34490703 GGTCTTGGTGGCGGGAGCGTAGG - Intergenic
1146798984 17:35803765-35803787 GGTCTTGGGGCTGGGCGCGGTGG + Intronic
1146828084 17:36041429-36041451 GGTCTTGGGGCTGGGCGCGGTGG - Intergenic
1146908110 17:36630774-36630796 GGTCTGGGAGGAGGAAGTTGAGG + Intergenic
1147114659 17:38289931-38289953 GGTGTGGGAGGTGGGGGATGTGG + Intergenic
1147120236 17:38331285-38331307 GTTCCTGGAGGCTGGAGCTGAGG + Exonic
1147162229 17:38574911-38574933 CGCCATGGAGGTGGGAGCAGAGG + Intronic
1147383551 17:40069560-40069582 GTAATTGGAGCTGGGAGCTGGGG - Intronic
1147407053 17:40219635-40219657 GGTCTTGCGGGTGGGGCCTGAGG + Intronic
1147423459 17:40334067-40334089 AGGGTTGGAGGTGGGGGCTGGGG + Intronic
1147794183 17:43030914-43030936 GGTGTTGGAGCTGGGAGATTTGG + Intergenic
1148414955 17:47499274-47499296 GGTGTGGGAGGTGGGGGATGTGG - Intergenic
1148451228 17:47778969-47778991 GGTCTTGGGGTGGGGGGCTGGGG - Intergenic
1148681390 17:49475929-49475951 AGTGTTGGAGGTGGGGCCTGGGG - Intronic
1148744977 17:49913015-49913037 GGTCTTGGAGGTCAGGGCTTTGG + Intergenic
1149439978 17:56665877-56665899 TGTGTTGGAGATGGGAGCTGAGG - Intergenic
1151327458 17:73388035-73388057 GGTCTGGGAGGTGGCAGAGGGGG + Exonic
1151557617 17:74854575-74854597 GGGCAGGGAGGTGGGGGCTGAGG - Intronic
1151679433 17:75615796-75615818 GGGCTTGGAGGTGACGGCTGAGG - Intergenic
1151826110 17:76525282-76525304 GGTCTGGGAGCTGAGAGCTCAGG + Intergenic
1151986429 17:77546972-77546994 GTTCTTGGGGGTGGGGGGTGGGG + Intergenic
1152394435 17:80023780-80023802 GGCCTGGGAGGTGGGAGATGAGG - Intronic
1152653735 17:81509880-81509902 AGTCTTGGGGGTGGGGGCGGTGG - Intergenic
1152907539 17:82977057-82977079 GGCCTTCGAGGTGGGCACTGCGG - Intronic
1153131594 18:1860140-1860162 GGTGTTGGAGGTGGCTTCTGAGG + Intergenic
1153478312 18:5520738-5520760 GGCCTTGTGGGTGGGAGTTGAGG - Intronic
1153599961 18:6770776-6770798 GGTGTGGGAGGTGGGGGGTGGGG + Intronic
1153778383 18:8473629-8473651 GGTGTTGGAGGTGGGGCCTGGGG - Intergenic
1154066170 18:11109376-11109398 GGGGTGGCAGGTGGGAGCTGGGG + Intronic
1154344491 18:13530864-13530886 GGTCATGGTGGTGTGGGCTGGGG + Intronic
1155174835 18:23292876-23292898 GGTGTTGGTGGTGGTTGCTGGGG - Intronic
1156537460 18:37878077-37878099 GGTCTTGGGGGTGGCTCCTGAGG - Intergenic
1156684940 18:39633137-39633159 GGTATTCAAGGTGGGAGATGTGG + Intergenic
1157025833 18:43841464-43841486 TGTCGTGGAGTGGGGAGCTGGGG + Intergenic
1157496095 18:48158507-48158529 GGTCTTGGAGGGGTGGGGTGGGG + Intronic
1157627360 18:49061642-49061664 GGTCTAGGCGATGGGGGCTGAGG + Intronic
1157946933 18:51991022-51991044 GGTCTGGGTGGAGGGAGCTGAGG + Intergenic
1158451916 18:57574310-57574332 GGTCTTGGAGAAGGAAGCAGAGG - Intronic
1159559409 18:69977613-69977635 GGTGTTGGGGGTGGCACCTGAGG + Intergenic
1160378516 18:78431435-78431457 GGACTTGGGGGTGGGAGGAGAGG - Intergenic
1160756329 19:758764-758786 GGTCTCAGAGGTTGGAGCAGGGG + Intronic
1160845918 19:1165960-1165982 GGTCTGGGATCTGGGATCTGGGG - Intronic
1160845941 19:1166038-1166060 GGTCTGGGATCTGGGATCTGGGG - Intronic
1160849726 19:1184556-1184578 GTTCTAGGAGGTGAGAACTGGGG + Intronic
1160917241 19:1503175-1503197 GCTCCTGGCGGTGGGGGCTGTGG + Intergenic
1160940446 19:1618282-1618304 GGCCTTGGAGGGGTGAGCAGTGG - Intronic
1161038610 19:2098535-2098557 CCTCTAGGACGTGGGAGCTGAGG - Intronic
1161074461 19:2278670-2278692 TGTCTAGGAGGCGGAAGCTGTGG + Exonic
1161168727 19:2802425-2802447 GGTGTTGGTGTTGGGAGGTGGGG - Intronic
1161378097 19:3950385-3950407 GGCCTTGGAGGTGACAGCTTTGG - Intergenic
1161487689 19:4544431-4544453 GGCCTTCGTGGTGGGAGCCGTGG - Exonic
1161534777 19:4812176-4812198 GGTGTTGGAGTTGAGACCTGGGG - Intergenic
1162163294 19:8734962-8734984 GATCTTAGAGGTGGGTGCAGAGG + Intergenic
1162329769 19:10020653-10020675 GGTCTGGGAGGTGGGCTTTGTGG - Intronic
1162404930 19:10467807-10467829 TTTTTTGGAGGTGGGGGCTGGGG + Exonic
1162478026 19:10912607-10912629 GGGGCTGGGGGTGGGAGCTGGGG - Intronic
1162566321 19:11447274-11447296 GGTCTCGGTGGGGGGTGCTGGGG - Intronic
1162625236 19:11879855-11879877 CGTGGTGGAGGTGGCAGCTGAGG - Intronic
1162906671 19:13827960-13827982 GATCTATGAGGTGGGATCTGGGG + Intronic
1162920667 19:13900419-13900441 GACCTTGGAGGGGGAAGCTGGGG - Intronic
1163124627 19:15238288-15238310 GGTGGTGGAGGTGGGATCAGCGG - Exonic
1163277290 19:16293218-16293240 GGGGTTGGAGGTGGGAGTGGGGG + Intergenic
1163397364 19:17071544-17071566 GGTCTTTCTGCTGGGAGCTGGGG - Intronic
1163550776 19:17965526-17965548 AGGCCTGGAGGTGGGAACTGTGG + Intronic
1163663900 19:18594291-18594313 GGTCGTAGAGGCGGAAGCTGAGG + Exonic
1163743299 19:19030025-19030047 TGTCTTGGGGCTGGGAGCAGTGG + Intronic
1163790931 19:19305784-19305806 GCTCTAGCAGGTGGGATCTGTGG - Intronic
1163799584 19:19356500-19356522 GGAGATGGAGCTGGGAGCTGAGG + Exonic
1164592856 19:29515683-29515705 TGGCTTGGAGGTGGGTGGTGGGG - Intergenic
1165002464 19:32776300-32776322 GAACTGGGAGATGGGAGCTGTGG - Intronic
1165099157 19:33428319-33428341 GGTCCTGGAAGAGGGAGCTCGGG - Intronic
1165365024 19:35359999-35360021 GGACTTGGAGTGGCGAGCTGGGG + Exonic
1165366843 19:35372468-35372490 GGACTTGGAGTGGCGAGCTGGGG + Exonic
1165423439 19:35733226-35733248 AGTCCAGGAGGTGGGAGCCGTGG - Exonic
1165427992 19:35756209-35756231 GGGCTCTGAGGAGGGAGCTGGGG - Intronic
1165432955 19:35782743-35782765 GGTCCTGGGGGTGGGAGCAGAGG - Exonic
1166360480 19:42251038-42251060 GGTCTTGGGGTTGGGAGTAGGGG - Intronic
1166380813 19:42354234-42354256 AGAATTGGAGATGGGAGCTGAGG - Intronic
1166510297 19:43403429-43403451 TGTCTTGGAGTTGGGGGCTGGGG + Intronic
1166581269 19:43902135-43902157 GGTATTCTAGGTGCGAGCTGAGG + Intergenic
1166747279 19:45147306-45147328 GATCCTGGAGGTGGTTGCTGGGG + Intronic
1167424886 19:49425103-49425125 AGTCTGGGGGGAGGGAGCTGGGG + Intronic
1167453013 19:49583443-49583465 GGTCCTGGAGGAAGGAGCAGGGG - Intronic
1167623946 19:50574556-50574578 AGTGTTGGAGGTGGGGCCTGGGG + Intergenic
1167779857 19:51592130-51592152 GGTTTTGGGGGTGGGGGCAGGGG - Exonic
1168267283 19:55229854-55229876 AGCCTGGGAGGAGGGAGCTGGGG + Exonic
1168296211 19:55378366-55378388 GGTCGTGGGGGTGTGAGCTGAGG + Intergenic
1168306500 19:55438802-55438824 GGTCTTGAAGGTGGAAAGTGTGG + Intronic
1168448425 19:56444472-56444494 AGTGTTGGAGGTGGGGTCTGTGG - Intronic
1168448459 19:56444638-56444660 AGTGTTGGAGGTGGGGTCTGTGG - Intronic
1168448475 19:56444721-56444743 AGTGTTGGAGGTGGGGTCTGTGG - Intronic
1168448491 19:56444804-56444826 AGTGTTGGAGGTGGGGTCTGTGG - Intronic
1168448508 19:56444887-56444909 AGTGTTGGAGGTGGGGTCTGTGG - Intronic
1168448524 19:56444970-56444992 AGTGTTGGAGGTGGGGTCTGTGG - Intronic
1168448540 19:56445053-56445075 AGTGTTGGAGGTGGGGTCTGTGG - Intronic
1168448557 19:56445136-56445158 AGTGTTGGAGGTGGGGTCTGTGG - Intronic
1168448572 19:56445219-56445241 AGTGTTGGAGGTGGGGTCTGTGG - Intronic
1168448623 19:56445470-56445492 AGTGTTGGAGGTGGGGTCTGTGG - Intronic
1168448709 19:56445889-56445911 AGTGTTGGAGGTGGGGTCTGTGG - Intronic
1168448725 19:56445972-56445994 AGTGTTGGAGGTGGGGTCTGTGG - Intronic
925181344 2:1818995-1819017 GGTCTGGGAGCTGGGAGCTGGGG - Intronic
925878517 2:8331795-8331817 GGGCTTGGAGGTGGGGGCAGTGG - Intergenic
926098514 2:10098267-10098289 GGTCTTGGTGGAGGAGGCTGGGG + Intergenic
926425696 2:12736763-12736785 GCTCTTGGAGGTGGGAAGTGAGG + Intronic
927011785 2:18911714-18911736 TGTGTTGGGGGTGGGAGCTGAGG + Intergenic
927146629 2:20170505-20170527 GGCCTTGGAGCTGGGAGATGTGG - Intergenic
927227953 2:20789094-20789116 GGGCATGGAGGTGGGTGCAGAGG - Intronic
927508477 2:23629572-23629594 GGGCTTGGAGGAAGGGGCTGGGG + Intronic
927706364 2:25298909-25298931 GTTCCTGGAGGTGGGGGGTGTGG - Intronic
928137733 2:28700975-28700997 GGAGTTGGAATTGGGAGCTGGGG - Intergenic
929270159 2:39963232-39963254 GGTGTTGGAGATGGGTCCTGAGG + Intergenic
929270239 2:39963983-39964005 GGTGTTGGAGATGGGTCCTGAGG - Intergenic
929640050 2:43569047-43569069 AGTCTGGGAGGTGAGGGCTGTGG - Intronic
929940835 2:46332865-46332887 TGTCGAGGAGGTGGGATCTGAGG + Intronic
930102513 2:47614349-47614371 GTTCTGGTAGGTGGGAGCTCTGG - Intergenic
930124320 2:47783833-47783855 GGCCTGGGAGGTGGGAGCACTGG + Intronic
931552391 2:63461231-63461253 AGTGTTGGAGGTGGGGCCTGCGG + Intronic
931869140 2:66440652-66440674 GGCGTTGGAGGTGGGAGGTAGGG - Intronic
932180582 2:69643171-69643193 GGCCGTGGGGGTGGGGGCTGAGG + Exonic
932419048 2:71590724-71590746 GATCTGGGTGGGGGGAGCTGGGG - Intronic
932448237 2:71793774-71793796 GGTCAGAGAGGTGGGAGCAGGGG - Intergenic
932485839 2:72083902-72083924 GGTAGTGAAGGTGGGAGATGAGG + Intergenic
932567945 2:72921135-72921157 GGAGCTGGAGGTGGGAGCTAGGG - Intronic
932621399 2:73266491-73266513 GGCCGTGGAGGTGGGGGCGGTGG - Exonic
933463992 2:82626712-82626734 AGTGTTGGAGGTGGGACCTAGGG - Intergenic
933882034 2:86679119-86679141 GATCCTGGAGTTGGGAGCAGGGG + Intronic
934611387 2:95739528-95739550 GGTGTTGGAGGTGGGGCCTGGGG + Intergenic
935146300 2:100397851-100397873 GGTCTTGGTGGCCGGTGCTGAGG - Intronic
935580676 2:104753607-104753629 GGTGTTGGAGGTGGGTCCTGTGG - Intergenic
935607391 2:104984611-104984633 GGTATAGGAGGTGGGACCTTTGG + Intergenic
936258351 2:110935847-110935869 GGTTTTGGGGGTGGGGGGTGCGG + Intronic
936287488 2:111191951-111191973 GGTATTGGAGGTGGGGCCTTTGG + Intergenic
936345255 2:111670928-111670950 GGGCTGGGAGCTGGGGGCTGGGG - Intergenic
936582610 2:113716527-113716549 GGCCTATGAGGTGGGAGCAGAGG + Intronic
937251643 2:120527704-120527726 GGGGTAAGAGGTGGGAGCTGGGG - Intergenic
937331344 2:121032217-121032239 GGGCCTGGAGTGGGGAGCTGAGG + Intergenic
937453569 2:122022612-122022634 GCTGTTTGAGGTGGGAACTGGGG + Intergenic
937696871 2:124818222-124818244 GGGCTTGGAGGAGGAAGCTGAGG - Intronic
937800011 2:126072296-126072318 GGTTTTGGGGGTGGGTCCTGAGG - Intergenic
938761373 2:134429332-134429354 GCTGTTGGAGCTGGGAGCCGTGG + Intronic
940035737 2:149310557-149310579 GGACTTGGAGCAGGGAGCGGAGG - Intergenic
941065587 2:160899063-160899085 GGCCTTGGAGGTGAGAGATTTGG + Intergenic
941141446 2:161788488-161788510 GGTCTTGGTGGTAGGGGCAGGGG + Intronic
941493096 2:166166733-166166755 GCTCTGGCAGGTGGGATCTGGGG + Intergenic
942064042 2:172253559-172253581 GGGCCTGGAGTTGGGAGCTGTGG - Intergenic
943210969 2:184965312-184965334 TGTCATTGAGGTGGGAGGTGAGG + Intergenic
943741122 2:191410246-191410268 TGGATTGGAGGTGGGAGATGAGG + Intronic
945931962 2:215864345-215864367 GGTATTGGCGGTGGGTGGTGGGG - Intergenic
946247285 2:218394966-218394988 GGAAGTGGTGGTGGGAGCTGTGG - Exonic
946326008 2:218985085-218985107 GGACTGGGCGGTGGGAGATGGGG + Exonic
946402697 2:219476898-219476920 GGACGTGGAGGTGGGGGCTGGGG + Exonic
946521994 2:220476123-220476145 GGTTTTGGTGGTGGGATCTTTGG - Intergenic
946540200 2:220676019-220676041 AGTGTTGGAGGTGGGGGGTGGGG - Intergenic
946827246 2:223691354-223691376 AGTCTTGGATGTGAGAACTGAGG - Intergenic
947523145 2:230863825-230863847 GGTCTGGGACGTGGGCGCTAAGG + Intergenic
947611711 2:231528792-231528814 GATCTTCGTGGTGGGCGCTGTGG - Exonic
947718481 2:232353338-232353360 GGTGTTGGCGGTAGGGGCTGGGG + Intergenic
947810444 2:233000795-233000817 GGTATTGGAGATGGGACCTCTGG - Intronic
948045599 2:234941179-234941201 GGTCCTGGAGTCAGGAGCTGTGG + Intergenic
948858823 2:240743152-240743174 GGCCTCTGGGGTGGGAGCTGGGG - Intronic
1168923936 20:1564578-1564600 GGTGGTGGAGGTGAGAGGTGTGG + Exonic
1168961229 20:1871434-1871456 GGGCTGGAAGGTGGGAGCAGGGG - Intergenic
1169134852 20:3191002-3191024 GGGCCTGGAGGTGGCAGCAGTGG - Intronic
1169374547 20:5055918-5055940 GATCTGGGAGGTGGAAGTTGTGG + Intergenic
1169629174 20:7607070-7607092 GGTATTGGGGGTGGGAGTAGGGG + Intergenic
1170158226 20:13287495-13287517 GGGCTTGGAGGTGAGAGGTGTGG - Intronic
1170899333 20:20445432-20445454 GTTCTTGGAACTGGAAGCTGGGG + Intronic
1171012211 20:21514964-21514986 GGGGTTGGGGGTGGGAGGTGGGG - Intergenic
1171958696 20:31478018-31478040 GGTTTTGGGGGAGGGTGCTGAGG - Intronic
1172214155 20:33223137-33223159 TGTCTTGGAGGAGGGGGATGGGG + Intronic
1172229674 20:33328301-33328323 GGTGTTGGAGATGTGAGCTCTGG - Intergenic
1172250229 20:33474314-33474336 GGCCTGGGAGGTGGAGGCTGTGG - Intergenic
1172334115 20:34099846-34099868 AGTTATGGGGGTGGGAGCTGAGG + Intronic
1172664154 20:36587515-36587537 GGTATGGGAGGAGGCAGCTGTGG + Intronic
1173881044 20:46412422-46412444 GGCATTGGAGGTGGAAGATGAGG + Intronic
1174000233 20:47369238-47369260 GGTTTTAGAGGTGGGGGTTGGGG - Intergenic
1174173318 20:48630117-48630139 TGTCTTGGGGCTGTGAGCTGGGG - Intronic
1174480877 20:50830492-50830514 GGGGTTGGTGGTGGGAGTTGGGG + Intronic
1174524070 20:51157288-51157310 GGAGCTGGAGGTGTGAGCTGAGG - Intergenic
1174932078 20:54827037-54827059 GGTATAGGAGGTGGGATCTTTGG + Intergenic
1175187307 20:57187385-57187407 GGCCTTAGAGGTGGGGCCTGTGG + Intronic
1175439132 20:58978552-58978574 AGCCTTGGGGGTGGGAGATGGGG - Intergenic
1175726242 20:61320614-61320636 CATCTGGGAGGTGGGAGCAGGGG + Intronic
1175752863 20:61511077-61511099 AGTGTTGGAGGTGGGGCCTGTGG - Intronic
1175767448 20:61601326-61601348 AGTGTTGGAGGTGGGGCCTGGGG - Intronic
1175789596 20:61733001-61733023 GTTTTCAGAGGTGGGAGCTGGGG - Intronic
1176092630 20:63325782-63325804 GGCCTTGGAGATGGAGGCTGTGG + Intronic
1176170976 20:63696266-63696288 GGGCTTGGTGGTGGGAGTTGAGG + Intronic
1176249209 20:64112250-64112272 GGTTCTGGAGGTGACAGCTGGGG + Intergenic
1176554069 21:8245487-8245509 GAACTTGGAGGTGGGGGCGGGGG - Intergenic
1176572991 21:8428511-8428533 GAACTTGGAGGTGGGGGCGGGGG - Intergenic
1177675610 21:24294813-24294835 AGTGTTGGAGGTGGGGCCTGAGG - Intergenic
1177702426 21:24655846-24655868 TGACTTGGTGGTGGAAGCTGGGG - Intergenic
1178311096 21:31530724-31530746 GGTCTTGGAGGTTGGTTCTGGGG - Intronic
1178396758 21:32249843-32249865 GATGTTGGAAGTGGGGGCTGGGG - Intergenic
1178622329 21:34187574-34187596 GGTCCTGGATGTGGGGTCTGAGG - Intergenic
1179502801 21:41820601-41820623 AGTCCTGGAGGCGGGAGCTCAGG - Intronic
1179608534 21:42533859-42533881 TGTCTGGGAGGTGGGAGGAGGGG - Intronic
1179800937 21:43811252-43811274 GGTCTCGGGGGTGAGGGCTGAGG - Intergenic
1180003320 21:45004985-45005007 CGTGTTGGAGGTGGGGCCTGGGG + Intergenic
1180070241 21:45432221-45432243 GGTCCTGAAGGTCAGAGCTGGGG + Intronic
1180219171 21:46347064-46347086 CCTCTTGGGGTTGGGAGCTGGGG + Intronic
1180979215 22:19870930-19870952 GGGCTTGGAGGTGGGCCCTGTGG + Intergenic
1181767826 22:25104422-25104444 TGTCTTGGAGGTGGGAGAGGAGG + Intronic
1182096469 22:27629364-27629386 CATCTTGCAGGTGGGAGATGGGG + Intergenic
1182106128 22:27691074-27691096 GATCTTGGAGGTAGGGGCTGAGG - Intergenic
1182293818 22:29301480-29301502 CGTTATGGAGGTGGGGGCTGTGG - Intergenic
1182331388 22:29553665-29553687 GTTCTTGGAGCTGTGAGGTGAGG - Exonic
1183322522 22:37173767-37173789 GGTCCTGGAGGTGGTAGCTTTGG + Intronic
1183424690 22:37733218-37733240 CCTGTTGGAGGTGGGAGCAGAGG + Intronic
1183465949 22:37980524-37980546 GCTGGTGGAGGAGGGAGCTGGGG - Intronic
1183753793 22:39740118-39740140 GGGCTTGGAGGAGGGGGGTGTGG + Intergenic
1184067499 22:42128941-42128963 CGTCCTGGGGGTGGGAGATGCGG + Exonic
1184070232 22:42142636-42142658 CGTCCTGGGGGTGGGAGATGCGG + Intergenic
1184080631 22:42217169-42217191 GGTCAAGGGGGTGGGAGCAGGGG - Intronic
1184110536 22:42391347-42391369 GGTCTTGGGGGTGGGGGTAGGGG + Intronic
1184325329 22:43778670-43778692 GGTCTTTGAGGTGTGAGCACTGG - Intronic
1184526018 22:45023282-45023304 GGTCTTGGCTATGGGAGATGTGG + Intergenic
1184709537 22:46240440-46240462 AGTCCAGGAGATGGGAGCTGAGG - Exonic
1184747584 22:46465194-46465216 GGGCCTGGAGGTGGCAGGTGAGG - Intronic
1184860238 22:47169388-47169410 GATCTGGGAGGTGGGGCCTGGGG - Intronic
1184863073 22:47187795-47187817 GGCCTTGGAGGGGGCAGATGTGG + Intergenic
1184984143 22:48118007-48118029 GCCCCTGGAGTTGGGAGCTGAGG - Intergenic
1185095000 22:48801345-48801367 GGGCGTGGAGTTGGGGGCTGTGG - Intronic
1185231747 22:49687768-49687790 GGGGTGGGAGGTGGGAGGTGGGG - Intergenic
1185386278 22:50532534-50532556 GGTCTGGGAGGTGGGCGGGGCGG - Exonic
1185414572 22:50702936-50702958 GGTCCTGGAGAGTGGAGCTGCGG + Intergenic
1203259074 22_KI270733v1_random:162525-162547 GAACTTGGAGGTGGGGGCGGGGG - Intergenic
949406110 3:3716502-3716524 GGTATTGGAGGTGGGGCCTGTGG - Intronic
949891617 3:8737593-8737615 GGTCATGGAGATTGTAGCTGAGG + Intronic
950456588 3:13096287-13096309 AGTCTTGGAGGTGGGGCATGTGG + Intergenic
951090989 3:18573730-18573752 GCTCTTGGAGGAGGAAGGTGAGG + Intergenic
951171296 3:19544806-19544828 TGTCTGGGAGTTGGGGGCTGGGG + Intergenic
951659720 3:25049037-25049059 GGTCTTGGAGCTGGGCGCGGTGG - Intergenic
952884061 3:38002121-38002143 GGCCTTGGAGGTGGAAAGTGGGG - Intronic
953053327 3:39366227-39366249 GCTGTTGGGGGTGGGAGGTGGGG + Intergenic
953129893 3:40127832-40127854 CATCCTGGAGCTGGGAGCTGGGG - Intronic
953280392 3:41548675-41548697 GGTCCTGGAGGTGGCAGTAGTGG - Intronic
953718590 3:45336278-45336300 GGAATGGGAGCTGGGAGCTGTGG - Intergenic
953767432 3:45754301-45754323 GAGCTTGGAGGAGGGAGCAGGGG - Intergenic
954150149 3:48653236-48653258 GGACTTGGAGGTGAGATCAGAGG + Intronic
954273352 3:49526260-49526282 AGTGTTGGAGGTGGGGTCTGGGG - Intronic
954440057 3:50516851-50516873 GCTTTAGGAGGTGGGAGCGGAGG - Intergenic
954511945 3:51133029-51133051 GGTGTTGGGGGTGGGTCCTGAGG - Intronic
957088982 3:75709412-75709434 AGTGTTGGAGGTGGGGCCTGGGG - Intergenic
957897801 3:86446297-86446319 GGTGTTGGGGGTGGGTCCTGAGG - Intergenic
958413430 3:93846905-93846927 TGTCGTGGGGTTGGGAGCTGGGG - Intergenic
961109910 3:124275170-124275192 GGTCATGGTGGTGGTAGCTTTGG + Intronic
961252087 3:125515758-125515780 GTTCTTGGGGCTGGGTGCTGTGG + Intronic
961870934 3:129987712-129987734 GGTTGAGGAGGTGGGAGGTGGGG - Intergenic
962450975 3:135516760-135516782 GGTTTTGGAGTCGGGAGCAGTGG - Intergenic
963102458 3:141620414-141620436 TGGCCTGGAGGTGGGGGCTGTGG + Intergenic
963842876 3:150125697-150125719 GGTCTTGGGGGCTGGAGCAGAGG + Intergenic
964004209 3:151810012-151810034 TGTATTGGAGGAGGCAGCTGGGG - Intergenic
964168966 3:153744233-153744255 AGTCTTGCAGGTGATAGCTGAGG + Intergenic
964246469 3:154659710-154659732 GGTGGTGGGGGTGGGAGGTGGGG + Intergenic
964394211 3:156228580-156228602 GAGCTTGGAGGTGGGAAGTGGGG + Intronic
965611315 3:170546818-170546840 GGTATTGTTGGTGAGAGCTGTGG + Intronic
966320720 3:178698886-178698908 AGTCTAGCAGTTGGGAGCTGAGG - Intronic
966399590 3:179534831-179534853 GGTCTGTGTGATGGGAGCTGTGG - Intergenic
966711748 3:182979965-182979987 GGTATTGGAGCCGGGAGCGGAGG + Intronic
966915280 3:184581203-184581225 AGTCTTGAAGGTGGGAGATAGGG - Intronic
967885107 3:194328416-194328438 GGGCCGGGAGGTGGGAGATGGGG - Intergenic
967937382 3:194739731-194739753 GCTCAAGGAAGTGGGAGCTGAGG + Intergenic
968654712 4:1773503-1773525 GGGGTGGGAGGTGGGACCTGAGG - Intergenic
968920705 4:3521052-3521074 GGACTTGGAAGTGGGAATTGGGG - Intronic
969599443 4:8167252-8167274 GGACTTGGAGGCAGGACCTGGGG - Intergenic
969700248 4:8764053-8764075 GGAGGTGGAGGTGGAAGCTGAGG + Intergenic
969927870 4:10602122-10602144 GGTCATGCAGGAGGGAGATGCGG - Intronic
970180308 4:13384585-13384607 AGTCCAGGAGCTGGGAGCTGAGG + Intronic
971464946 4:26947535-26947557 GGACTTGGAGGAGGGGGCTGAGG + Intronic
972338232 4:38127800-38127822 GGGCTGTGAGGTTGGAGCTGAGG + Intronic
973096848 4:46213145-46213167 GGATTTGGAGGTGGGACCTTTGG + Intergenic
973112520 4:46413208-46413230 CCTCTTGGAGGTGGGAACTATGG + Intronic
973907530 4:55546578-55546600 GCTGCTGGAGGTGGGAGCCGCGG - Intronic
974628318 4:64452456-64452478 AGTGTTGGAGGTGGGTCCTGTGG - Intergenic
974747217 4:66091379-66091401 GGTTTTGGAGGTGGCTGCTAAGG + Intergenic
976327448 4:83788051-83788073 AGACATGGGGGTGGGAGCTGGGG + Intergenic
976599073 4:86921085-86921107 AATCTTGGAGGTGGAGGCTGTGG + Intronic
977465674 4:97380951-97380973 GGTGTTGGAGGTGGCTCCTGAGG - Intronic
978384457 4:108166895-108166917 GGGCTAGCAGCTGGGAGCTGTGG - Intronic
978481972 4:109203077-109203099 AGTCATGAAGGTGGGACCTGGGG - Intronic
979023155 4:115528609-115528631 GGTCTTGAAGGAGAGTGCTGCGG - Intergenic
979765003 4:124453787-124453809 AGTGTTGGAGGTGGGGCCTGGGG - Intergenic
979776488 4:124594946-124594968 AATATTGGAGGTGGGAGGTGGGG + Intergenic
981093040 4:140753094-140753116 GGTCTTGGAGGTGGAGGCAAAGG - Intronic
981536025 4:145800740-145800762 CATCTTGTAGGTGGAAGCTGGGG - Intronic
981565462 4:146096990-146097012 GGGATTGGGGGTGGGAGCTGGGG + Intergenic
981806791 4:148725176-148725198 GTATTTGGAGGTGGGACCTGTGG - Intergenic
982482811 4:155933026-155933048 GGCCTTGGAGATGAGAGATGAGG - Intronic
982752260 4:159176318-159176340 TGTCTTTGAGGTGGGGGCGGAGG - Intronic
983177982 4:164614315-164614337 AGTCTTGGCTGGGGGAGCTGGGG - Intergenic
983436348 4:167720503-167720525 AGTGTTGGAGGTGGGGCCTGTGG + Intergenic
983554879 4:169051216-169051238 GGTTTCGCAGGTGGGGGCTGGGG - Intergenic
984534944 4:180962807-180962829 GGTGGTGGAGGTGGGAGAGGTGG + Intergenic
985865630 5:2511892-2511914 GATCATGGAGGTGGGAGGGGTGG + Intergenic
986086647 5:4458870-4458892 AGTGTTGGAGGTGGGCCCTGTGG - Intergenic
986097534 5:4574472-4574494 GGTCATGGTGGTGGGAGTGGTGG - Intergenic
986600471 5:9467716-9467738 GTGCCTGGAGGTGGGAGCCGGGG + Intronic
986694428 5:10339363-10339385 GCTGTTGGAGGTGGGGGCTGGGG + Intergenic
986730106 5:10629023-10629045 GGCATTGGCGGTGAGAGCTGAGG + Intronic
987059160 5:14225793-14225815 GGGCTTGGAGGTGGGGGGGGGGG - Intronic
987629206 5:20445953-20445975 GGGCTTGGTGGGGGGAGTTGAGG + Intronic
988697118 5:33633496-33633518 GGTCATGGTGGTGGGAGCTCTGG - Intronic
989339520 5:40357685-40357707 TGACTAGGAGGTGGGCGCTGTGG + Intergenic
990876617 5:60493775-60493797 GGTCTTCATGGTGGGTGCTGGGG - Intronic
991446741 5:66708206-66708228 GGACTTGGAGTTGGAAGATGAGG + Intronic
991684386 5:69167975-69167997 GGGCTTGGAGGTTGCAGCAGGGG - Exonic
991945813 5:71897687-71897709 GGTGTTGGGGGTGGGTCCTGAGG - Intergenic
992185681 5:74242123-74242145 GATCATGGTGGTGGGGGCTGGGG - Intergenic
993266827 5:85737289-85737311 GGTATTGGTGGGGGGAGGTGGGG - Intergenic
993820023 5:92602600-92602622 GGTATTGGAGGTGGGACTTTGGG - Intergenic
994424608 5:99569066-99569088 TTTCATGGAGGTGGGAGTTGGGG - Intergenic
995142389 5:108748782-108748804 GGTAGTGGAGGAGGGGGCTGAGG + Intronic
996026732 5:118654750-118654772 GGGATTGGGGGTGGGAGGTGGGG - Intergenic
996866158 5:128124771-128124793 GGTGTGAGGGGTGGGAGCTGGGG + Intronic
997443489 5:133925308-133925330 GGATTTGGAGGTGGGGGCTGAGG - Intergenic
997584660 5:135037250-135037272 GGTGTTGGACATGGGAACTGAGG - Intronic
997691842 5:135832483-135832505 GGTTGGGGAGGTGGGAGCTGTGG + Intergenic
998070767 5:139196337-139196359 GGTGTAGGTGGTGGGAGTTGAGG - Intronic
998094260 5:139388419-139388441 GCCCTTGGAGGAGGGAGGTGGGG + Intronic
998817387 5:146028110-146028132 GCTCTGGGAGCTGGGAGCAGGGG + Intronic
999206139 5:149849475-149849497 GGTCAAGGAGGTGGGAGTAGTGG - Exonic
999276445 5:150333792-150333814 GGTTTTGGAGGTTGGTTCTGAGG - Intronic
1000183795 5:158839452-158839474 GGAGTTGGAGGTTGCAGCTGAGG - Intronic
1002079138 5:176727359-176727381 GGTCTAGGAGGTGTCAGCAGCGG + Intergenic
1002187377 5:177460631-177460653 GGAGGTGGAGGTGAGAGCTGGGG - Exonic
1002300199 5:178253398-178253420 GGTGTTGGAGCAGGGAGCAGGGG - Intronic
1002575464 5:180171463-180171485 GGCCTCGGAGGTGGGCTCTGAGG - Intronic
1002694302 5:181073905-181073927 TGCCGTGGAGGTGGGAGGTGGGG - Intergenic
1002711178 5:181195791-181195813 GGCCTTGGCGCTGGGTGCTGGGG - Intronic
1002972987 6:2043471-2043493 GGTCAGACAGGTGGGAGCTGTGG - Intronic
1004184944 6:13413684-13413706 GGTCCAGGGGGTGGTAGCTGGGG - Intronic
1004743619 6:18488261-18488283 GATCTTGGGGTTGGGAGTTGAGG + Intergenic
1004858286 6:19774067-19774089 GGCCTTGCTGGTGGCAGCTGTGG - Intergenic
1004876506 6:19960272-19960294 GGGCATGGAGGTGGGAGGTATGG - Intergenic
1005034155 6:21540294-21540316 GGGCTTAGGGGTGGGCGCTGGGG - Intergenic
1005159533 6:22843131-22843153 GTACTTGGAGGTGGGATCTTTGG - Intergenic
1006002069 6:30972851-30972873 GGTCCTGAAGCTGGGGGCTGAGG - Intergenic
1006189109 6:32196740-32196762 GGTGTTGAGGGTGGGAGTTGGGG + Intronic
1006340455 6:33443694-33443716 GGGCCTGGAGGTGGGAGCGGTGG + Exonic
1006389902 6:33752070-33752092 GGCCTGGGAGGTGGCAGCTTTGG - Intergenic
1006449205 6:34096310-34096332 GGATTTGGATGTGGGAGATGAGG - Intronic
1006578808 6:35064784-35064806 GGGGGTGGAGGTGGGGGCTGGGG - Intronic
1007355107 6:41309149-41309171 GGACTTGGTGGTGGGGGCTCTGG - Intergenic
1007703850 6:43779687-43779709 GCTCTGGAAGCTGGGAGCTGAGG - Intronic
1007733962 6:43968816-43968838 GGTTGTGGGGGTGGGTGCTGTGG - Intergenic
1007826532 6:44605175-44605197 GAGCTGGCAGGTGGGAGCTGAGG + Intergenic
1007958425 6:45937794-45937816 GGTCTCGGTTGTGGTAGCTGGGG + Intronic
1008513115 6:52295807-52295829 AGTGTTGGAGGTTGGAGGTGGGG + Intergenic
1008846684 6:55974733-55974755 TGACTTGGGGGTGGGGGCTGGGG - Intergenic
1009829898 6:68916826-68916848 GGTCTTGAAGGTGTAGGCTGGGG + Intronic
1010938474 6:81888160-81888182 GGTATTGGGGGTGGGTCCTGAGG + Intergenic
1011456811 6:87559393-87559415 GGGGGCGGAGGTGGGAGCTGAGG + Intronic
1012344257 6:98167876-98167898 GGTGTTGGGGGTGGGTCCTGAGG - Intergenic
1012518033 6:100086457-100086479 GGTCTTGGATGTGAGAGCAAAGG + Intergenic
1014416685 6:121192930-121192952 GGTGTTGGAGGTGGCTCCTGAGG - Intronic
1015537126 6:134277488-134277510 GGTCCTGGAGGTGTGAGAGGTGG + Intronic
1016257658 6:142128027-142128049 AATGTTGGAGGTGGGACCTGTGG + Intergenic
1016420304 6:143875735-143875757 GGTGTTGGAGGTGGTTTCTGAGG + Intronic
1016570649 6:145508185-145508207 GGTCTTCCAGGTGGGGCCTGGGG + Intronic
1017225687 6:152018608-152018630 GGTTTTGGGGGTGGGAGGAGCGG + Intronic
1017653141 6:156601368-156601390 GGTCATCGAGGTGTGAGGTGTGG - Intergenic
1018065473 6:160122531-160122553 GGTCTTTGAGGAGGAAGCTGAGG + Intronic
1018414897 6:163592226-163592248 CGTCTTCGAGATGGGAGCTGTGG + Intergenic
1018842263 6:167525824-167525846 GAGCTTGGAGGTGGGAGATGGGG + Intergenic
1019124574 6:169829781-169829803 GTACTTGGAGGTGGGGGATGAGG + Intergenic
1019173278 6:170146805-170146827 GGTCTGGGCTGTGGCAGCTGAGG + Intergenic
1019365397 7:630169-630191 GGTCCTGGAAGGGGGAGGTGGGG - Intronic
1019510044 7:1413162-1413184 GGTCTTGGAGGGGCGGGCAGTGG + Intergenic
1019818764 7:3222737-3222759 GGTGTTGGAGATGGGGCCTGGGG + Intergenic
1019896622 7:3988259-3988281 GGGTGTGGAGGTGGGGGCTGGGG - Intronic
1020098747 7:5382661-5382683 GGTCTGGGAGGGAGGGGCTGTGG - Intronic
1021270822 7:18583549-18583571 GGTCAGGGCAGTGGGAGCTGGGG - Intronic
1021490118 7:21210744-21210766 GGTCTGTGAGCTGGGTGCTGTGG + Intergenic
1021659869 7:22909148-22909170 AGTGTTGGAGGTGGGGCCTGGGG + Intergenic
1021689042 7:23214489-23214511 GGCGATGGAGGTGGGGGCTGAGG - Intergenic
1022077342 7:26985062-26985084 AGTCTAGGAGGTTGAAGCTGAGG + Intronic
1023197278 7:37655262-37655284 GCACTTGGAGGTGGTAGCTTTGG - Intergenic
1023410523 7:39885283-39885305 GGTCATGGAGGCAGGATCTGTGG + Intergenic
1023450930 7:40284140-40284162 GGGGTTGGAGGTGGGGGCAGGGG + Intronic
1023830627 7:44037020-44037042 GGCCTCGGAGGTGTGAGCTTTGG + Intergenic
1024220949 7:47286187-47286209 GGTCTGGGTTGTGGCAGCTGTGG - Intronic
1025032947 7:55572258-55572280 GCTCTTGGAGGTAGGGGCCGGGG - Exonic
1025805138 7:64824128-64824150 AGTGTTGGAGGTGGGACCTAGGG + Intronic
1026360635 7:69598828-69598850 GGTCTTCGAGGGGGGAGGAGAGG - Intergenic
1029587658 7:101485750-101485772 GGTGTTGGGGGTGGGAGCAGTGG + Intronic
1029740956 7:102491334-102491356 GGCCTCGGAGGTGTGAGCTTTGG + Intronic
1029758950 7:102590507-102590529 GGCCTCGGAGGTGTGAGCTTTGG + Intronic
1030653429 7:112140284-112140306 GGTCCTGCAGGTGGGGGTTGGGG - Intronic
1030727223 7:112939816-112939838 GGGGTAGGAGGAGGGAGCTGCGG + Exonic
1030806434 7:113925831-113925853 GGTTTTGGAGGAGGGAGATCAGG - Intronic
1031501438 7:122522718-122522740 GGTGTTGGGGGTGGGGGATGGGG - Intronic
1031676249 7:124615885-124615907 GGCCTTGGGGGTGGGTCCTGAGG - Intergenic
1032227647 7:130046139-130046161 CCTGTTGGAGGTGGGAGTTGGGG + Intronic
1032874273 7:136020506-136020528 GGTATTGGAGATGGGATCTTTGG + Intergenic
1032887958 7:136162702-136162724 GGAATGGGAGGAGGGAGCTGTGG + Intergenic
1033224138 7:139547411-139547433 GGCCTTGGAGCTCAGAGCTGGGG + Intergenic
1034266863 7:149785309-149785331 GGTCGGGGTGGTGGGGGCTGGGG + Intergenic
1035324277 7:158054856-158054878 TGTCTTGGAGGTGCCAGCAGTGG - Intronic
1035375620 7:158404944-158404966 GGCCAGGGAGCTGGGAGCTGGGG - Intronic
1035641228 8:1186582-1186604 TGTCATGGAGGTGGGGGGTGCGG + Intergenic
1037003307 8:13747365-13747387 GGTCTTGGGCATGGGAACTGTGG + Intergenic
1037363891 8:18102548-18102570 AGTGCTGGAGGTGGGACCTGTGG + Intergenic
1037508549 8:19557480-19557502 GGGCTTTGAGGTGGGAAATGAGG - Intronic
1037557040 8:20034840-20034862 GATCTTGGAGGTGGGAGACAAGG - Intergenic
1037828969 8:22177183-22177205 GGTCCTGGAGGTGGGGGCTGGGG - Intronic
1038364379 8:26916096-26916118 GGGCTTGGTGGTGGGAGTGGGGG - Intergenic
1038654336 8:29435580-29435602 GCTCTTGGAGGTTGGGGGTGGGG - Intergenic
1038819662 8:30940822-30940844 GGTGTTGGAGGTGGAACCTTTGG - Intergenic
1038861433 8:31392951-31392973 GGACTAGGAGGTGTGGGCTGGGG + Intergenic
1039006841 8:33048281-33048303 GGTTTTTGAGGTGGAAGCTTAGG - Intergenic
1039289449 8:36077903-36077925 AGTCCAGGAGTTGGGAGCTGAGG + Intergenic
1039440987 8:37595196-37595218 GCTCTTGGGGGTTGGAGCTGAGG - Intergenic
1039574715 8:38613851-38613873 GGTCTTGAAGTTTGGAGGTGAGG + Intergenic
1039848657 8:41343742-41343764 TGCTTTGAAGGTGGGAGCTGGGG + Intergenic
1040667125 8:49647567-49647589 GGTTCTGGATGTGGGAACTGGGG + Intergenic
1041872088 8:62646938-62646960 GGCCTTTGTGCTGGGAGCTGGGG - Intronic
1044480945 8:92687464-92687486 AGTATTGGAGGTGGGGCCTGGGG + Intergenic
1044684415 8:94813262-94813284 GATCTTGGAGGTGGGGGTGGGGG - Intergenic
1045032582 8:98151818-98151840 GGTCCGGGAGGTGGAGGCTGTGG - Intronic
1045181839 8:99792588-99792610 GGTCCTGGGGCAGGGAGCTGTGG + Intronic
1046238782 8:111463523-111463545 AGTTTTGGAGGTTGGATCTGAGG + Intergenic
1046405140 8:113763411-113763433 AGTGTTGGAGGTGGGACCTGGGG - Intergenic
1046819661 8:118621565-118621587 GGACTTTGAGGTAGGAGGTGTGG - Intronic
1046961464 8:120117530-120117552 GGTAATGGAGGTGGGACCTTTGG + Intronic
1047030962 8:120880100-120880122 GGTGTGTGAGATGGGAGCTGAGG + Intergenic
1047959613 8:130001396-130001418 GGTTCAGGTGGTGGGAGCTGTGG - Intronic
1048269927 8:133020383-133020405 TGTCGTTGAGGCGGGAGCTGAGG + Intronic
1048770124 8:137886193-137886215 GGTGTGGGAGGTGGGGGCAGAGG + Intergenic
1048876116 8:138837991-138838013 AGTTCTTGAGGTGGGAGCTGGGG + Intronic
1048895394 8:138988012-138988034 GGACTTGGAGGTGGGGCCTTTGG - Intergenic
1048901202 8:139039612-139039634 TGACCTGGAGGTGGGAGATGGGG - Intergenic
1049046283 8:140154543-140154565 GGGCTAGGAGGTGGGAGCAGTGG - Intronic
1049125846 8:140787023-140787045 GGTCTTGGAGGGCTAAGCTGAGG + Intronic
1049219507 8:141422496-141422518 GATCCTGGAGGAGGGAGATGGGG + Intronic
1049356164 8:142189491-142189513 GATCCTGCAGGTGGGTGCTGCGG - Intergenic
1049536063 8:143183092-143183114 GGGCCAGGAGGTGGGAGATGGGG - Intergenic
1049685896 8:143939225-143939247 GGTCTTGGAGATGGGGGTCGGGG - Intronic
1051530885 9:18101681-18101703 GGTCTAGGAGGTGAGAGATAAGG + Intergenic
1051582599 9:18694179-18694201 AGTGTTGGAGGAGGGGGCTGGGG - Intronic
1052605135 9:30689426-30689448 GGTCTTAGAGGTGGAAGAGGAGG + Intergenic
1052990685 9:34517867-34517889 GGTCCCTGAGCTGGGAGCTGTGG + Intronic
1053316848 9:37059305-37059327 GGTGTTGAGGGTGGGAGCAGAGG - Intergenic
1053360725 9:37485135-37485157 GGTGTTGGAGGCGGGTGTTGAGG + Intergenic
1053365146 9:37517611-37517633 GGGGTGGGAGGTGGGAGCTCAGG + Intronic
1053433492 9:38059372-38059394 GATCTTGGAGGTGGGTCCAGGGG - Intronic
1055618605 9:78099599-78099621 GATTTTGGAGGTGGGAGATGGGG - Intergenic
1056244702 9:84682648-84682670 GTTATTGGAGAGGGGAGCTGAGG - Intronic
1056579802 9:87882719-87882741 GGACTGGGGGCTGGGAGCTGAGG + Intergenic
1056678720 9:88698476-88698498 GGTCTTGGGGCTGGGGGCTGGGG - Intergenic
1056890558 9:90488072-90488094 GTTCCTGGAGGGTGGAGCTGGGG + Intergenic
1056950806 9:91039582-91039604 GTCCTTGGAGTTGGGAGGTGTGG - Intergenic
1057325874 9:94062745-94062767 AGTGTTGGAGGTGGGGCCTGTGG - Intronic
1057397935 9:94696624-94696646 CTTTTTGGAGGTGAGAGCTGGGG + Intergenic
1057491324 9:95522177-95522199 AGTGTGGGAGGTGGGAGCTTGGG + Intergenic
1057526883 9:95810757-95810779 GTTCCTGGAGGTGGGAGTAGGGG + Intergenic
1057696087 9:97323894-97323916 GCTCTTGGACGTGCGTGCTGGGG + Exonic
1057996006 9:99822150-99822172 GGCCGTGGAGGTGGGAACAGCGG + Exonic
1058721692 9:107770043-107770065 GATCTTGGGGGTGGGCGGTGAGG + Intergenic
1058870045 9:109193472-109193494 GGTTTTGGAAGTGAGTGCTGTGG + Intronic
1058934493 9:109755685-109755707 GGGGGTGGAGGTGGGGGCTGGGG - Intronic
1059655268 9:116352197-116352219 GGCATTGGTGGTGGGAGCTGGGG + Intronic
1060205727 9:121681743-121681765 GGGCTGGGTGCTGGGAGCTGAGG + Intronic
1060733193 9:126050628-126050650 GGATCTGGTGGTGGGAGCTGAGG - Intergenic
1061877167 9:133550044-133550066 GGTCTTGGATGGGGGAGCTTGGG - Intronic
1062015278 9:134288148-134288170 GGTCCTGGCTGTTGGAGCTGGGG + Intergenic
1062055644 9:134468545-134468567 GGCCTTTGAGGTGGGTGCAGAGG - Intergenic
1062549654 9:137080186-137080208 AGTTTTGGTGGTGGGAACTGAGG + Intronic
1203745544 Un_GL000218v1:39066-39088 GGTGTTGGGTGTGTGAGCTGGGG + Intergenic
1203475265 Un_GL000220v1:144534-144556 GAACTTGGAGGTGGGGGCGGGGG - Intergenic
1187252589 X:17612359-17612381 GGTCTTGGAAGTGGGAGTGTGGG - Intronic
1187410221 X:19044720-19044742 GGATATGGAGGTGGGAGTTGGGG - Intronic
1187793950 X:22980803-22980825 TCTCTTGGAGCTGGGAGGTGTGG - Intergenic
1187883182 X:23865029-23865051 GGGCATGGAGGTGGGGGCAGGGG - Intronic
1188151743 X:26684790-26684812 TGTCATGGAGGTGGGAGTTGAGG + Intergenic
1189354266 X:40299221-40299243 GGTGTTGGAGCTGGGGGCCGTGG - Intergenic
1190058571 X:47196377-47196399 AGTCTTGGAGGTGTGAGAGGAGG - Intronic
1190213591 X:48466485-48466507 AGTCTGGGAGGTGGGATCTGAGG + Intronic
1190224406 X:48534255-48534277 GCTCTGTGAGGTGAGAGCTGTGG - Intergenic
1190321155 X:49179958-49179980 TGTTTGGGAGCTGGGAGCTGAGG - Intronic
1190688483 X:52894622-52894644 GGTCATCGAGGAGGGAGATGAGG + Intronic
1190697500 X:52961170-52961192 GGTCATCGAGGAGGGAGATGAGG - Intronic
1190742866 X:53301629-53301651 GGGCTTGGAGGTGTTGGCTGGGG + Intronic
1191226386 X:58048837-58048859 GGTGTTGGAGGTGGGTCCTGAGG - Intergenic
1191630416 X:63315669-63315691 GGTGTTGGAGGTGGCTCCTGAGG + Intergenic
1191742847 X:64453761-64453783 GGTGTTGGAGGTGGCTCCTGAGG + Intergenic
1193070760 X:77303491-77303513 GGTGTTGGTGGTGGCAGTTGGGG - Intergenic
1193134718 X:77957955-77957977 AGTGTTGGAGGTGGGACTTGTGG + Intronic
1193442052 X:81554274-81554296 GGTCTGGGAGGTGGGAGAAAAGG - Intergenic
1193879135 X:86900200-86900222 GGTGTTGGGGGTGGCTGCTGAGG + Intergenic
1194972798 X:100362655-100362677 GGGCGTGGTGGTGGGTGCTGTGG + Intronic
1195197898 X:102516934-102516956 GGCCTGGGAGGTGGGGCCTGGGG - Intergenic
1195347145 X:103962451-103962473 GGCCTGGGAGGTGGGGCCTGGGG + Intronic
1195360297 X:104076390-104076412 GGCCTGGGAGGTGGGGCCTGGGG - Intergenic
1195627481 X:107019066-107019088 AGTATTGGAGGTGGGGCCTGGGG + Intergenic
1195871720 X:109493371-109493393 GGCAGTGGAGGTGGGAGCGGAGG + Intergenic
1195916709 X:109943150-109943172 GGTTTTGAAGCTGGGAACTGGGG + Intergenic
1196871343 X:120116062-120116084 GGTGTTGCAGGTGGGAGTGGGGG + Intergenic
1196900484 X:120378264-120378286 AGTCTTGGACTTTGGAGCTGAGG - Intronic
1197183728 X:123563449-123563471 GGGGTTAGAGGTAGGAGCTGGGG - Intergenic
1198462618 X:136877959-136877981 GGTCTTAGAGGTGGAAGAGGAGG - Exonic
1199276617 X:145951261-145951283 GTTTTTGGAGGTGGGAACTTTGG + Intergenic
1199650011 X:149940614-149940636 GGAGTTGGGGGAGGGAGCTGAGG + Intergenic
1199998677 X:153044735-153044757 GCTCTGGGAGGAAGGAGCTGGGG - Intergenic
1200047842 X:153411905-153411927 GGGCTGGGCGCTGGGAGCTGCGG + Intergenic
1200230442 X:154441292-154441314 GGTCTTGGAGCTGGGAACTGGGG + Intronic
1201165324 Y:11204067-11204089 GGTGTCAGAGGTGGGATCTGTGG + Intergenic
1201242857 Y:11975428-11975450 GGTTTTGGAGGGGACAGCTGTGG + Intergenic
1201400288 Y:13597454-13597476 GTTGTTGAAGGTGGGTGCTGAGG + Intergenic
1201986722 Y:19976672-19976694 GGTTTTGGAGGGAGGAGTTGAGG + Intergenic