ID: 1133300574

View in Genome Browser
Species Human (GRCh38)
Location 16:4779870-4779892
Sequence GGGGAGTCCTATCCTTTTCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 42}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133300572_1133300574 -10 Left 1133300572 16:4779857-4779879 CCCAGGCAGGAGAGGGGAGTCCT 0: 1
1: 0
2: 6
3: 66
4: 392
Right 1133300574 16:4779870-4779892 GGGGAGTCCTATCCTTTTCGAGG 0: 1
1: 0
2: 0
3: 2
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133300574 Original CRISPR GGGGAGTCCTATCCTTTTCG AGG Intronic