ID: 1133301975

View in Genome Browser
Species Human (GRCh38)
Location 16:4787982-4788004
Sequence CTGGCTGCAAACACCCATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 138}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133301975_1133301980 -6 Left 1133301975 16:4787982-4788004 CCAGGATGGGTGTTTGCAGCCAG 0: 1
1: 0
2: 1
3: 22
4: 138
Right 1133301980 16:4787999-4788021 AGCCAGGCTGGAGTCCTGGAGGG 0: 1
1: 0
2: 6
3: 53
4: 495
1133301975_1133301989 24 Left 1133301975 16:4787982-4788004 CCAGGATGGGTGTTTGCAGCCAG 0: 1
1: 0
2: 1
3: 22
4: 138
Right 1133301989 16:4788029-4788051 GGAGTGTGTATGGGGTGAAGTGG 0: 1
1: 0
2: 1
3: 36
4: 480
1133301975_1133301987 15 Left 1133301975 16:4787982-4788004 CCAGGATGGGTGTTTGCAGCCAG 0: 1
1: 0
2: 1
3: 22
4: 138
Right 1133301987 16:4788020-4788042 GGGCTTCAGGGAGTGTGTATGGG 0: 1
1: 0
2: 0
3: 17
4: 179
1133301975_1133301983 2 Left 1133301975 16:4787982-4788004 CCAGGATGGGTGTTTGCAGCCAG 0: 1
1: 0
2: 1
3: 22
4: 138
Right 1133301983 16:4788007-4788029 TGGAGTCCTGGAGGGGCTTCAGG 0: 1
1: 1
2: 4
3: 47
4: 390
1133301975_1133301978 -10 Left 1133301975 16:4787982-4788004 CCAGGATGGGTGTTTGCAGCCAG 0: 1
1: 0
2: 1
3: 22
4: 138
Right 1133301978 16:4787995-4788017 TTGCAGCCAGGCTGGAGTCCTGG 0: 1
1: 0
2: 6
3: 105
4: 1939
1133301975_1133301984 3 Left 1133301975 16:4787982-4788004 CCAGGATGGGTGTTTGCAGCCAG 0: 1
1: 0
2: 1
3: 22
4: 138
Right 1133301984 16:4788008-4788030 GGAGTCCTGGAGGGGCTTCAGGG 0: 1
1: 0
2: 1
3: 42
4: 286
1133301975_1133301986 14 Left 1133301975 16:4787982-4788004 CCAGGATGGGTGTTTGCAGCCAG 0: 1
1: 0
2: 1
3: 22
4: 138
Right 1133301986 16:4788019-4788041 GGGGCTTCAGGGAGTGTGTATGG 0: 1
1: 0
2: 4
3: 29
4: 271
1133301975_1133301979 -7 Left 1133301975 16:4787982-4788004 CCAGGATGGGTGTTTGCAGCCAG 0: 1
1: 0
2: 1
3: 22
4: 138
Right 1133301979 16:4787998-4788020 CAGCCAGGCTGGAGTCCTGGAGG 0: 1
1: 0
2: 10
3: 157
4: 2166
1133301975_1133301988 16 Left 1133301975 16:4787982-4788004 CCAGGATGGGTGTTTGCAGCCAG 0: 1
1: 0
2: 1
3: 22
4: 138
Right 1133301988 16:4788021-4788043 GGCTTCAGGGAGTGTGTATGGGG 0: 1
1: 0
2: 2
3: 21
4: 227
1133301975_1133301981 -5 Left 1133301975 16:4787982-4788004 CCAGGATGGGTGTTTGCAGCCAG 0: 1
1: 0
2: 1
3: 22
4: 138
Right 1133301981 16:4788000-4788022 GCCAGGCTGGAGTCCTGGAGGGG 0: 1
1: 0
2: 9
3: 135
4: 1180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133301975 Original CRISPR CTGGCTGCAAACACCCATCC TGG (reversed) Intronic
900582047 1:3414229-3414251 CTGGCTGCCAGCACCCCTGCAGG - Intronic
902641342 1:17768237-17768259 CTGGCTGGAGCCACCCATCCTGG - Intronic
902975327 1:20084268-20084290 CTGCCTGCAAAGAACCATCAGGG + Intronic
903626046 1:24730804-24730826 CTGGCTGCAGAGACTCAGCCCGG + Intergenic
904201583 1:28823149-28823171 CTTTCTGCACACACCCTTCCTGG - Intronic
904301199 1:29555980-29556002 CTGGGTGCAGAGACCCTTCCGGG + Intergenic
905970422 1:42137752-42137774 TTGGCTCCCAACACCCCTCCAGG - Intergenic
905974779 1:42166206-42166228 TTGGCTACACACACCCATCAGGG - Intergenic
908413484 1:63889582-63889604 CTGTGAGCAAACAGCCATCCGGG - Intronic
908655996 1:66389624-66389646 CTGGCTGGCAACACCCCACCTGG + Intergenic
909491106 1:76227245-76227267 CTGGCTGTAAACAACCAGCATGG + Intronic
909571489 1:77117051-77117073 CTGACTGCAGACACCCATCTTGG + Intronic
915594179 1:156887123-156887145 CTGGCTGGAAACACCCATAGGGG - Intergenic
915731677 1:158058520-158058542 CTGGCTGCCAACATCCATGGGGG - Intronic
923215630 1:231845615-231845637 CTGCCTGGAAACCCCCAGCCTGG - Intronic
924356579 1:243183390-243183412 CTGGATGACAACACTCATCCAGG + Intronic
1062957435 10:1549489-1549511 CTGGGTGGAAACACCAACCCCGG - Intronic
1074327587 10:112467523-112467545 TGGGCTGCAAAAAGCCATCCTGG + Intronic
1077753866 11:5004412-5004434 CAAGCTGGAAACACCCCTCCAGG + Intergenic
1078901919 11:15650217-15650239 CTGGCTGCGGAGACCCAGCCTGG + Intergenic
1082075766 11:47975096-47975118 CTGGATGCCAGCACTCATCCAGG - Intergenic
1082987281 11:59179787-59179809 CTGGCTGGCAACACCCTGCCTGG - Intronic
1087277542 11:96175408-96175430 CTGGCTGCAAAAACCCATAGAGG + Intronic
1089013906 11:115151493-115151515 CTGGCTTCAGCCCCCCATCCTGG + Intergenic
1089462731 11:118662349-118662371 CTTGCTGCCACCACCCAGCCGGG + Intronic
1089729741 11:120512358-120512380 CCGGCTGCAGCCCCCCATCCCGG + Intronic
1092442873 12:8524424-8524446 CTGGATGCATACACCCTACCGGG - Intergenic
1094366895 12:29693001-29693023 CTGACTGCAAATGCCCATCAGGG + Intronic
1101351729 12:103935966-103935988 ATGGCTGCTAACACCTATCCAGG + Intronic
1103188686 12:118982078-118982100 CTGCCTGCATCCACCCCTCCGGG - Intronic
1103455919 12:121065130-121065152 CTGGCTGCAAAAGCCTATCCAGG + Intergenic
1103596979 12:122030096-122030118 CTGGCTGCACCCACACATTCAGG + Intronic
1106354885 13:28971925-28971947 CTGCATGCAAACAGCCATGCTGG + Intronic
1108046700 13:46390135-46390157 CTGCCTGCCAAAACCCAGCCAGG + Intronic
1110186978 13:72686435-72686457 CTGGCTGCAAAGAGCCCTTCTGG + Intergenic
1112036911 13:95505555-95505577 CTGTCTGCCAACAACCACCCTGG - Intronic
1112278894 13:98045476-98045498 CTCACTGCAAACTCCCCTCCCGG + Intergenic
1112411371 13:99166420-99166442 CAGGCAGCAACCACCCTTCCAGG - Intergenic
1112659183 13:101487948-101487970 CTGACTGCAAACAGCCATGCAGG + Intronic
1117201239 14:53392102-53392124 CTTGCTGGAAACTCCCTTCCTGG + Intergenic
1119915815 14:78400760-78400782 CCGACTGCATACACCCAGCCAGG - Intronic
1122298682 14:100719698-100719720 CTGGCTGCAGACAGCCAGCTTGG + Intergenic
1122887202 14:104715402-104715424 CTTGCTGCCCACACCCCTCCGGG + Intronic
1124432371 15:29618714-29618736 CTGGCAGCCACCACCCATCAGGG - Intergenic
1125359513 15:38850320-38850342 CAGGCAGCCAAAACCCATCCTGG + Intergenic
1128412110 15:67410126-67410148 CTGGCTTAAAACACCCATCATGG + Intronic
1130208576 15:81901484-81901506 CAGGCTGCCATCACACATCCCGG + Intergenic
1130830128 15:87590901-87590923 CTGTCTGCAAACTCACACCCAGG - Intergenic
1131024375 15:89127524-89127546 CTGGCTGAAAACACCAGTTCAGG - Intronic
1132710620 16:1265523-1265545 CTGGCCGCATTCACCCATCATGG + Intergenic
1133301975 16:4787982-4788004 CTGGCTGCAAACACCCATCCTGG - Intronic
1136461994 16:30417400-30417422 CTGGATGCGCACAGCCATCCTGG + Intronic
1137673378 16:50291992-50292014 CTGTCTGCAAACACGGCTCCGGG - Intronic
1139599647 16:67978957-67978979 CTGGCAGCAAACAGTCATCAAGG - Intronic
1142737208 17:1908537-1908559 CTGGCTTCAAACACCAAACGCGG - Intergenic
1143130585 17:4674627-4674649 CAGTCTGCAAACTCCCATCAGGG + Exonic
1144721770 17:17476114-17476136 CTGCCTGCAACCACACATACAGG + Intergenic
1145712815 17:26992501-26992523 CTGGCTTCAAACCCCCTGCCAGG - Intergenic
1147757637 17:42779493-42779515 CTGGCTGCAGGCAGCCTTCCAGG + Exonic
1149819748 17:59764550-59764572 CTGGCTTCAAGCAGTCATCCTGG + Intronic
1151489921 17:74426839-74426861 CACCCTGCAAACCCCCATCCGGG - Intronic
1151979505 17:77500119-77500141 CTGGCTGCAAGCAGCCAGCCCGG - Exonic
1152395977 17:80033658-80033680 CTGGCTTCAAATACAAATCCTGG - Intronic
1152668819 17:81589018-81589040 ATGGCAGCAAACACTCATCACGG + Exonic
1158148094 18:54338570-54338592 CTGACTCCATCCACCCATCCTGG - Intronic
1160014722 18:75131811-75131833 CTGGCTGCAAACACCTCGCCGGG + Intergenic
1160706573 19:532678-532700 CTGGCTGCCAAGGCTCATCCGGG - Intronic
1160856518 19:1220347-1220369 CGGGCAGCACACACCCGTCCTGG - Intronic
1161137371 19:2627510-2627532 CGTGCTGTAAACACCCACCCAGG + Intronic
1162034074 19:7929810-7929832 ATGGCTGCAACCACCTCTCCTGG + Intronic
1167492530 19:49800889-49800911 GTGGCTGCACCCACCGATCCCGG + Intronic
925678867 2:6395879-6395901 CTGGTTGCAGAAACTCATCCTGG + Intergenic
926643622 2:15264571-15264593 TTGGCTGCAGAAGCCCATCCGGG - Intronic
927313975 2:21660826-21660848 ATGGCTAAAAACATCCATCCTGG - Intergenic
927877588 2:26669226-26669248 CTGGCAGCCAGCACCCAGCCTGG - Intergenic
928229594 2:29485912-29485934 CTGGCTGCAAGCACTGATTCTGG + Intronic
928914395 2:36456053-36456075 CTGGCTGCTAACACTCCTTCAGG - Intronic
929819432 2:45261477-45261499 CTGGCTGCAAAAGCCCCTCCTGG + Intergenic
933117832 2:78497352-78497374 CTGGCTGCCAACAACCATTGTGG + Intergenic
935854137 2:107256775-107256797 CTGGCTGGTACCACCCATGCTGG + Intergenic
936462820 2:112724742-112724764 CGGGCTGCACACACACAGCCTGG - Intronic
936777052 2:115986408-115986430 CTGCCTCCAATCACCTATCCTGG + Intergenic
938079957 2:128364634-128364656 TTGGCTGCAGACAACCCTCCCGG - Intergenic
938405384 2:131030031-131030053 CTGACTGCACACACCCAGCAGGG + Intronic
940859118 2:158754000-158754022 CTGGCTGCAAGCAGACATTCTGG - Intergenic
948691889 2:239711434-239711456 CTGGCCACCAACACCCAGCCTGG + Intergenic
1168962713 20:1879991-1880013 CGGGATTCAAACCCCCATCCAGG - Intergenic
1170258494 20:14375329-14375351 CTGGCTGCAAAATTCCATACTGG - Intronic
1170430012 20:16267221-16267243 ATGGCAGAAATCACCCATCCTGG - Intergenic
1173253161 20:41375222-41375244 CTGGCTGCAAAGACTCAACCTGG - Intergenic
1175490625 20:59378708-59378730 CTGGCTTCAAACCCCCAGCCAGG - Intergenic
1175739884 20:61413066-61413088 CTCCCTGCAAACACCCTTCCCGG + Intronic
1175790494 20:61737424-61737446 CTGGCCGCAAACACCCTGCACGG + Intronic
1179673937 21:42969071-42969093 CCCCCTGCACACACCCATCCTGG - Intergenic
1184747098 22:46462351-46462373 CAGGCTGCCAACACCCGTGCTGG + Intronic
1185182509 22:49371582-49371604 ATGGCTGGAAACACCCACCCGGG - Intergenic
1185280425 22:49967489-49967511 CAGGCTGCCACCGCCCATCCAGG + Intergenic
950359816 3:12442181-12442203 CCAGCTGCAAGCACCCACCCTGG - Intergenic
952522854 3:34179462-34179484 CTCACTGCAAGCTCCCATCCTGG - Intergenic
956248959 3:67215447-67215469 CTAGCTGGAAACACACATTCAGG + Intergenic
956597697 3:70986262-70986284 CTCTCTGCCAACACCCAGCCCGG + Intronic
958141762 3:89571170-89571192 CTGCCTGCAGATACCCACCCTGG - Intergenic
958972676 3:100629965-100629987 CTGGCTGCAATGACTAATCCAGG + Intronic
960005259 3:112775177-112775199 CTGGCTGCAAAAACCTTTCCCGG - Intronic
961432640 3:126893981-126894003 AGGGCTGCAAACACACCTCCAGG + Intronic
963044011 3:141089271-141089293 GTGGCTGCAAATCCCCATCCTGG - Intronic
966022823 3:175236472-175236494 CTGACTGCAACCTCCCCTCCTGG - Intronic
966674265 3:182568350-182568372 TTGGCTGGAAAGTCCCATCCAGG - Intergenic
967532197 3:190561412-190561434 CTGTCTGCGAACACACATCCAGG - Intronic
970035301 4:11728018-11728040 CTGGCTTCAAACTCCCACCCAGG - Intergenic
971211581 4:24622919-24622941 ATGGCAGAAAACACCTATCCTGG + Intergenic
977895154 4:102355959-102355981 CTGTCTGCAAACACCACACCTGG + Intronic
980050591 4:128035592-128035614 ATGGATTCAAACACCCATTCTGG + Intronic
981944155 4:150321265-150321287 GTGGCAGCCAACACCCAGCCTGG - Exonic
984098009 4:175455208-175455230 GTGCCTAGAAACACCCATCCCGG - Intergenic
984905526 4:184622301-184622323 CTGACTGCAAAACCCCATCGTGG + Intergenic
985071737 4:186172233-186172255 CGGACTGCAAACACACATCAGGG - Exonic
986621982 5:9685651-9685673 TTCTGTGCAAACACCCATCCAGG + Intronic
988018131 5:25586644-25586666 CTGCCTGCAATCTGCCATCCTGG + Intergenic
989118224 5:37977490-37977512 CTGGCTGCACACACACATCCTGG - Intergenic
991582242 5:68168443-68168465 CTGACTGCAATCTCCCCTCCTGG + Intergenic
993583665 5:89696212-89696234 CTGACTGCAAAAACTCATGCTGG - Intergenic
999747578 5:154604087-154604109 CTTTCTTCAAACACCCAGCCAGG - Intergenic
1000377871 5:160600589-160600611 CTCTATGCTAACACCCATCCTGG + Intronic
1001985924 5:176074412-176074434 ATGGCTGCAAACACCTGGCCTGG - Intronic
1002230947 5:177763712-177763734 ATGGCTGCAAACACCTGGCCTGG + Intronic
1002264391 5:178020036-178020058 ATGGCTGCAAACACCTGGCCTGG - Intronic
1002419773 5:179139511-179139533 CTGGCTGCAAACAGCTGCCCAGG + Intronic
1004528050 6:16427691-16427713 CTGCCTGAAAACTTCCATCCTGG - Intronic
1004634216 6:17451367-17451389 CAGACAGCAAACACCCAACCTGG - Intronic
1005841215 6:29745668-29745690 CTGACTGCACAGATCCATCCTGG + Intergenic
1005870691 6:29972404-29972426 CTGACTGCACAGATCCATCCCGG + Intergenic
1006072095 6:31505654-31505676 CTGACTGCACAGATCCATCCTGG - Exonic
1006381842 6:33703236-33703258 CTCACTGCAAACTCCCCTCCTGG + Intronic
1015719002 6:136221822-136221844 TTGGATCCAAACACCTATCCAGG + Intergenic
1016935865 6:149449043-149449065 CTGGCAGCATCCACCCATTCTGG - Intronic
1018677507 6:166235837-166235859 CTGGCTGCAGACGGCCAGCCTGG + Intergenic
1019702372 7:2480191-2480213 CTGGCTGCAGCCATCCGTCCTGG - Intergenic
1023354070 7:39349811-39349833 CTGGCTGAAAACACCAGTCCTGG + Intronic
1024942717 7:54778874-54778896 CTTGTTGCCAAAACCCATCCAGG - Intergenic
1030140248 7:106296883-106296905 CTGGCTACAAACATGCAGCCAGG - Intergenic
1035484339 7:159211070-159211092 CTGGATGAAAACACACAGCCAGG - Intergenic
1036157098 8:6352464-6352486 CTTGCTGTAAAGACGCATCCAGG + Intergenic
1036460358 8:8947127-8947149 CTGGCTGTCATCACCCAGCCTGG + Intergenic
1037843353 8:22261437-22261459 CTCACTGCAAACTCCCCTCCTGG + Intergenic
1042303344 8:67309807-67309829 CTGACTGCAAACCACTATCCTGG + Intronic
1048201124 8:132374487-132374509 CTTGCGGCACACACCCCTCCCGG + Intronic
1048280880 8:133104840-133104862 CTGGATGCAAACGGCCACCCAGG + Intronic
1048451557 8:134538038-134538060 CAGGCTGCAAACACAGATCAGGG + Intronic
1048627880 8:136206294-136206316 CTGGCAGCAGATACCCAGCCAGG + Intergenic
1048860611 8:138722164-138722186 CTGGCTGCAAAAACAGCTCCTGG - Intronic
1052404001 9:28036368-28036390 CAGGCTGCAGACACACATCCAGG + Intronic
1057531265 9:95848263-95848285 CTGGCTGGAAACCTCCATGCTGG - Intergenic
1057803326 9:98203255-98203277 ATGGCTGCAAAGTCCCCTCCTGG + Intronic
1059622879 9:116027859-116027881 GGGGATGCAAACACCCCTCCTGG - Intergenic
1061591109 9:131598165-131598187 CAGGCTGCAAAGCCCCAGCCCGG + Intronic
1062102636 9:134736453-134736475 GTAGCTGCATTCACCCATCCAGG + Intronic
1062427261 9:136511732-136511754 CAGGCAGCAAACGCCCATCACGG + Intronic
1062672092 9:137716988-137717010 CATGCTGCAAAAACCCTTCCTGG + Exonic
1190257346 X:48773488-48773510 CTTCCTGCAAACCCCCACCCAGG + Exonic
1190995707 X:55606470-55606492 CTGGCTTCAAACCCCTTTCCAGG + Intergenic
1199622942 X:149715304-149715326 CAGACTGCAAGCACCCATCCTGG - Intronic