ID: 1133303828

View in Genome Browser
Species Human (GRCh38)
Location 16:4798094-4798116
Sequence CATGCAGCTGGTACACCGTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 101}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133303819_1133303828 10 Left 1133303819 16:4798061-4798083 CCCTCCTCACCTTGGTGGAGTTG 0: 1
1: 0
2: 0
3: 12
4: 187
Right 1133303828 16:4798094-4798116 CATGCAGCTGGTACACCGTGAGG 0: 1
1: 0
2: 1
3: 8
4: 101
1133303816_1133303828 22 Left 1133303816 16:4798049-4798071 CCGGGCAGGGGTCCCTCCTCACC 0: 1
1: 1
2: 3
3: 38
4: 383
Right 1133303828 16:4798094-4798116 CATGCAGCTGGTACACCGTGAGG 0: 1
1: 0
2: 1
3: 8
4: 101
1133303820_1133303828 9 Left 1133303820 16:4798062-4798084 CCTCCTCACCTTGGTGGAGTTGG 0: 1
1: 0
2: 1
3: 18
4: 148
Right 1133303828 16:4798094-4798116 CATGCAGCTGGTACACCGTGAGG 0: 1
1: 0
2: 1
3: 8
4: 101
1133303824_1133303828 1 Left 1133303824 16:4798070-4798092 CCTTGGTGGAGTTGGGCTGCAGG 0: 1
1: 0
2: 4
3: 19
4: 222
Right 1133303828 16:4798094-4798116 CATGCAGCTGGTACACCGTGAGG 0: 1
1: 0
2: 1
3: 8
4: 101
1133303823_1133303828 6 Left 1133303823 16:4798065-4798087 CCTCACCTTGGTGGAGTTGGGCT 0: 1
1: 0
2: 0
3: 10
4: 128
Right 1133303828 16:4798094-4798116 CATGCAGCTGGTACACCGTGAGG 0: 1
1: 0
2: 1
3: 8
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133303828 Original CRISPR CATGCAGCTGGTACACCGTG AGG Exonic
904571123 1:31465999-31466021 TATTCATCTGGTACACCCTGTGG - Intergenic
913266044 1:117045836-117045858 CATGCAGATGGCATATCGTGGGG - Intergenic
919500966 1:198337584-198337606 CATGCTTCTGGTACAGCCTGTGG + Intergenic
922447176 1:225707392-225707414 CAGGCAGTTGGGACACAGTGTGG + Intergenic
922572875 1:226644215-226644237 CATCCAGCTGGCACCCCCTGTGG - Intronic
1063550515 10:7028638-7028660 CATGCCTCTGGTACAACCTGTGG - Intergenic
1067295231 10:44971827-44971849 CTTCCAGCTGAGACACCGTGAGG + Exonic
1068752996 10:60618124-60618146 CATGCAGCCAGTACATGGTGGGG + Intronic
1078425408 11:11245739-11245761 CATGGAGATGTTACACAGTGTGG + Intergenic
1079387692 11:19995415-19995437 CTTGCAGCTGGCATGCCGTGGGG + Intronic
1083783617 11:64931429-64931451 CCTGCAGCTGGCATACTGTGTGG + Exonic
1083812970 11:65115936-65115958 CGCGCTGCTGGTGCACCGTGAGG + Exonic
1083934593 11:65863651-65863673 CGTGCAGCTTGCGCACCGTGTGG - Exonic
1084299812 11:68240976-68240998 CATGCTTCTGGTACAACCTGTGG - Intergenic
1088868071 11:113867961-113867983 CATGCAGCTGGTACTTACTGAGG + Intronic
1089188741 11:116638718-116638740 CCTGCAGCTGCTACACCTTCAGG + Intergenic
1093339254 12:17950673-17950695 CAAGCAGCTGTAACACCATGGGG - Intergenic
1094787104 12:33860925-33860947 CATGCATCTCGTACAGCCTGTGG + Intergenic
1096835475 12:54348021-54348043 CCAGCAGGTGGTACACCGGGTGG + Exonic
1100011209 12:89955587-89955609 CAGGCAGCAGGGACACCATGAGG + Intergenic
1102005511 12:109586926-109586948 CTTGCAGCTAGTGCACTGTGAGG - Intronic
1103342023 12:120225850-120225872 CAGGCAGCTGGGACAAGGTGTGG - Intronic
1104477586 12:129083374-129083396 CAGGCAGCTGTGACAGCGTGTGG + Intronic
1107815490 13:44240828-44240850 CAGGCTGCTGGTACCCCTTGTGG - Intergenic
1112736307 13:102423356-102423378 AATGCAGCAGGTGCACCGTCAGG - Intergenic
1112968691 13:105232102-105232124 CCTGCAGTTGCTGCACCGTGCGG - Intergenic
1117503510 14:56377427-56377449 CATGCAGCTGGTAGACATTCTGG - Intergenic
1124971953 15:34496523-34496545 CATGCAGCGGGCAGACCCTGTGG - Intergenic
1125728315 15:41879441-41879463 CGTGCAGCTGGCACACAGTGTGG - Exonic
1128788471 15:70415449-70415471 CATGCTGCTGGTACAGTGTCCGG + Intergenic
1129605355 15:77022307-77022329 CAGGCAGCAGGGACACAGTGGGG + Intronic
1132181178 15:99754008-99754030 GACGCTGCTGGTAAACCGTGGGG + Intergenic
1133303828 16:4798094-4798116 CATGCAGCTGGTACACCGTGAGG + Exonic
1134204314 16:12224490-12224512 GGTGCAGCTGGAGCACCGTGTGG + Intronic
1138122696 16:54413234-54413256 CAGGCAGCTGGTACACACTCCGG + Intergenic
1141431521 16:83972660-83972682 CATGCAGCTGGGCAACCCTGGGG - Intronic
1142410238 16:89912338-89912360 CCTGCAGCTGCAGCACCGTGGGG - Intronic
1145985759 17:29045121-29045143 CATGCATCTGGTACTTCTTGAGG - Intronic
1147325941 17:39669669-39669691 TGAGCAGCTGGTACACGGTGGGG - Exonic
1150221217 17:63496918-63496940 CATGCAGCTCGTTCTCCGTGCGG - Exonic
1151466289 17:74287646-74287668 CATGCACCTGGTAAAGCGAGCGG + Intronic
1152235087 17:79134502-79134524 CTTGCAGCTGGGACACAGTGAGG + Intronic
1153254598 18:3157825-3157847 CTAGCAGCTGCTACACAGTGTGG + Intronic
1157541618 18:48514923-48514945 CCTGCAGCTGGCCCAGCGTGGGG + Intergenic
1160774850 19:850717-850739 GTTGCAGCTGGAACATCGTGGGG + Intergenic
1160782640 19:884601-884623 CAGCCAGCGGGGACACCGTGAGG - Intronic
1160941399 19:1621955-1621977 CATGCAGCTGGTAGCCCTGGGGG + Exonic
1165483632 19:36081919-36081941 CATTCAGCTGCCACACAGTGAGG + Intronic
1165708318 19:37991894-37991916 CATGCAGCTAGTGCAGGGTGGGG - Intronic
925813232 2:7721901-7721923 CATGCAGCTTGCAGACTGTGGGG - Intergenic
925954951 2:8954528-8954550 CATGCAGCTGGGAAACCATCTGG + Intronic
926172140 2:10559138-10559160 CATGCAGCTGCTGCGCGGTGGGG + Intergenic
926386420 2:12339835-12339857 CATGGAGCTGGTCCAGTGTGGGG + Intergenic
926731764 2:16040983-16041005 CATGCAGCAGGTTCATGGTGGGG + Intergenic
928996608 2:37299034-37299056 CATGCAGCTGGTATACTGAATGG - Intronic
931879547 2:66554079-66554101 AATCCAGCTGGTACAACCTGAGG + Intronic
934725665 2:96616771-96616793 CATGCTGCTGGGCCACGGTGTGG - Intronic
936165127 2:110114441-110114463 CATGCAGCTGCTCCAAGGTGAGG + Intronic
937285108 2:120745783-120745805 CCTGCAGCTGGTTCACCTGGTGG + Intronic
944908356 2:204285186-204285208 CATGCAGCAGGGACACCGCAGGG + Intergenic
946644275 2:221816417-221816439 CATGCTGCTTGTACAGCCTGTGG + Intergenic
946937579 2:224737554-224737576 CATGCTACTGGTACAGCCTGAGG + Intergenic
947634781 2:231674427-231674449 CATCCAGCTGGTACACAGTGAGG - Intergenic
947929283 2:233950095-233950117 CAGGCAGCCGGGACACCGTGCGG - Exonic
948860499 2:240750492-240750514 CGTTCCCCTGGTACACCGTGTGG - Exonic
1172445304 20:34990286-34990308 TGTGCAGCTGGGACACCGTCTGG - Exonic
1173440377 20:43070161-43070183 CATGCTGCTGGTGCACAGTCCGG + Intronic
1179590869 21:42407075-42407097 CACGCAGCTGGTACCTGGTGAGG - Intronic
1180937841 22:19637756-19637778 CATGCAGCATCTGCACCGTGGGG + Intergenic
1181066344 22:20307812-20307834 CATGGAGCTGGCTCACCGTGAGG + Intergenic
1183032725 22:35117682-35117704 CACCCAGCTGGTACCCCGGGTGG + Intergenic
949484652 3:4526468-4526490 CCAGCAGCTGGTACACAGTAGGG - Intronic
950574852 3:13826076-13826098 CATGCACCTGTTTCACAGTGAGG + Intronic
953188518 3:40661449-40661471 CATGCAGCTGGTAAGCTATGAGG + Intergenic
957041231 3:75337037-75337059 CATGCTGATGGTACAAGGTGAGG - Intergenic
960640115 3:119815748-119815770 CCTGCAGCTGGTCCACCACGCGG - Exonic
961135074 3:124502547-124502569 CATGCAGCTGGTACCTAGTTGGG - Intronic
966141818 3:176766246-176766268 CATGCAGCTGCTACACAGGGTGG - Intergenic
968066758 3:195763229-195763251 CAAGCAGCTGGGAAACCGTGGGG + Intronic
970717988 4:18950309-18950331 CATTCAGCTGGTACATGGTCAGG + Intergenic
979203827 4:118010924-118010946 CATGCTTCTGGTACAGCTTGTGG - Intergenic
980765956 4:137304714-137304736 CATGCTGCTTGTACAGAGTGTGG - Intergenic
981030250 4:140118258-140118280 CATACAGCTAGTACACGGTAGGG - Intronic
982702402 4:158671639-158671661 CCTCCAGCTGGTCCACCGTTGGG + Exonic
992425485 5:76652639-76652661 CATGGAGCTGGGACACTGTCAGG - Intronic
995856763 5:116600824-116600846 CATGTGGCTGGTACAGAGTGGGG + Intergenic
997303770 5:132824334-132824356 CATGGAGCGGGTACTCTGTGGGG + Exonic
997789225 5:136742158-136742180 CATGCCTCTGGTACAGCCTGTGG + Intergenic
1006754199 6:36400483-36400505 CATGCAGCTGAGACACATTGGGG - Exonic
1009604292 6:65847565-65847587 CATGCTTCTGGTACAGCCTGCGG - Intergenic
1016580794 6:145627652-145627674 CATGCAGCAGGCACACCGCCTGG + Exonic
1029495329 7:100893374-100893396 CACGCAGCTGGCCCACCTTGTGG - Exonic
1032866823 7:135934042-135934064 CATGCCTCTTGTACAGCGTGAGG + Intronic
1038023819 8:23571696-23571718 CGTTGAGCTGGTACACCGTCCGG - Exonic
1043005392 8:74811860-74811882 CCTGCAGCTGGGAAACAGTGGGG + Intronic
1048591570 8:135825403-135825425 CATGCTTCTGGTACAGCCTGTGG + Intergenic
1049104597 8:140603974-140603996 CATGCAGCTCCTTCACCCTGAGG - Intronic
1049684275 8:143933095-143933117 CGTGCAGACGGTACACCCTGGGG + Exonic
1052025925 9:23573038-23573060 CATGCTTCTTGTACACCCTGTGG - Intergenic
1053588723 9:39487996-39488018 TAAGCATCTGGAACACCGTGGGG + Intergenic
1054577582 9:66877298-66877320 TAAGCATCTGGAACACCGTGGGG - Intronic
1056820197 9:89836009-89836031 CATGCAGGTGGTACAGCTTGAGG + Intergenic
1057070867 9:92098838-92098860 TATGCAGCTGCTACACAGGGTGG - Intronic
1057184545 9:93049630-93049652 ACTGCAGCTGGAACACAGTGGGG + Intergenic
1060022760 9:120146521-120146543 CAGGGAGCTGGGCCACCGTGGGG - Intergenic
1060115187 9:120934766-120934788 CCTGCATCTTGTACACAGTGGGG + Intergenic
1062273871 9:135721606-135721628 CATGCAGGTGGCACACCAAGGGG - Intronic
1062295831 9:135826007-135826029 CCTGCAGCCTGGACACCGTGGGG + Intronic
1187388854 X:18872788-18872810 TGTGCAGCTGGTACGCGGTGGGG + Intergenic
1198859683 X:141055886-141055908 CATGCAGCTGCTACCCAGGGTGG + Intergenic
1198903010 X:141531504-141531526 CATGCAGCTGCTACCCAGGGTGG - Intergenic