ID: 1133308451

View in Genome Browser
Species Human (GRCh38)
Location 16:4826816-4826838
Sequence CTGGGGCAGCACAGCTGTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 252}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133308451 Original CRISPR CTGGGGCAGCACAGCTGTCT TGG Intronic
900236876 1:1597270-1597292 CTGGGGCAGCACGGCTCCTTGGG - Intergenic
900568660 1:3347677-3347699 CTGGGGTAGCAAAGCTGAATGGG + Intronic
900615378 1:3563323-3563345 CTATGGCAGCCCAGGTGTCTGGG + Intronic
900726860 1:4222232-4222254 CTGGTGGAGCACAGCTGACCTGG + Intergenic
900814555 1:4833445-4833467 CTGGGGCTGCACAGCTGCTGTGG - Intergenic
901090493 1:6637637-6637659 CTCGGGTAGCAGAGCTGTCAGGG - Intronic
901828948 1:11880481-11880503 CTGGGGCAGTAAAGATGGCTGGG - Intergenic
902562657 1:17287421-17287443 TAGGGACAGGACAGCTGTCTTGG + Intergenic
902684052 1:18064321-18064343 CTGGGGAAATGCAGCTGTCTCGG - Intergenic
904458887 1:30663765-30663787 GTGGGGAAGCACAGCTGTCAGGG + Intergenic
904868020 1:33597441-33597463 TTGGAGCAGGAAAGCTGTCTGGG + Intronic
905994160 1:42366485-42366507 AAGCGGCAACACAGCTGTCTGGG - Intergenic
906109136 1:43311846-43311868 CTGGGGCAGGACAGAGGTGTTGG + Intronic
907239006 1:53070307-53070329 CTGGGGCAGGTCAGATTTCTGGG + Intronic
908399302 1:63755444-63755466 CTCGTACAGCACAGCTGTCTAGG - Intergenic
910737946 1:90482766-90482788 CTGGGGCCCCACATCTGTCATGG + Intergenic
910986973 1:93014734-93014756 CTGGGGGTGAACAGCTATCTTGG - Intergenic
912480459 1:109978616-109978638 CTGGGGGAGCACATCTGCCAGGG + Intergenic
912625360 1:111201495-111201517 CTTGGGCAGAACAGCTGACCTGG - Intronic
915120994 1:153629458-153629480 AGGGGGCAGCTCAGGTGTCTCGG - Intronic
915335298 1:155137451-155137473 ATGGGGAAGCCAAGCTGTCTAGG - Intronic
917051709 1:170932024-170932046 CTGTGGCAGCACAGCTCTCATGG - Intergenic
920416360 1:205801364-205801386 CCAGGGCAGCTCAGCTGTGTGGG - Intronic
922717104 1:227883441-227883463 CTGGGCCAGCACGGGTGTCCAGG + Intergenic
1063227913 10:4033721-4033743 CTGGGGCAGGAGCGCTGTCCTGG - Intergenic
1067559200 10:47293029-47293051 CTGGTGCAGCCCAGCTCGCTGGG - Intergenic
1067737664 10:48870883-48870905 CTGGGGATGCACAGCTCCCTGGG - Intronic
1067847804 10:49737293-49737315 CTGGTGGAGCAGAGCTGTCTTGG - Intronic
1068087205 10:52389265-52389287 CAGGCTCAACACAGCTGTCTGGG - Intergenic
1071503381 10:86218980-86219002 CCTGGTGAGCACAGCTGTCTCGG - Intronic
1072430979 10:95370130-95370152 CTGGGGCTGGAGATCTGTCTTGG + Intronic
1074697646 10:116065033-116065055 CTGGGGAAGGACAGCTGTGCTGG - Intronic
1074721999 10:116272118-116272140 CCAGAGCAGCACAGCTGTCCGGG - Exonic
1075791715 10:125089427-125089449 CAGGGGGAGCACAGGTGTCTAGG + Intronic
1076786284 10:132751586-132751608 CCTGGGGAGCACAGATGTCTGGG + Intronic
1078327514 11:10392662-10392684 CTGGGGCAGGAGAACTTTCTTGG + Intronic
1079114079 11:17629428-17629450 TTGGAGCAGCAGAGCTGTCAGGG + Intronic
1079629764 11:22659626-22659648 ATGGGGCAGCTCATCTGGCTTGG + Intronic
1079994579 11:27282154-27282176 CCAGCGCAGCTCAGCTGTCTTGG - Intergenic
1081876424 11:46411413-46411435 CTGAGGCAGCACAGCCTCCTGGG - Intronic
1083078471 11:60066487-60066509 CTGGGGCAGCAAAGGGGTCAAGG - Intronic
1084425492 11:69081784-69081806 CTGGGGGAGCACTGGTGTCCAGG - Intronic
1086431877 11:86743950-86743972 CTGGTGCAGAAAGGCTGTCTGGG + Intergenic
1089138715 11:116269811-116269833 CTGGGGCAGGACTGATTTCTTGG - Intergenic
1089369662 11:117946457-117946479 CTGGGGAAGCACGGCTGGGTGGG + Intergenic
1089467646 11:118695768-118695790 CCGGGGCAGCAGAGCTGGCAGGG + Intergenic
1091383405 12:77470-77492 CTGGCGAAGCAGAGCTGTCTGGG + Intronic
1094588329 12:31798255-31798277 CTGGGACAGCTCCGCTGTCAAGG + Intergenic
1095941296 12:47728873-47728895 CTGGGCTACCACAGGTGTCTGGG + Intergenic
1100779978 12:98013762-98013784 CTGGGGCAGGACTGGAGTCTGGG - Intergenic
1101829423 12:108245888-108245910 CTGGAACATCACAGCTGTTTGGG - Intronic
1101838751 12:108312955-108312977 CTGGGGCAGCTCAGGGCTCTGGG - Intronic
1102578357 12:113871666-113871688 CTGGAAAAGCACAGCAGTCTGGG + Intronic
1103569919 12:121838275-121838297 CTGGGGCAGTGCAGCTGCGTGGG + Intergenic
1104434711 12:128746833-128746855 CTGGAGAAGCTGAGCTGTCTGGG - Intergenic
1106015220 13:25863088-25863110 CTGGGCCTGCACAGCTTCCTTGG - Intronic
1106073196 13:26434004-26434026 CAGGGGCAGCACAGCAGGCTAGG + Intergenic
1107890354 13:44908962-44908984 GTGGTGCAGCACAGCTGGCTTGG + Intergenic
1108696408 13:52906289-52906311 CAGGGGCACTACTGCTGTCTGGG + Intergenic
1110900124 13:80811687-80811709 AAGAGGCAGCACAGCTCTCTGGG - Intergenic
1113571935 13:111363917-111363939 GAAGGGCAGCCCAGCTGTCTTGG + Intergenic
1113842358 13:113367344-113367366 CTGGTGCTGCAGAGCTGGCTGGG + Intergenic
1114481697 14:23039695-23039717 CTGTGGCATCATAGCTTTCTGGG - Intergenic
1114533285 14:23408445-23408467 CTGGGGCAGCAGACCTTTCTTGG - Intergenic
1114615470 14:24065662-24065684 CTGGGACAGCACAGCAGCCAAGG + Exonic
1118867900 14:69717806-69717828 CTGAGGCAGCCTAGGTGTCTGGG + Intergenic
1119170327 14:72530128-72530150 CTGAGCCAGAAGAGCTGTCTAGG + Intronic
1119962529 14:78875971-78875993 CTGGGGCCTCACAGCTGGTTAGG + Intronic
1122176693 14:99926007-99926029 CTGGGCCAGCACAGCGGTCCTGG - Intronic
1122365446 14:101192481-101192503 CTGGGACAGGAGAGCTGTCTGGG - Intergenic
1124343507 15:28905078-28905100 CTGGGACTGCACAGGTGCCTGGG + Intronic
1127957536 15:63865974-63865996 CTGGAGCAGCCCAGAGGTCTGGG - Intergenic
1129056552 15:72824415-72824437 CTGGAGCAGCAAGTCTGTCTGGG + Intergenic
1129286644 15:74530880-74530902 CTGGCTCAGCACAGCTCTATGGG + Intergenic
1129288678 15:74546346-74546368 CGGGGGCAGCCCAGCCGCCTCGG - Intronic
1130460075 15:84154042-84154064 CAGGGGCAACACAGCTGCCCAGG + Intergenic
1130961148 15:88659448-88659470 CTGGGTCAGCCCAGGAGTCTGGG - Intergenic
1131391508 15:92052673-92052695 CTGGGACAGCACAGCTCTAGAGG - Intronic
1131867013 15:96721943-96721965 CAGAGGCAGCACAGCAGGCTGGG - Intergenic
1132110247 15:99097479-99097501 CGGGGTCAGAACAGCAGTCTGGG + Intergenic
1132338377 15:101063248-101063270 AAGGTGCAGCACAGCTGGCTGGG - Intronic
1132981526 16:2740680-2740702 CTGGAGCGGCTCACCTGTCTGGG + Intergenic
1133248847 16:4466781-4466803 CAGAGGCACCACAGCTGCCTAGG + Intronic
1133308451 16:4826816-4826838 CTGGGGCAGCACAGCTGTCTTGG + Intronic
1134803631 16:17107181-17107203 ATGGGGCAACACATCTGGCTAGG + Exonic
1138658366 16:58503447-58503469 CTGGGGAGGCAGAGCTGTCCAGG + Intronic
1140852534 16:78948514-78948536 ATCAGGCAGCAGAGCTGTCTTGG - Intronic
1141674841 16:85512331-85512353 CTGGGGCCCGACAGCTGTCCTGG - Intergenic
1142273955 16:89105906-89105928 CTGGCGCAGGCCAGCTGTCAAGG + Intronic
1142393258 16:89816370-89816392 CTGGGGCGGCGCGGCTGCCTCGG - Intronic
1142849055 17:2695589-2695611 CTGGGGGAGCACAGCTATCCTGG + Intronic
1145029763 17:19495573-19495595 CTGGGGCTGCACCCCTGCCTAGG + Intronic
1146491674 17:33287819-33287841 ATTGGGGAGCACAGGTGTCTGGG + Intronic
1146565903 17:33912568-33912590 CTGGGGAAGAACTGCTGTCAAGG - Intronic
1149565097 17:57635644-57635666 CAGGGGCAGCACAGCTCCCCAGG + Intronic
1151547844 17:74804303-74804325 CAGGGCCAGCACCGCTGGCTGGG - Intronic
1151766654 17:76136604-76136626 CCGGGGCAGCCAAGCTGTATGGG - Exonic
1151977736 17:77492000-77492022 CTGCGGCACCACATCTGCCTCGG + Intronic
1152364980 17:79850272-79850294 CTGGGGCACCCCAGCAGGCTTGG - Intergenic
1152641607 17:81451750-81451772 CTGGGGCAGTGGAGCTGTCCAGG - Exonic
1152930329 17:83106028-83106050 CTGGGGCAGCAGCTCTGACTGGG - Intergenic
1154200166 18:12294042-12294064 CTGGGGCAGCCCAGGAGTTTGGG + Intergenic
1156593231 18:38515990-38516012 CTGTGGTAGCATAACTGTCTGGG - Intergenic
1156595848 18:38546748-38546770 CTGGGGAAGCACTGCTGCATAGG + Intergenic
1160557404 18:79735266-79735288 CTGGGGGTGCACACCTGGCTGGG - Intronic
1160773407 19:843804-843826 CTGGGGCTGCACCGCGGCCTCGG + Intronic
1161041087 19:2111126-2111148 CTTGGGCAGCACCTCTGGCTTGG - Intronic
1161053712 19:2179345-2179367 CTGAGGCTGCACGGCTGCCTGGG + Intronic
1161053718 19:2179377-2179399 CTGAGGCTGCACGGCTGCCTGGG + Intronic
1161283400 19:3457371-3457393 CTGAGGCTGCACAGTAGTCTAGG + Intronic
1161659927 19:5539746-5539768 CTGTGGGAACACAGCTGTGTGGG + Intergenic
1161809212 19:6462021-6462043 CTGTTCCAGCACACCTGTCTAGG - Intronic
1162789633 19:13056129-13056151 CTGCGGCAGCAAAGTTGGCTGGG - Intronic
1163148702 19:15398928-15398950 CTGGGGCGGCACAGGCGCCTTGG + Intronic
1163560044 19:18013715-18013737 CAGGGGCATCAGAGCTGCCTGGG + Exonic
1163599051 19:18237133-18237155 CTGGGCCAGTCCAGGTGTCTGGG - Intronic
1163638252 19:18447562-18447584 CAGGAGCAGGACAGCTGCCTGGG - Intronic
1163791429 19:19308617-19308639 CTGATGCAGCTCAGGTGTCTCGG + Intronic
1166334198 19:42095639-42095661 CTGGGGCTGCTCAGCTGGTTGGG + Exonic
1167097294 19:47381163-47381185 CTGTGGCAGGCCAGCTGTCAGGG - Intronic
1167230500 19:48279918-48279940 CTAGGGCAGCACGGCTGGCGGGG - Intronic
1167862469 19:52296946-52296968 CTGGAGCAACTCAGCTGTCTCGG - Intergenic
1167943106 19:52963113-52963135 CTGGAGCAGCTCAGCAGTCAGGG + Intergenic
1168060638 19:53890077-53890099 CTGGGCCAGCACAAGTGCCTTGG - Intronic
925278577 2:2667770-2667792 CTGGTGCAGGACATCAGTCTCGG + Intergenic
925675836 2:6360273-6360295 CTGCCTCAGCACAGCTGGCTGGG - Intergenic
926119912 2:10236260-10236282 CTGGGGAGGCACAGGTGGCTGGG - Intergenic
927271988 2:21221179-21221201 CAGAGGCAGCACAGCTATGTGGG + Intergenic
927517324 2:23680012-23680034 AAGGGGCAGCACAGCCCTCTGGG - Intronic
927678954 2:25127617-25127639 CAGGGTCAGCACAGCTCTGTGGG - Intronic
929452317 2:42046361-42046383 GTGGGGCAGAACAGCTCTATCGG + Intergenic
929779982 2:44951363-44951385 CTGGGGGTGCACAGCAGTTTGGG + Intergenic
930625710 2:53695313-53695335 AAAGGGCAGCACAGATGTCTTGG + Intronic
931086654 2:58838807-58838829 CTGGTGTAGCACAGCTGACCAGG + Intergenic
931228362 2:60352953-60352975 CAGGTGCAGCACAGCTGGCTAGG + Intergenic
933709365 2:85314399-85314421 GTGGGGAAGCCCAGCTGTTTAGG + Intergenic
933775086 2:85766929-85766951 CTGGGGCAGGACATCTGCCGAGG - Intronic
933990054 2:87627647-87627669 TTGGACCAGCACAGCTGCCTGGG - Intergenic
934515325 2:94982637-94982659 CTGGGGCAGTCCATCTGACTGGG + Intergenic
934775828 2:96936867-96936889 CTTGGGCAGCACAGCAGACCCGG + Intronic
934778102 2:96951519-96951541 CTGTGCCAGCACACTTGTCTCGG + Intronic
935763646 2:106343618-106343640 CTGGGAGCACACAGCTGTCTAGG + Intergenic
935827640 2:106967598-106967620 CTGGGGAATCACAGTTGTGTGGG + Intergenic
936303792 2:111323177-111323199 TTGGACCAGCACAGCTGCCTGGG + Intergenic
937139403 2:119586313-119586335 CTGGGGGAGCAGAGCTCTCCAGG - Intronic
938073595 2:128320534-128320556 CTAGGGGAGCACAGCTGCCCCGG + Intergenic
942395104 2:175538857-175538879 CTGCTGTAGCACATCTGTCTTGG + Intergenic
944860833 2:203814505-203814527 ATGGGGAAGCACAGCTGGATGGG + Intergenic
944861169 2:203817206-203817228 GTGGGGTAGCACAGCTGTCAGGG + Intergenic
947710923 2:232315218-232315240 CTGGGCCAGCACACCGGTATGGG - Intronic
948120510 2:235526392-235526414 TTGGTGCACCACAGATGTCTTGG + Intronic
948307065 2:236956216-236956238 CTGGGGCATCCCAGCTGTGTGGG - Intergenic
948854365 2:240723293-240723315 GGGGGGCAGCACAGCTGCTTGGG - Intronic
949020458 2:241738316-241738338 CTGGCTCAGCACTGCTGTCTGGG + Intronic
1168788413 20:559308-559330 AAGGGGCAGCAGAGCTCTCTGGG - Intergenic
1169199920 20:3703922-3703944 CAGGTGCAGCACACCAGTCTTGG + Exonic
1173828357 20:46062037-46062059 CGGGGGCAGTACAGGTGTCTGGG - Exonic
1174134906 20:48372904-48372926 CTGGAGCAGCAAAGCAGTCAGGG + Intergenic
1175410145 20:58762397-58762419 CTGGGGCTGCTCTGCTGGCTCGG - Intergenic
1175575954 20:60060895-60060917 CTGGGGAAGCGCAGGTGTGTTGG + Intronic
1175813834 20:61873397-61873419 CTGGGGCAGCAGAGCAGGCCTGG - Intronic
1176281773 20:64317317-64317339 CTGGCGAAGCAGAGCTGTCTGGG - Intergenic
1176297251 21:5080682-5080704 CAGAGCCAGCCCAGCTGTCTGGG - Intergenic
1179318577 21:40268952-40268974 CTGGGGCAGAACAGCTCCGTGGG - Intronic
1179859778 21:44181266-44181288 CAGAGCCAGCCCAGCTGTCTGGG + Intergenic
1179883745 21:44304670-44304692 TTGGGGTGGCTCAGCTGTCTGGG + Intronic
1179963403 21:44784948-44784970 CTGGGGATGAACAGCTGTCTAGG + Intronic
1182895679 22:33857348-33857370 TTGGGGCTTCCCAGCTGTCTGGG - Intronic
1183115183 22:35686345-35686367 CTTCTGCAGCACAGCTCTCTGGG - Intergenic
1183305256 22:37079608-37079630 CTGGGGCTGCAGAGCTGAATTGG + Intronic
1183324547 22:37184264-37184286 CTGGGGCCACACAGCTGTCAGGG - Intronic
949890312 3:8728780-8728802 CTGGGTCATCAGAGCCGTCTTGG - Intronic
950295625 3:11827584-11827606 CAGGGCCACCACAGCTGGCTGGG + Intronic
952407283 3:33015816-33015838 CTAGGGCAGGACAGGTGTCTGGG - Intronic
953414030 3:42705391-42705413 CTGGGGCACCACAGCTGAGCTGG - Intronic
954296199 3:49675723-49675745 CTTGCGCAGCACAGCTTTCATGG - Exonic
954370093 3:50165787-50165809 CTGGGGCTGCCCAGCAGGCTGGG - Intronic
959051485 3:101528768-101528790 ATGGGGCAAGACAGCTCTCTGGG - Intergenic
960721347 3:120627398-120627420 CTTGGGCAGCCCAGCGCTCTGGG + Intergenic
961591137 3:127982740-127982762 CTGGGACAGGGGAGCTGTCTGGG - Intronic
964406383 3:156352956-156352978 CAGGAGCAGCACAGATGCCTGGG + Intronic
965940724 3:174177878-174177900 CCGGGGCAGTATTGCTGTCTAGG - Intronic
966028618 3:175317455-175317477 CTGGGAAAGAATAGCTGTCTAGG - Intronic
967105994 3:186255500-186255522 CTGGGGCAGCACTGCAGACAGGG + Intronic
968359474 3:198137280-198137302 CAGAGGCCGCACAGCTGTCCTGG - Intergenic
969662254 4:8537127-8537149 CAGAGGCAGCACAGCTGCCTGGG + Intergenic
969835113 4:9834134-9834156 GTGAGGGAGCAGAGCTGTCTGGG - Intronic
975577425 4:75876721-75876743 GTGGGCCACCACACCTGTCTGGG - Intronic
977962196 4:103098658-103098680 CTTAGACTGCACAGCTGTCTGGG + Intronic
979521185 4:121668823-121668845 CTGGGGCTGCAGGGCTGTCATGG + Intronic
979970215 4:127125415-127125437 CTGAGGCCGCACAGCTGGATGGG + Intergenic
980154993 4:129093501-129093523 CTGGGGCTTCCCAGCCGTCTTGG - Exonic
983939298 4:173524078-173524100 CTGGGCCTGCACAGCGGTCTGGG + Intergenic
984639558 4:182145760-182145782 CTCGGGCATCCCAGCCGTCTGGG - Intronic
984796556 4:183665610-183665632 CTGAGCCAGCACAGCTGATTTGG + Intronic
985507634 5:292957-292979 TTGGGGCCGCCCAGCTGTGTGGG - Intronic
985922182 5:2986024-2986046 AAGGGTCAGGACAGCTGTCTGGG - Intergenic
989243263 5:39224196-39224218 CTGGCACAGCAGAGCTGGCTTGG - Intronic
990362571 5:55035609-55035631 CTGGAGGATCTCAGCTGTCTCGG + Intergenic
991434219 5:66580032-66580054 TTGGGGAAGCTCAGCAGTCTTGG - Intergenic
992673678 5:79084230-79084252 ATGGGGCACCACAGCTCCCTGGG + Intronic
997472509 5:134124707-134124729 CAAGGGCAGGAAAGCTGTCTGGG + Intronic
1001522608 5:172405447-172405469 GTGGGGCAGCAAATCTGACTAGG - Intronic
1001601809 5:172933996-172934018 CTGGGGCAGGATGACTGTCTGGG - Intronic
1001963529 5:175894787-175894809 CCCTGGCAGCACAGATGTCTTGG - Intergenic
1001997909 5:176176792-176176814 CTGTGGCAGCAGAGCTTCCTGGG - Intergenic
1002425791 5:179174745-179174767 CTTGGGTCCCACAGCTGTCTCGG + Intronic
1002923371 6:1589720-1589742 CTGGGGCAGCACCTCAGCCTCGG + Intergenic
1003032965 6:2618789-2618811 CTGGAGCTGCTCAGCTGTCCTGG - Intergenic
1003173948 6:3741076-3741098 CTTGGGCAGCACCCCAGTCTCGG + Intronic
1004120649 6:12818323-12818345 CTGGGTCAGCTGAGATGTCTGGG + Intronic
1005411349 6:25550755-25550777 CTGGGGCAGCTCAGAATTCTTGG + Intronic
1005861816 6:29907909-29907931 TTGGGCCAGCTCAGCTGTGTGGG + Intergenic
1005873468 6:29994567-29994589 TTGGGCCAGCTCAGCTGTGTTGG + Intergenic
1006906405 6:37536429-37536451 CTGGAGCAGCCCCGCTCTCTCGG + Intergenic
1010009728 6:71036299-71036321 CTGTGCCAGCACAGGGGTCTGGG - Intergenic
1011339635 6:86299694-86299716 TTGGGGAAGGACTGCTGTCTTGG - Intergenic
1015203267 6:130606030-130606052 CTGGTGAAGCACAGTTGTCATGG + Intergenic
1018364033 6:163100088-163100110 CTGGGGCAGCCCAGGAGTCCAGG - Intronic
1018787943 6:167122678-167122700 CTGTGGCTGCACAGCTTTCGGGG + Intergenic
1019260525 7:79395-79417 CAGAGGCCGCACAGCTGTCCTGG + Intergenic
1019398276 7:835251-835273 CTGGTGCAGGACAGCGGGCTGGG - Intronic
1020968453 7:14902723-14902745 CTGGGGAAGCCGAGCTGTGTGGG - Intronic
1021775540 7:24051090-24051112 GTGGCTCAGCAGAGCTGTCTGGG + Intergenic
1024349306 7:48347587-48347609 CTGGGGCTGGACAGCTGGCCTGG - Intronic
1025815109 7:64903664-64903686 CTGCGGCAGCAGAGCTGCCCAGG - Intronic
1026466907 7:70662108-70662130 CTGTGTCAGCGCAGCTGCCTGGG - Intronic
1027946236 7:84749110-84749132 CTGGGGCAGGACTGATTTCTGGG - Intergenic
1032442510 7:131952869-131952891 CTGAGGCAGCACAGCTTTAATGG - Intergenic
1033980192 7:147155022-147155044 CTGGAGCACCACAGCTGTGAAGG + Intronic
1035284293 7:157796394-157796416 CAGGGGCAGCAGAGCTGACTAGG - Intronic
1035453309 7:158992982-158993004 CTGGGGCAGCTCCTCTGTCGGGG + Intergenic
1035555252 8:562872-562894 CTGTGGCCCCACAGCTGTCAAGG + Intergenic
1035852770 8:2937955-2937977 CTGCGACAGAACAGCTGACTGGG + Intronic
1037541949 8:19880570-19880592 CTGGGGAAACACAGTTCTCTGGG + Intergenic
1039219647 8:35315418-35315440 CTGGGGCAGTGCAGATGGCTGGG + Intronic
1039420216 8:37431604-37431626 CTTGAGCTCCACAGCTGTCTTGG - Intergenic
1039618749 8:38977478-38977500 CTGAGTCAGCACATCTATCTGGG - Intronic
1040959227 8:53013310-53013332 CTGTGTCTGCACAGCAGTCTAGG + Intergenic
1041329935 8:56713908-56713930 GAGGGGCAGGAAAGCTGTCTGGG - Intergenic
1042926494 8:73972861-73972883 CTGGGTTAGCTCAGCTGTCCTGG + Intronic
1044868347 8:96594353-96594375 CTGGGGCAGCTGAGCAGACTTGG + Intronic
1046772170 8:118127010-118127032 CTGGAGCTGAACAGCTGCCTGGG + Intergenic
1046922679 8:119749607-119749629 CTTGGGCAAGTCAGCTGTCTGGG + Intronic
1048320784 8:133398556-133398578 CTAGGGCAGCACAGCCATGTGGG + Intergenic
1048504744 8:135010908-135010930 CTGGGGCATCAAAGTTATCTTGG + Intergenic
1048788737 8:138080373-138080395 CTTGGGCAGCACAAATGCCTTGG - Intergenic
1049173414 8:141176358-141176380 CTGGGCGAGCCCAGCTGTGTGGG + Intronic
1049202320 8:141346375-141346397 CTGGGGCTGGGCAGCTGTGTAGG - Intergenic
1049339068 8:142102247-142102269 CTGGGGGTGCACAGGTGTGTGGG + Intergenic
1049563301 8:143324264-143324286 CTGGGGCAGCAAATCTAGCTGGG + Intronic
1050204317 9:3181332-3181354 CTGGGGCACCAGAACTGTCCAGG + Intergenic
1051564247 9:18479042-18479064 ATAGGCCAGCACAGCTGTGTGGG + Intronic
1053424125 9:38000020-38000042 CTGGGGCACCACACCTGAGTGGG + Intronic
1056826423 9:89879324-89879346 CAGGCCCAGCACAGCTGTCCAGG + Intergenic
1057266531 9:93621405-93621427 CTTGGCCAGGACAGCTGCCTTGG - Intronic
1057917845 9:99071428-99071450 CTGGGCCAGCCCAGCTGAATGGG - Intergenic
1059422663 9:114201944-114201966 CTGAGGCCACACAGCTTTCTAGG - Intronic
1059625844 9:116065152-116065174 CAGAGGCAGGACAGCTATCTGGG + Intergenic
1059663031 9:116420201-116420223 CTTGGGCAGTACAGTTGGCTGGG + Intergenic
1060369999 9:123059697-123059719 ATGGGGCAGGGCAGCTCTCTAGG - Intronic
1060522862 9:124303708-124303730 CTGGGGCTTCCCAGCTTTCTGGG - Intronic
1060731502 9:126039720-126039742 CTGGGGCAGCTCACCTGGCCAGG + Intergenic
1060741059 9:126097866-126097888 CTGGGGCAGGACAGCTGCCTTGG - Intergenic
1061422592 9:130480308-130480330 CTGGGACAGCCCAGCTGGGTGGG + Intronic
1061623655 9:131827755-131827777 GTGGGGCAGCACGGCAGCCTGGG + Intergenic
1061765615 9:132879124-132879146 AGGGGCCTGCACAGCTGTCTCGG + Intronic
1062744162 9:138200994-138201016 CAGAGGCCGCACAGCTGTCCTGG - Intergenic
1186435798 X:9542378-9542400 CGGCGGCAACACAGCTGTCTTGG + Intronic
1187433867 X:19249065-19249087 ATGGAGCAGAACAGCTATCTGGG - Intergenic
1187583134 X:20630743-20630765 CCTGGGCAGCACTGCTGGCTGGG + Intergenic
1187791288 X:22952903-22952925 CTGGGGCAGCAGAGCAGACCAGG + Intergenic
1188833906 X:34933147-34933169 GTGAGGCAGCATTGCTGTCTGGG - Intergenic
1189368781 X:40411366-40411388 CTGGGACAGGAAAGCTGTCTGGG + Intergenic
1191141529 X:57120830-57120852 GTGGTGCAGTAGAGCTGTCTGGG + Intronic
1191143174 X:57136798-57136820 GTGGTGCAGTAGAGCTGTCTGGG + Exonic
1197866902 X:131028697-131028719 CTGGGGCCTCACAGCAGTATTGG - Intergenic
1198800048 X:140439405-140439427 CCGGGGCATCACAACTTTCTAGG - Intergenic
1199944898 X:152657581-152657603 ATTGAGCAGGACAGCTGTCTGGG + Intergenic
1200145574 X:153924706-153924728 CTGGGACAGCACAGATGTATAGG + Intronic
1200397916 X:156001998-156002020 CTGGGGCAGAACAGTTGGATGGG + Intronic
1201720412 Y:17090210-17090232 CTGTGCCAGCACAGCTGGCATGG + Intergenic