ID: 1133311305

View in Genome Browser
Species Human (GRCh38)
Location 16:4848127-4848149
Sequence CGCTAGCTGCGCCGCCGCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 117}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133311297_1133311305 11 Left 1133311297 16:4848093-4848115 CCCGCCCGCTGGGAGCCACGGCT 0: 1
1: 0
2: 1
3: 11
4: 189
Right 1133311305 16:4848127-4848149 CGCTAGCTGCGCCGCCGCCCGGG 0: 1
1: 0
2: 0
3: 12
4: 117
1133311295_1133311305 14 Left 1133311295 16:4848090-4848112 CCGCCCGCCCGCTGGGAGCCACG 0: 1
1: 0
2: 2
3: 14
4: 186
Right 1133311305 16:4848127-4848149 CGCTAGCTGCGCCGCCGCCCGGG 0: 1
1: 0
2: 0
3: 12
4: 117
1133311300_1133311305 6 Left 1133311300 16:4848098-4848120 CCGCTGGGAGCCACGGCTTAGCA 0: 1
1: 0
2: 0
3: 9
4: 111
Right 1133311305 16:4848127-4848149 CGCTAGCTGCGCCGCCGCCCGGG 0: 1
1: 0
2: 0
3: 12
4: 117
1133311301_1133311305 -4 Left 1133311301 16:4848108-4848130 CCACGGCTTAGCAGCCGACCGCT 0: 1
1: 0
2: 0
3: 1
4: 38
Right 1133311305 16:4848127-4848149 CGCTAGCTGCGCCGCCGCCCGGG 0: 1
1: 0
2: 0
3: 12
4: 117
1133311298_1133311305 10 Left 1133311298 16:4848094-4848116 CCGCCCGCTGGGAGCCACGGCTT 0: 1
1: 0
2: 2
3: 13
4: 123
Right 1133311305 16:4848127-4848149 CGCTAGCTGCGCCGCCGCCCGGG 0: 1
1: 0
2: 0
3: 12
4: 117
1133311299_1133311305 7 Left 1133311299 16:4848097-4848119 CCCGCTGGGAGCCACGGCTTAGC 0: 1
1: 0
2: 0
3: 4
4: 122
Right 1133311305 16:4848127-4848149 CGCTAGCTGCGCCGCCGCCCGGG 0: 1
1: 0
2: 0
3: 12
4: 117
1133311292_1133311305 26 Left 1133311292 16:4848078-4848100 CCGAGGCGCGGGCCGCCCGCCCG 0: 1
1: 0
2: 3
3: 24
4: 221
Right 1133311305 16:4848127-4848149 CGCTAGCTGCGCCGCCGCCCGGG 0: 1
1: 0
2: 0
3: 12
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133311305 Original CRISPR CGCTAGCTGCGCCGCCGCCC GGG Intronic
900352065 1:2239831-2239853 AGCCAGCTGCGCCACTGCCCAGG - Intronic
901055965 1:6448737-6448759 CGGCAGCTGGGCCGCTGCCCCGG + Exonic
901433995 1:9235079-9235101 CGCCGGCCCCGCCGCCGCCCCGG + Intronic
901526003 1:9823817-9823839 GGCTAGCTGCTCCGCGGCGCGGG + Exonic
902478430 1:16699902-16699924 CGGCAGCTGGGCCGCTGCCCCGG - Intergenic
903044230 1:20553642-20553664 CGCTGGGGGCGCCGCCGCCTCGG + Exonic
903457404 1:23497277-23497299 CGCTAGCTAGGCCTCTGCCCAGG - Intergenic
903883795 1:26529862-26529884 CCCCGGCTGCGCCGCCTCCCGGG - Intronic
906365420 1:45205969-45205991 CGCCAGCAGCGCCGGCGCCGGGG + Exonic
906475614 1:46167404-46167426 AGCTAGCTGCGCCTCCACCCAGG - Intronic
907231355 1:53002106-53002128 TGCAAGCTCCGCCGCCTCCCAGG - Intronic
915358846 1:155273408-155273430 CGCTCGCACCGCCCCCGCCCGGG + Intronic
922440659 1:225653059-225653081 CGCTCGCCGCGCCGCCGCCGAGG + Exonic
922766243 1:228158092-228158114 CGCGCCCTCCGCCGCCGCCCGGG + Exonic
1063458976 10:6203523-6203545 CGGTGGCTGCCCCGCCGGCCCGG + Intronic
1067520178 10:46994405-46994427 TGCAAGCTCCGCCGCCTCCCAGG + Intronic
1079815377 11:25050378-25050400 TGCAAGCTCCGCCGCCTCCCGGG + Intronic
1085295662 11:75430318-75430340 GGCCAGCGCCGCCGCCGCCCCGG + Exonic
1086064917 11:82733852-82733874 GGCTCGCTGCGCTGCCTCCCGGG + Exonic
1089734610 11:120541086-120541108 CGGTAGCTGCGCCTCAGTCCAGG - Intronic
1091888073 12:4031259-4031281 CGCCCGCCGCGCCCCCGCCCGGG + Intergenic
1093173292 12:15882689-15882711 CGCTGGCTTCGCCGCCGCCATGG + Exonic
1094375371 12:29783650-29783672 GGCCAGCAGCGCCGCGGCCCCGG + Exonic
1094411168 12:30170068-30170090 TGCCAGCAGCGCCGCGGCCCCGG + Intergenic
1096253815 12:50050995-50051017 CTCTGGCTGGGCGGCCGCCCTGG + Intergenic
1098247464 12:68535222-68535244 CGCAATCTGCTCTGCCGCCCAGG - Intergenic
1099974170 12:89529108-89529130 TGCAAGCTGCTCCGCCTCCCAGG + Intergenic
1100186368 12:92144969-92144991 GGGAAGCTGCGCCGCTGCCCCGG - Intronic
1100611373 12:96194299-96194321 CGCTTCCTGCGCGGCCACCCCGG - Intergenic
1103526635 12:121573661-121573683 AGCAAGCTCCGCCGCCTCCCAGG + Intronic
1103528051 12:121580480-121580502 CGCAGGCGCCGCCGCCGCCCGGG + Intronic
1103623861 12:122204410-122204432 CCCAGGCTGCGCCGCGGCCCGGG - Intronic
1115576137 14:34714306-34714328 CCCAACCTGCGCCGACGCCCGGG + Intronic
1117549094 14:56816753-56816775 CTCGAGCTGCGCCGCCCCGCTGG + Intergenic
1118607760 14:67515623-67515645 AGCCACCTGCGCCGCGGCCCTGG - Intronic
1119325921 14:73759576-73759598 CGCCCGCTCCACCGCCGCCCAGG + Intronic
1122137897 14:99645218-99645240 CGCCAGCAGCGCCCCGGCCCTGG - Exonic
1124652352 15:31483400-31483422 CGCTGGCAGCGCCGCTGCACCGG + Exonic
1126467689 15:48975925-48975947 CGCCAGCTCCGCGGCCGCCCCGG + Intergenic
1127577101 15:60302578-60302600 TGCAAGCTCCGCCGCCTCCCAGG + Intergenic
1133212642 16:4272041-4272063 CGGTAGGGGCGCCGCGGCCCGGG - Intronic
1133311305 16:4848127-4848149 CGCTAGCTGCGCCGCCGCCCGGG + Intronic
1133464737 16:6018967-6018989 CGCCAGCGCCGCCGCCGCCGCGG - Intergenic
1134143632 16:11742848-11742870 CGTCAGCCGCGCCGCCGCCGCGG + Exonic
1139364826 16:66427039-66427061 CGGGAGCCGCGCCGCCGCCGAGG + Intergenic
1141590442 16:85065282-85065304 CGCCAGCTGCGTCCCCGGCCAGG - Intronic
1141608597 16:85169298-85169320 CGCTCGCCGCGGCGCCGCCTCGG + Intergenic
1141683378 16:85556643-85556665 CGCTCGCTCCGCCGCCGCGGCGG - Intergenic
1142586853 17:979436-979458 CTCGGGCTCCGCCGCCGCCCCGG + Exonic
1142683285 17:1562464-1562486 CCCTCGCCGCGCCGTCGCCCCGG + Intronic
1143873497 17:9974819-9974841 CGCCAGCAGCTCCGCCACCCAGG + Intronic
1147312937 17:39605810-39605832 CGTGCGCCGCGCCGCCGCCCAGG + Exonic
1147919460 17:43907169-43907191 CGGTATCTGCGCGGCCTCCCCGG - Intronic
1150168366 17:62966225-62966247 CGCTAGCGCCGCCGCCGCGCTGG - Intergenic
1151783818 17:76265565-76265587 CGCGGGCTGCGCGGCCGACCAGG + Exonic
1151817136 17:76476977-76476999 CGCTTGCCGCGCCGGGGCCCGGG + Exonic
1152545399 17:80997826-80997848 TGCCAGCTGCCCCGGCGCCCTGG + Intronic
1152546785 17:81004213-81004235 TGCTTCCCGCGCCGCCGCCCCGG - Intronic
1154070609 18:11148947-11148969 TGCTCGCCGCGCCGCCTCCCAGG - Intergenic
1155928824 18:31685138-31685160 CGCTGGCCGGGACGCCGCCCTGG - Intronic
1157753012 18:50194986-50195008 CCGTAGCTGCGCCGCCGCGGCGG - Exonic
1158714272 18:59863904-59863926 CGCTACCAGCTCCGCCCCCCGGG + Intergenic
1161388106 19:4007673-4007695 CGCGGGCGGGGCCGCCGCCCGGG - Exonic
1161886289 19:6998588-6998610 TGCAAGCTCCGCCGCCTCCCGGG - Intergenic
1162145504 19:8610638-8610660 CGCTACCTGCGCCGCGCCCGGGG + Intronic
1162759639 19:12881095-12881117 CCCTCTCTGCGCCGCCTCCCCGG + Exonic
1163002343 19:14376082-14376104 CAATAGCTGCGCCGCCCTCCTGG + Intergenic
1163277909 19:16297003-16297025 CGCTGGCTGCCCAGCTGCCCGGG - Intergenic
1163832393 19:19553337-19553359 CGCTACCCGCCCCCCCGCCCAGG + Intergenic
1166857970 19:45792627-45792649 TGCGAGCGGCGCCGTCGCCCGGG + Exonic
1167577699 19:50325689-50325711 CGCTAGCTGCGGCACCGCAGTGG + Intronic
1202712449 1_KI270714v1_random:25733-25755 CGGCAGCTGGGCCGCTGCCCCGG - Intergenic
929194781 2:39173732-39173754 TGCAAGCTGCTCCGCCTCCCGGG - Intergenic
949065291 2:241986751-241986773 CGCGAGCTGCCCAGCTGCCCGGG + Intergenic
1169233008 20:3905420-3905442 CGCTCACTGCTCCGCCTCCCGGG + Intronic
1171249436 20:23637346-23637368 CTCGAGCTGCGCCGCAGCGCGGG - Intronic
1173576639 20:44116291-44116313 GGCCCGCTGCGCCGGCGCCCCGG + Exonic
1177580250 21:23013064-23013086 TGCAAGCTCCGCCGCCTCCCGGG + Intergenic
1180614810 22:17120353-17120375 CGCTGGCTGCGCCGCCCCGACGG + Exonic
1180809574 22:18749434-18749456 CGCTAACGAGGCCGCCGCCCAGG + Intergenic
1183404410 22:37623425-37623447 TGCCAGCTGCTGCGCCGCCCTGG - Exonic
1183578268 22:38706206-38706228 CGCTGGCCCCGCCGTCGCCCGGG - Intronic
1183607076 22:38872105-38872127 CGAAAGGTGAGCCGCCGCCCGGG - Exonic
1183942069 22:41301617-41301639 TGCTCCCGGCGCCGCCGCCCCGG - Exonic
952099251 3:29992521-29992543 CGCAAGCTGCTCCGCCTCCCGGG - Intronic
952760012 3:36905210-36905232 TGCAAGCTCCGCCGCCTCCCGGG - Intronic
953570454 3:44067439-44067461 CCCTAGCTGCCCTGCAGCCCTGG - Intergenic
954612943 3:51955861-51955883 TGCTGGCCGCACCGCCGCCCGGG + Exonic
959984952 3:112561926-112561948 CCGTAGCTGCGCCGCCACCGGGG + Exonic
960530496 3:118758828-118758850 CGCAACCTCCGCCGCCTCCCGGG + Intergenic
960577149 3:119240820-119240842 CGCTGGCTCCGCCGGCGCCCGGG - Intronic
961684130 3:128617797-128617819 AGCGAGCTGCGCCTGCGCCCTGG - Intergenic
962318795 3:134374632-134374654 GGCCAGCAGCGCCGCCTCCCCGG - Intronic
968673428 4:1864339-1864361 CTCAAGCTGCCCCGCCTCCCAGG - Intergenic
968965083 4:3765740-3765762 CGCGCCCCGCGCCGCCGCCCCGG + Intergenic
969115010 4:4865968-4865990 CCCTCCCTGCGCCGCAGCCCGGG + Intergenic
970441389 4:16083508-16083530 AGCCATCTGCGCCGCCTCCCTGG - Intronic
972979466 4:44678427-44678449 GGCAAGCTGCGCCGCCGCTTCGG + Exonic
978126956 4:105146595-105146617 CCCGGCCTGCGCCGCCGCCCTGG - Exonic
983940128 4:173529064-173529086 TGCCAGCGGCGCCGCCGGCCTGG - Exonic
986813630 5:11385047-11385069 CGCTGCCCGCGCCGCCGCGCGGG - Exonic
991587531 5:68215700-68215722 CGCTAGCCCCGCCTCCGGCCCGG - Exonic
998193073 5:140043191-140043213 CCCTAGCTGGGCCACCTCCCCGG - Exonic
1002524456 5:179807330-179807352 CGCTGCCTTCGCTGCCGCCCAGG + Intronic
1009431908 6:63573571-63573593 CGCGAGCTGCACCCCTGCCCGGG + Intronic
1015786157 6:136922842-136922864 CACCACCTGCGGCGCCGCCCTGG + Exonic
1017793636 6:157823069-157823091 CCCGCGCCGCGCCGCCGCCCCGG - Intronic
1019343058 7:517554-517576 CGCCAGGAGCGCCGCCGCCCCGG + Intronic
1019381651 7:727278-727300 CTGCAGCTGCGCCGCCGCCCTGG + Exonic
1019433184 7:1009104-1009126 CGCTAGCTGCACAGCCACACTGG + Intronic
1019626114 7:2016478-2016500 CACAAGCTGAGCCCCCGCCCAGG + Intronic
1020010011 7:4802397-4802419 CGCTGGCTGGGCCCCCTCCCCGG + Intronic
1020010027 7:4802433-4802455 CGCTGGCTGGGCCCCCTCCCCGG + Intronic
1020010153 7:4802730-4802752 CGCTGGCTGGGCCCCCTCCCCGG + Intronic
1024797450 7:53036151-53036173 CGCAGGCCGCCCCGCCGCCCAGG + Exonic
1031051888 7:116953464-116953486 CGCGAGCTGCGCCTCCGGGCCGG + Exonic
1033288612 7:140062756-140062778 CGCAAGCGGCGCCGCAGCTCGGG + Exonic
1034223113 7:149460516-149460538 TGCGAGCTGCGCTGCCGTCCCGG + Intronic
1034468900 7:151245519-151245541 AGCGAGCAGCGCCCCCGCCCGGG - Exonic
1043527353 8:81111655-81111677 GGCGCGCAGCGCCGCCGCCCCGG + Exonic
1049457446 8:142700796-142700818 CTCAGGCTGCCCCGCCGCCCTGG - Intronic
1049936350 9:504700-504722 CGCTCGCTCCGCCGCGGACCCGG - Exonic
1056677561 9:88688058-88688080 AGCTAGCTGCACCACAGCCCTGG - Intergenic
1057623268 9:96655230-96655252 GGTTAGCGGCGCCGCCGCCCTGG - Exonic
1058885781 9:109320501-109320523 CTGCCGCTGCGCCGCCGCCCGGG + Exonic
1062022631 9:134326591-134326613 CGCTGCCTGCGCCGCCGGCCGGG + Exonic
1062194715 9:135266619-135266641 CGCTGGCTGTGCCCCCGCCCTGG - Intergenic
1062242603 9:135548299-135548321 CACTGGCTGCCCTGCCGCCCTGG - Intronic
1194666822 X:96685069-96685091 CGCTCCCGACGCCGCCGCCCCGG - Exonic
1196918263 X:120561168-120561190 CGCGAGCTCCCCCGCCCCCCGGG - Intronic