ID: 1133312417

View in Genome Browser
Species Human (GRCh38)
Location 16:4858230-4858252
Sequence TAAGGTACAGAAAAGGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 330}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133312411_1133312417 22 Left 1133312411 16:4858185-4858207 CCTTAAGCATGGAGAGAAGAGAA 0: 1
1: 1
2: 1
3: 33
4: 363
Right 1133312417 16:4858230-4858252 TAAGGTACAGAAAAGGGGCATGG 0: 1
1: 0
2: 1
3: 26
4: 330

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133312417 Original CRISPR TAAGGTACAGAAAAGGGGCA TGG Intronic
900923327 1:5687629-5687651 AGAAGTACAGAAAAGGGACAGGG - Intergenic
901609371 1:10485019-10485041 GAAGGAACAGCACAGGGGCATGG + Intronic
903352843 1:22728596-22728618 TGAAGTCCAGAAAAGGGGAATGG - Intronic
904219377 1:28952581-28952603 GAAAATACAGAAAAGGGGAAAGG + Intronic
904675151 1:32194710-32194732 CATGGTGCAGAAAAGGGGCACGG - Intronic
905488131 1:38321852-38321874 GGAGCTTCAGAAAAGGGGCATGG - Intergenic
906288939 1:44607060-44607082 TAAGGGACAGAAAAGAGTTAAGG - Intronic
907084478 1:51657292-51657314 TAGGGTACATAAAAGGAGAATGG + Intronic
907133616 1:52118952-52118974 TAAAGTTCAGAGAAGGGGAAAGG - Intergenic
907328747 1:53657881-53657903 GAGGGTGCAGAGAAGGGGCAAGG - Intronic
908489279 1:64626821-64626843 TGAGGTACAGAGAAGGGCTATGG - Intronic
908513068 1:64864977-64864999 TAAGATACATAAAAGGGACAGGG + Intronic
910022657 1:82611085-82611107 TAAGGTAGAGAGAAGAGGGAAGG - Intergenic
910198290 1:84668812-84668834 TAAGGAAAAGTAAACGGGCATGG + Intronic
910270655 1:85390575-85390597 TAAGGTACCCAAAGAGGGCATGG + Intronic
910559662 1:88576921-88576943 TTAGGTACAGAAACTGGGCAAGG - Intergenic
910615065 1:89188563-89188585 TAAGGTGAGGAAAAGGGGAATGG - Exonic
911206641 1:95098281-95098303 AAAGGTTTAGAAATGGGGCAGGG - Intergenic
911762806 1:101635963-101635985 GAAGGTAGAGAATAGGGACATGG - Intergenic
911783881 1:101919987-101920009 TAAGAGACAGAAAAGAGTCAAGG - Intronic
912230085 1:107783303-107783325 TAGGGAACAGAGAAGGGGCCAGG + Intronic
912649543 1:111425555-111425577 TAAGGAAAGGAAAAGGGGGAAGG + Intronic
913070092 1:115290685-115290707 TAAGAGATAGAGAAGGGGCAGGG - Intronic
913371396 1:118103525-118103547 TAAGGTACAGAAGAGTGAAAGGG + Intronic
913707590 1:121442323-121442345 TAAGATACAGAATACAGGCATGG - Intergenic
914421026 1:147528459-147528481 TAAGCTAGAGAAAAGGTGGAGGG - Intergenic
915469879 1:156119563-156119585 AAAGAGACAGAGAAGGGGCAGGG - Intronic
916081590 1:161236637-161236659 GAAGGGACAGAAAAGGGTCAAGG - Intronic
916591285 1:166193306-166193328 TTAGATGCATAAAAGGGGCAAGG + Intergenic
916751782 1:167729694-167729716 TAAGAAACAGAAAAGGGAGAGGG - Intronic
916980497 1:170131025-170131047 TAAAGTACACAACAGGGTCATGG - Intergenic
917559544 1:176134086-176134108 TCATGTACAGAAAGGGTGCAGGG - Intronic
917723796 1:177811318-177811340 TAAGGTGGAGATAAGGGGTAAGG + Intergenic
918252596 1:182716770-182716792 CGAGGCACAGAAAAGTGGCAGGG - Intergenic
919979881 1:202636228-202636250 TAAGGAACAGAAAATGAGGAGGG + Intronic
920219616 1:204387249-204387271 TAAAGTACAGAAAAGGGCCCAGG - Intergenic
920229802 1:204462680-204462702 TAAGGGAAAGGAAAGAGGCAGGG - Intronic
921314034 1:213874032-213874054 TCAGGTCCAGAAACTGGGCAAGG - Intergenic
921419397 1:214928958-214928980 TAAGCTACGCTAAAGGGGCAGGG - Intergenic
922561341 1:226571934-226571956 TAAGGAAGGGAAAAGGGGCCGGG - Intronic
922744525 1:228036783-228036805 ACAGGTACAGAGAAAGGGCAGGG + Intronic
1064247554 10:13681164-13681186 GAAGGTAGAGAAAAAGGGGAGGG - Intronic
1064586748 10:16846834-16846856 AAAGAAAAAGAAAAGGGGCACGG + Intronic
1064955867 10:20908863-20908885 TAAGGAACAGAATAGCAGCAGGG - Intronic
1065139123 10:22703501-22703523 TTAGGAACAGAAAAAGCGCAGGG + Intronic
1065454444 10:25892290-25892312 AGAGGAACAGAAAAGTGGCATGG - Intergenic
1066334631 10:34463207-34463229 GAAGGGAAAGAAAAGGGGAAGGG + Intronic
1068342689 10:55728557-55728579 GAAAGGAAAGAAAAGGGGCAGGG + Intergenic
1068654512 10:59560818-59560840 TAAGGGTAAGAAAATGGGCACGG + Intergenic
1070760471 10:79021249-79021271 TGAGGCACAGATAAGAGGCAGGG + Intergenic
1071575576 10:86723453-86723475 TCAGGTACAGAAAGTGGGGATGG + Intronic
1071776665 10:88796753-88796775 GAAGGAAAAGAAAAGGGGAAAGG + Intergenic
1072206116 10:93206693-93206715 TAAGGAACAGCAAAGTGGGAGGG + Intergenic
1074445847 10:113520401-113520423 TAAGCAGCAGAAAAGGGGAAAGG + Intergenic
1078664867 11:13316029-13316051 TAAGGTAGAGAAAAGGGCAAAGG - Intronic
1079196200 11:18329395-18329417 TAAGGCTCAGAAATGGGGTATGG + Intronic
1079928479 11:26526389-26526411 CAAGGTGCAGAAAACGGCCAAGG - Intronic
1080689851 11:34547437-34547459 TAATGTACACAAAACAGGCATGG - Intergenic
1081875196 11:46403820-46403842 TAACTGACAGAAAAGGGCCAAGG + Intronic
1083191752 11:61057181-61057203 TAAGGTACAGCCAGGGGGCTGGG - Intergenic
1083666678 11:64279098-64279120 CAAGGTACAGAAAGGAGACAGGG - Intronic
1084275946 11:68051032-68051054 AAAGGGGCAGAAAAGGGCCAAGG + Intergenic
1086089003 11:82985973-82985995 TAAGGTCCAGAAGCCGGGCATGG - Intronic
1086092295 11:83017046-83017068 TAAGGTATAGAAGCTGGGCACGG + Intronic
1086207417 11:84275949-84275971 AAAGGTACAGCAAAGGCACAGGG + Intronic
1087448588 11:98287782-98287804 TAAGAAACAGAAAAGGGAGATGG - Intergenic
1088671011 11:112140584-112140606 TAAGGTAATGAAAAGCGGCCAGG - Intronic
1089342965 11:117772103-117772125 TAAGGGACAAAAGAGGGGCAGGG + Intronic
1089811644 11:121136893-121136915 TAAGGTACACAAAAGTGCCTAGG + Intronic
1090212987 11:124935937-124935959 GAAGGTAGACAAAAGGAGCAAGG + Exonic
1090267633 11:125363531-125363553 TAAGGCACAGAGGAGAGGCAAGG - Intronic
1091065360 11:132505164-132505186 AAAGGCAGAGAATAGGGGCAAGG + Intronic
1091215077 11:133896089-133896111 TAAGGCAAAAAAAAGGAGCAGGG - Intergenic
1091775421 12:3181833-3181855 TCAGATACAGCAAAGGAGCAAGG - Intronic
1092081937 12:5723594-5723616 GAAATTACAGAGAAGGGGCAGGG + Intronic
1092463533 12:8707411-8707433 CAAAGTATGGAAAAGGGGCACGG + Intronic
1093006470 12:14057088-14057110 GAAGGTAAAGAACAGGTGCATGG - Intergenic
1095302209 12:40598050-40598072 TAAGGTATGGAAAGGAGGCAAGG + Intergenic
1095857965 12:46882047-46882069 GAAGGTAAAGACAAGGGCCAGGG - Intergenic
1095900657 12:47324972-47324994 TAAGGTACTGGAAAGAGGAATGG - Intergenic
1096054565 12:48640836-48640858 TGAGGCACTGTAAAGGGGCAGGG - Intergenic
1096725607 12:53559381-53559403 TAAAATACAGAAAATGGGCTGGG + Intronic
1096732327 12:53624528-53624550 TTCTGTACAGAAAAGGGACAGGG - Intronic
1097130609 12:56808349-56808371 TGAGGCACAGAAAAGAAGCATGG - Intergenic
1097523234 12:60695946-60695968 AAAGGTAGAGGAAAGGGGGAGGG - Intergenic
1097794268 12:63844903-63844925 GAAGGCACACAAAAGGAGCAAGG - Intronic
1098073722 12:66703505-66703527 TGAGGAACTGAAAAGGAGCAGGG + Intronic
1098226074 12:68326280-68326302 TAAGAAACTGAAAAGGGGCTAGG + Intronic
1098417132 12:70247142-70247164 TAAGGAAAAGAAAATGTGCAGGG - Intronic
1099114465 12:78607479-78607501 TAAGGTTCACAAAAGAGGCAGGG + Intergenic
1099978223 12:89568761-89568783 TAGGGAACAGAAATAGGGCAGGG - Intergenic
1100157638 12:91819461-91819483 TAAGGTCCTGAAAAGGGTGAAGG + Intergenic
1100282136 12:93128131-93128153 TGAGATACAGAAAAGTGCCACGG + Intergenic
1104962203 12:132493642-132493664 CAGGGCACAGAAAAGGGGCAGGG - Intronic
1105788173 13:23770109-23770131 TAAGCAACAGAAAATGGGCTAGG + Intronic
1106021509 13:25920176-25920198 TAAGTTACAGAAGAGGGAAAAGG - Intronic
1106485830 13:30171714-30171736 GAAGGTAACGAGAAGGGGCAGGG + Intergenic
1107068095 13:36238933-36238955 AAAAGAACAGAAAAGGGGCCAGG + Intronic
1107273619 13:38650971-38650993 TTAGGTACTGAAAATAGGCATGG + Intergenic
1107824104 13:44312127-44312149 TAAAGTCCTAAAAAGGGGCAGGG + Intergenic
1109218342 13:59615659-59615681 TAAGGTACATAAAAAGGTTAAGG + Intergenic
1109966445 13:69704275-69704297 TAAGGTAAAAAGAAGGGTCAAGG - Intronic
1110076087 13:71244913-71244935 TAAGGAAAAGAAAAGGAGGAAGG - Intergenic
1110801226 13:79697981-79698003 AGAGATACAGAAAAGGGGTAAGG + Intergenic
1111873402 13:93862901-93862923 TAAGATACAGAAAAGAGTGATGG + Intronic
1112684414 13:101807048-101807070 TAAGAAAAAGAAAAGGGGCAGGG + Intronic
1112855326 13:103761687-103761709 TAAAGTATAGAAAAGAGACATGG - Intergenic
1114260083 14:21030301-21030323 TAAGGTACATAAAAGAGGTAGGG + Exonic
1116616637 14:47148786-47148808 TCAGGTACAGAAATTGGACAAGG + Intronic
1117272497 14:54159216-54159238 TAAGGTAAAGAAGATGGGTATGG + Intergenic
1117684937 14:58243063-58243085 TAAGGGAAAGAAGAGAGGCAGGG - Intronic
1117773697 14:59160578-59160600 TGAGGTACAGAAAAGGGATACGG - Intergenic
1117838742 14:59835308-59835330 AAAGTGACAGAAAAGGGGCGGGG + Intronic
1118169539 14:63373688-63373710 TAAGGTACAAAAAAGGATCCTGG + Exonic
1119764277 14:77178593-77178615 AGAGGTACAGAAAAGGGGGATGG - Intronic
1119764421 14:77179427-77179449 AAAGATACAGTAAAGGGGGACGG - Intronic
1120227765 14:81810006-81810028 TAAGGGACAGAATTGGGGTATGG - Intergenic
1121371705 14:93364572-93364594 CAAGGAATAGAAAAGGGGCCTGG + Intronic
1121714341 14:96062255-96062277 TCAGGTAAAGAAAATGGGCTTGG + Intronic
1126260509 15:46683843-46683865 AATGGGACAGAAGAGGGGCAGGG + Intergenic
1127267562 15:57374221-57374243 GAAGGTAAGGAAAAGGGGAAGGG - Intergenic
1127741930 15:61916955-61916977 GAAGATACAGTAAAGAGGCAGGG + Intronic
1130370426 15:83281874-83281896 TGAGGTACAGAAAGTGGGCATGG + Intronic
1131012841 15:89032684-89032706 GAAGGTACAGAAAATAGGCTGGG + Intergenic
1131729749 15:95267448-95267470 TCAGGTTGAGAAAAGGGGAAGGG - Intergenic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1132104256 15:99051385-99051407 AAAGGTGCAGAAATTGGGCAGGG - Intergenic
1132635663 16:944841-944863 CAAGGTGCACCAAAGGGGCAGGG - Intronic
1133312417 16:4858230-4858252 TAAGGTACAGAAAAGGGGCATGG + Intronic
1133424160 16:5673216-5673238 GAAGTCACAGAGAAGGGGCAAGG + Intergenic
1135573783 16:23569256-23569278 TAAAATACAGAAAAGAGGCTGGG + Intronic
1136158617 16:28403035-28403057 TAATGTACAGAAATGGCGGATGG + Intronic
1136204470 16:28712248-28712270 TAATGTACAGAAATGGCGGATGG - Intronic
1138617529 16:58182233-58182255 TAAGAAACAGAAAATGGGCTAGG + Intronic
1142772408 17:2108019-2108041 TAAGGCTCAGAAATTGGGCAAGG - Intronic
1144714796 17:17426536-17426558 TGAGGCACAGAAAAGAAGCACGG + Intergenic
1146487821 17:33258403-33258425 TAAGGGACAGAGAAGGAGGATGG + Intronic
1146619427 17:34386073-34386095 TATGACACAGACAAGGGGCAGGG + Intergenic
1147741948 17:42675008-42675030 TAAGCCCCAGCAAAGGGGCAGGG - Intronic
1148020170 17:44548149-44548171 TCAGTTACAGGAAAGGGGAAGGG + Intergenic
1148745571 17:49916182-49916204 TCAGGGACAGAACAGGGGCAGGG - Intergenic
1149136077 17:53366250-53366272 TAAGGAAAACAAAAGGGGAAGGG - Intergenic
1149591198 17:57831071-57831093 TGAGCTGCAGAGAAGGGGCAGGG + Intergenic
1150459994 17:65342479-65342501 TAAGCTATAGAAAAGCGGGAGGG + Intergenic
1151191315 17:72400095-72400117 AAAGGGACAGAGAAGGGGCAGGG - Intergenic
1154176168 18:12088141-12088163 CAGGGTCCAGAACAGGGGCAGGG - Intergenic
1154476823 18:14768285-14768307 CAAGTTATAGGAAAGGGGCATGG - Intronic
1157327763 18:46681271-46681293 TAATGTAAAGAAATGGGGCCAGG - Intronic
1157557834 18:48624297-48624319 TGAGGCACAGAAATGGAGCATGG + Intronic
1158093044 18:53737692-53737714 TAACGTAGAAAAATGGGGCAGGG - Intergenic
1158513373 18:58110752-58110774 TAAGGAAAAGAAAATGAGCAAGG - Intronic
1159812300 18:73030259-73030281 GAAGGTAGATAAAAGCGGCAAGG + Intergenic
1161651819 19:5490393-5490415 AAAGGTACAAAAATGAGGCATGG - Intergenic
1162220668 19:9173567-9173589 TCAGTTACACAAAAGGGGCTTGG + Intergenic
1163136079 19:15312336-15312358 AAAAGTACAAAAAAGGGGCCAGG + Intronic
1163600342 19:18245458-18245480 TAAGGAACAGCAAAGAGGCCAGG - Intronic
1163832380 19:19553265-19553287 TAACGCACAGGAGAGGGGCAGGG + Intergenic
1164403969 19:27925306-27925328 GAATGTACAGAAAAGGAGAATGG + Intergenic
1165946555 19:39446416-39446438 AAAAGAACAGAAAAGGGGAATGG + Intronic
1166380570 19:42353243-42353265 TCAGGAACAGGAATGGGGCAGGG - Intronic
1166423266 19:42654389-42654411 GAAGATACAGAAGAGGGACAGGG + Intronic
1166427664 19:42693893-42693915 TAAGGATCAGAAAGGGGCCAGGG - Intronic
1167246351 19:48375580-48375602 ACAGGGAGAGAAAAGGGGCAGGG - Intronic
1167871036 19:52370335-52370357 TAAGGCACAGAAAAGGGGGCAGG - Intronic
925932675 2:8722720-8722742 TAAGGTTAAGAATAGGGGAAAGG - Intergenic
929046923 2:37799188-37799210 AGAGGTACAGAAAGGTGGCAAGG + Intergenic
929923264 2:46188724-46188746 AAAGTTACAGAAATGGGGCCGGG + Intergenic
930774891 2:55161808-55161830 TGAGGTGGAGAAAAGGGGAAGGG - Intergenic
931102418 2:59017380-59017402 AGAGGGACAGAAAAGGGGAAAGG + Intergenic
931515492 2:63048573-63048595 TAAGGTGGAGGAATGGGGCAAGG + Intergenic
932399464 2:71469877-71469899 TAAGGAATGGAAAATGGGCAGGG - Intronic
933017872 2:77152621-77152643 TAAGATACAAAAAAGTGGCCGGG - Intronic
933881057 2:86670512-86670534 TGAGGAAGAGAAAAGGGCCAAGG + Intronic
934036308 2:88091547-88091569 TAAGATACTAACAAGGGGCAGGG + Intronic
934781792 2:96974085-96974107 AAATATACAGAAAAGGGGCTGGG + Intronic
934945370 2:98537458-98537480 GAAGGAACAGAAAAGGGCCCAGG + Intronic
936116001 2:109703722-109703744 TAAAATACAGAAAATAGGCAGGG - Intergenic
936893787 2:117403846-117403868 TAAGGAAAAGCAAAGGGTCATGG + Intergenic
938938258 2:136146588-136146610 TCAGGTCCAGAAACTGGGCAAGG - Intergenic
940403376 2:153272080-153272102 TAAGGTGTAGAAAAGGGGTCCGG - Intergenic
940887700 2:159003877-159003899 TCAGGTCCAGATAGGGGGCAAGG + Intronic
940936674 2:159503385-159503407 TAAGGCAGAGAATAAGGGCAGGG - Intronic
941355995 2:164492070-164492092 TAAGAAACTGAAAAGGGGGAAGG + Intergenic
941621317 2:167782388-167782410 TAAGGCCCAGCAAAGGGGCCAGG + Intergenic
941640900 2:167987239-167987261 TAAGCCAGAGAAAAGGGGAAGGG - Intronic
942661974 2:178275192-178275214 TAAGGAAAGGAAAAGGGGCAAGG + Intronic
942847074 2:180439885-180439907 TAAGGAGCAGAAAAGGGGCAGGG - Intergenic
943447739 2:188009694-188009716 TTAGCTACAGGAAATGGGCATGG + Intergenic
943776300 2:191770206-191770228 TAAGGTAAAGGATGGGGGCAGGG + Intergenic
944323022 2:198370445-198370467 CAAGGTACATAAAAGGTACAAGG - Intronic
945535546 2:211013248-211013270 TAAGGTACACATGTGGGGCAGGG + Intergenic
945666226 2:212746743-212746765 TAAAGTACAGGAAATGGACAGGG + Intergenic
946174954 2:217916900-217916922 TGAGGGACAGAGAATGGGCAGGG + Intronic
948204279 2:236154346-236154368 TAAGGCACAGTAAGGGGGTAGGG - Intergenic
1169019607 20:2319704-2319726 GAAGGTTCAGAAAAGGGGAGAGG - Intronic
1169272455 20:4211121-4211143 TCAGGTCCAGCAAAGGGGCCTGG + Intergenic
1169930543 20:10828130-10828152 TGAGAGAAAGAAAAGGGGCAAGG - Intergenic
1170566671 20:17611689-17611711 GAAGGCACAGGAATGGGGCAGGG - Intergenic
1172178233 20:32985415-32985437 TAAGGTCCAGAGAAGGATCAGGG - Intronic
1175141456 20:56863625-56863647 TAACGTGCAGAACAGAGGCATGG + Intergenic
1177580135 21:23011016-23011038 TAAGGTTCAGGAAAGTGACAGGG + Intergenic
1177787119 21:25683015-25683037 ATAGGTACAGGACAGGGGCATGG + Intronic
1177946397 21:27475248-27475270 TAAGGCACAGATCAAGGGCATGG - Intergenic
1178088354 21:29135550-29135572 TTATGTACAGAAAAGAGCCATGG + Intronic
1178244245 21:30936139-30936161 GGAGATGCAGAAAAGGGGCATGG + Intergenic
1178988122 21:37326190-37326212 AAAGGAACAAAAAAGGGGCTGGG + Intergenic
1179126337 21:38594502-38594524 TATGGGACAGAAAAGTTGCAAGG + Intronic
1179486125 21:41711948-41711970 GAAGGTGAAGTAAAGGGGCAAGG - Intergenic
1181106323 22:20577863-20577885 GAAGGCACAGAACTGGGGCAAGG + Intronic
1181142553 22:20817289-20817311 TAAGGGACAGCAAATGGGGAAGG - Intronic
1181341012 22:22179981-22180003 TGAGGATCAGGAAAGGGGCAAGG + Intergenic
1183725952 22:39589844-39589866 TCAGGTGGAGAAAAGGGGCTGGG - Intronic
1183999687 22:41663980-41664002 TAAGGAACAGCAAAGTGGGAGGG - Exonic
949780299 3:7679194-7679216 AAAAATAAAGAAAAGGGGCATGG + Intronic
951134078 3:19083423-19083445 TATGATACAGACAAGAGGCAGGG + Intergenic
951465950 3:23000698-23000720 TAATGTACAGAAACAGGCCAAGG + Intergenic
951719396 3:25681758-25681780 TGAGGTATAAAAAAGGAGCATGG - Intergenic
952310096 3:32180840-32180862 TCTGGAACAGAAATGGGGCAGGG - Intergenic
952651850 3:35737070-35737092 TAACCTAAAGTAAAGGGGCAGGG - Intronic
953832814 3:46316259-46316281 TTTGGTACAGAATAGGGCCAAGG + Intergenic
954970605 3:54648827-54648849 TAAGAGAGAGAAAAGGGGTAGGG + Intronic
955786958 3:62551007-62551029 TAAGGAAGAGAAGAAGGGCAAGG - Intronic
957751511 3:84423393-84423415 TAAGGTAAAGAAAAGGAGTAAGG - Intergenic
960592521 3:119379418-119379440 TTAGGCACAGAAAAGTGGAAGGG - Intronic
960820313 3:121723875-121723897 TAAGGAACAGAAAAGGATGAAGG + Intronic
961785094 3:129342872-129342894 TGAGCTCCAGAAAAGAGGCAGGG + Intergenic
962477768 3:135771627-135771649 TCAGGTCCAGAAGAGGTGCAGGG + Intergenic
962682123 3:137811156-137811178 TATGGTCCAGAAAAGGGGTTGGG - Intergenic
962782791 3:138736829-138736851 GAAGTAACAAAAAAGGGGCAAGG + Intronic
966390568 3:179448776-179448798 TGAGGTAGAGAAATGAGGCAGGG + Intronic
967381199 3:188860338-188860360 TGTGGTACAGTAAAGGAGCAGGG - Intronic
970054690 4:11957495-11957517 ATAGGCACAGAATAGGGGCATGG + Intergenic
971374734 4:26047883-26047905 TAAGGAAGAGAAAAGGGCCAAGG + Intergenic
972625611 4:40796049-40796071 TAAAGTAGAGAATAGTGGCAAGG - Intronic
972738786 4:41870809-41870831 TAAGGAACAGAAGAGGAGGAGGG + Intergenic
972887847 4:43514699-43514721 TGAGGTACAGAAAAGGAGGTAGG - Intergenic
973536742 4:51890613-51890635 AAAGGTAAAGAAGAGGGACAGGG - Intronic
974000728 4:56508217-56508239 CAAGGTAAGGAAGAGGGGCAAGG - Intronic
974166929 4:58215476-58215498 TAAGGTAGAGGGAAGGAGCAAGG + Intergenic
975310076 4:72893976-72893998 TCAGCTACAGAGAAGGGGCAAGG + Intergenic
975320236 4:73002004-73002026 TCAACTAAAGAAAAGGGGCAAGG + Intergenic
977455102 4:97249062-97249084 TAAAGTACAGAAAAGAGAAAAGG - Intronic
977878685 4:102179045-102179067 TAAGGGACAGAAAACTGGCTAGG - Intergenic
980332683 4:131429863-131429885 TAAAGTAAAGAGAAGGGGTAGGG - Intergenic
982033502 4:151324592-151324614 TTGGGTACACAAAAGCGGCACGG - Intronic
982544087 4:156711058-156711080 TCAGGTACAGAAACTGGGGAAGG + Intergenic
983625432 4:169797345-169797367 TAAGGCACAGAGGAGGGGAAAGG - Intergenic
984793636 4:183637115-183637137 TAACAAACAGAAAACGGGCAGGG + Intergenic
986811740 5:11367286-11367308 TATGGGAAAGAAAAGGGCCAAGG + Intronic
987314731 5:16713611-16713633 TAAGTTACTGGGAAGGGGCAGGG - Intronic
987444096 5:17995061-17995083 TAAAGTACATAAAAGTGACATGG - Intergenic
987756861 5:22107695-22107717 AAAGGTAAACAAAGGGGGCAGGG + Intronic
988251749 5:28768188-28768210 TAAGGTACAACAAAGAGCCATGG + Intergenic
988596070 5:32592345-32592367 TGAGCAACAGAAAAGGGGAATGG + Intronic
989415353 5:41168968-41168990 TGATGTACAGAAAACAGGCAAGG + Intronic
990664743 5:58059657-58059679 TATTGTACAGAAAAGGAACATGG + Intergenic
991524000 5:67535756-67535778 TAAGGAAAAGAAAAGGGATAAGG - Intergenic
993580483 5:89653997-89654019 AAGGGGACAGAAAAGTGGCAAGG + Intergenic
994054327 5:95398862-95398884 GCAGGAACAGAAAGGGGGCAAGG + Intronic
994132900 5:96250877-96250899 AAAGGTACAGAGAAGGTACAGGG + Intergenic
994441865 5:99817486-99817508 TAAGATAAAGAATAGAGGCAGGG + Intergenic
995092377 5:108193444-108193466 GAATGAAAAGAAAAGGGGCAGGG + Intronic
997039623 5:130236157-130236179 TAAGGTACAGAAAGAAGGCCAGG + Intergenic
998115405 5:139533353-139533375 AAAGGAAAAGAAAAGGGGCCGGG + Intronic
998174756 5:139894924-139894946 CAAGGTAGAGAAGAGGGGCCAGG + Intronic
998455717 5:142271252-142271274 AAAGGGACAGGAAAGGGGAAAGG + Intergenic
998748047 5:145284402-145284424 TAACATACAGAAAAGAGTCACGG - Intergenic
1000848030 5:166305493-166305515 CAAGGTACACCACAGGGGCAAGG + Intergenic
1001702201 5:173714906-173714928 AAAGATACTGGAAAGGGGCAAGG - Intergenic
1004193091 6:13481381-13481403 TGAGGAACAGAAAAGAGGCCAGG + Intronic
1005221927 6:23596947-23596969 TAAGTTACAGAAACTGGGCAAGG + Intergenic
1007529954 6:42533190-42533212 TAAAGGAAAGAAAATGGGCAGGG + Intergenic
1007954563 6:45904629-45904651 AAAGGGACAGAAAAGAGGGAGGG - Intronic
1008219749 6:48841526-48841548 GCAGTTACAGAGAAGGGGCAGGG - Intergenic
1008247554 6:49196527-49196549 AGAGATGCAGAAAAGGGGCATGG - Intergenic
1009357917 6:62775052-62775074 TAAGGTAGAGATAGGGGGCTGGG + Intergenic
1010026859 6:71228825-71228847 TAAGGAAGAGAAAGGGGGGAGGG - Intergenic
1011114633 6:83876616-83876638 TAAGGCACAGAAAAGGAAAATGG - Intronic
1011950438 6:92958199-92958221 TTAGTTACAGAAAAGTTGCAAGG - Intergenic
1012193684 6:96313040-96313062 AAAGGTAAAGGGAAGGGGCAGGG + Intergenic
1013331308 6:109103528-109103550 TAACATAGAAAAAAGGGGCATGG - Intronic
1013343274 6:109236198-109236220 TTAGGGATAGAAAAGGGGGAAGG + Intergenic
1013394260 6:109718638-109718660 AAAGGCATAGAAAAGGGGCCAGG - Intronic
1014818866 6:125963261-125963283 TAAGGTATTCAAAAGGGGGAGGG + Intronic
1015848229 6:137544318-137544340 TCAGGTCCGGAAAGGGGGCAAGG - Intergenic
1015907943 6:138136739-138136761 TAAGGGCCAGAAAAGGAGAAAGG + Intergenic
1016674696 6:146750261-146750283 TAAGATACAGGAGAGGGGCCAGG + Intronic
1018463972 6:164025610-164025632 TAAGGTACAGAGAAAGGACATGG - Intergenic
1020912138 7:14144211-14144233 GAAAGTACAGGAAAGAGGCAAGG - Intergenic
1020959119 7:14780034-14780056 TAAGATGTAGAAATGGGGCATGG + Intronic
1021777591 7:24068638-24068660 TAAGGGGAAGAAAAGGGGCCAGG + Intergenic
1022045786 7:26621163-26621185 AAAGGTACCAAAAAGGTGCAAGG + Intergenic
1023282773 7:38588628-38588650 TTAGGTTCAGAACAGAGGCAGGG - Intronic
1024225765 7:47325691-47325713 TAATGTAAACAAAATGGGCATGG + Intronic
1025637156 7:63332569-63332591 TAAAGTAAAAAAAAGGGGCTGGG + Intergenic
1025645539 7:63415533-63415555 TAAAGTAAAAAAAAGGGGCTGGG - Intergenic
1025851547 7:65248703-65248725 TGAGGGAAAGAAAAGGGGCAAGG + Intergenic
1028400295 7:90418474-90418496 TGAGGTCAAGAAAGGGGGCATGG - Intronic
1028501750 7:91527114-91527136 TATGATACAGAACAGGGGGAGGG - Intergenic
1029315013 7:99703941-99703963 TAAGGTAGAGAAGAGAGTCATGG - Intronic
1030855763 7:114555499-114555521 TAAGATAGAGCAAAGGGGCTGGG + Intronic
1031857325 7:126938182-126938204 GAAGGGACAGAGAAGGGGAAGGG - Intronic
1032297224 7:130650612-130650634 TTAGGGACAGAAAAGGGAGAAGG - Intronic
1032460329 7:132105507-132105529 TGTGGTACAGATCAGGGGCAGGG + Intergenic
1032716115 7:134510694-134510716 TAAGGTAGAGAATAAAGGCAGGG + Intergenic
1033455796 7:141502298-141502320 TAAGGTTCAGAAAAGAGGCCGGG + Intergenic
1034119065 7:148610757-148610779 AAAGGGACAGCAATGGGGCAGGG + Intronic
1037513819 8:19610309-19610331 AAAGATACAGAAGAGGGGAAGGG + Intronic
1037981683 8:23258827-23258849 AGAGGTACAGAAAGGGGCCAGGG + Exonic
1038175427 8:25177929-25177951 TGAGGTACAGAAAACGGAAATGG + Intergenic
1041169028 8:55121796-55121818 TATGTTACAGAAAAAAGGCACGG + Intronic
1042251445 8:66759878-66759900 TAAGAGACAGAAGAGGGGCTGGG - Intronic
1042593953 8:70425490-70425512 GAAGGTAGAGGAATGGGGCAGGG - Intergenic
1042734591 8:71974193-71974215 AAAAGTAAAGAAAAGGGGGAGGG + Intronic
1043867539 8:85393204-85393226 TGAGGTGCAGAAAAGTGGAAGGG + Intronic
1044346090 8:91106012-91106034 TAAAGCAGAGAGAAGGGGCAGGG + Intronic
1044520873 8:93197950-93197972 TAAGGAATAGAAAAGGGACAAGG - Intergenic
1044526236 8:93254554-93254576 TAAGTTACAGAAAAGGAGAGGGG + Intergenic
1045173952 8:99699934-99699956 TAAGTCACAGAAAAGGGGAGGGG + Intronic
1045449190 8:102303391-102303413 TATGGAACAGAAAATAGGCAAGG + Intronic
1045884639 8:107080802-107080824 TAAGGTACAGGAAGGGAGAAAGG - Intergenic
1046769772 8:118106999-118107021 AAAGGTATAGAAAAGCTGCAAGG - Intronic
1047830855 8:128628157-128628179 TAAAGGACAGAAAAGAGGGAAGG - Intergenic
1051029427 9:12657276-12657298 TGAGGCACAGAAAAGAAGCATGG - Intergenic
1051427056 9:16942835-16942857 AAAGGTACAGAAATGGTGGAGGG + Intergenic
1052178793 9:25500108-25500130 TAAGGCAGAAAAAATGGGCATGG - Intergenic
1053791551 9:41689742-41689764 TAAGATGCAGAAACGAGGCATGG - Intergenic
1055621001 9:78125169-78125191 GAAGGTAGAGAAAAGGTTCAAGG - Intergenic
1056166075 9:83942021-83942043 CAAGGTACTGGAAAGAGGCAAGG + Intronic
1056689033 9:88790244-88790266 TGAGAGACAGAGAAGGGGCAAGG + Intergenic
1057414030 9:94845516-94845538 AACGGGACAGGAAAGGGGCAGGG + Intronic
1058373090 9:104292922-104292944 TATGGGACAGAGAAGGGTCAAGG - Intergenic
1058685865 9:107478983-107479005 GAAGTTACAGAATAGGGGAAGGG + Intergenic
1058876844 9:109252057-109252079 TAAGGGAGAGAAAAGAGGGAGGG + Intronic
1059069117 9:111116994-111117016 TAAGGCACACAAGAGGGGCCAGG + Intergenic
1059391360 9:114001515-114001537 TAAGTGACAGAACAGGGACAGGG + Intronic
1059700999 9:116775518-116775540 GAAGGAAAAGAAAGGGGGCAGGG + Intronic
1060678095 9:125535111-125535133 TAAGCTACAGAAACTAGGCAGGG - Intronic
1061446881 9:130643814-130643836 AAAAGTACAAAAAATGGGCAGGG + Intergenic
1061491388 9:130946658-130946680 GAAGCTACTGGAAAGGGGCATGG - Intergenic
1061976189 9:134068847-134068869 CAAGATACAGAAAAAGGGCCAGG - Intergenic
1185679987 X:1880629-1880651 TAGGGTCCAGGAAAGGGGCTGGG + Intergenic
1187761340 X:22589390-22589412 TAGAGAAGAGAAAAGGGGCAGGG + Intergenic
1187877771 X:23818239-23818261 TATGGTACAGAAAAGGGTGTTGG + Intergenic
1188248981 X:27868526-27868548 TAATCAACAGAAGAGGGGCAGGG - Intergenic
1188339036 X:28976494-28976516 GAAGGAACAGATAAGGGGGAAGG + Intronic
1188482680 X:30651443-30651465 TGAGGTAAAGATAAGGGGAAAGG - Intergenic
1188507012 X:30893607-30893629 GAAGGGAAAGCAAAGGGGCAAGG - Intronic
1191099464 X:56710122-56710144 TAGGGTACCGAAAAGAGACAAGG - Intergenic
1191731842 X:64344535-64344557 TTAGGGTCAGAAAGGGGGCAAGG - Intronic
1192142656 X:68658967-68658989 CAAGGTAGAGGAAAGGGCCAGGG - Intronic
1192218459 X:69180186-69180208 AAAAGGACAGAAAGGGGGCAGGG - Intergenic
1194152963 X:90348812-90348834 TAAAGAAAAAAAAAGGGGCAAGG + Intergenic
1194916970 X:99719168-99719190 TAAGGAACAGCAAAGTGGGAGGG + Intergenic
1197673269 X:129302247-129302269 TAGAGTACAGAAAAAGGACAAGG - Intergenic
1197730291 X:129803993-129804015 TAAGGAAAAGAAAGAGGGCAGGG + Exonic
1199681899 X:150230884-150230906 TAAGGAACAGCAAAGTGGGAGGG + Intergenic
1201897376 Y:19006246-19006268 CAAAATACTGAAAAGGGGCAAGG + Intergenic