ID: 1133312606

View in Genome Browser
Species Human (GRCh38)
Location 16:4859819-4859841
Sequence GTTACACGGCTCCCTAACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 33}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133312606_1133312609 6 Left 1133312606 16:4859819-4859841 CCTGAGTTAGGGAGCCGTGTAAC 0: 1
1: 0
2: 0
3: 2
4: 33
Right 1133312609 16:4859848-4859870 TTGTCTTTAATTCTCAGAAGCGG 0: 1
1: 0
2: 2
3: 35
4: 380
1133312606_1133312610 16 Left 1133312606 16:4859819-4859841 CCTGAGTTAGGGAGCCGTGTAAC 0: 1
1: 0
2: 0
3: 2
4: 33
Right 1133312610 16:4859858-4859880 TTCTCAGAAGCGGAAGTTGAAGG 0: 1
1: 0
2: 1
3: 24
4: 225
1133312606_1133312612 23 Left 1133312606 16:4859819-4859841 CCTGAGTTAGGGAGCCGTGTAAC 0: 1
1: 0
2: 0
3: 2
4: 33
Right 1133312612 16:4859865-4859887 AAGCGGAAGTTGAAGGAAGGTGG 0: 1
1: 0
2: 0
3: 32
4: 373
1133312606_1133312611 20 Left 1133312606 16:4859819-4859841 CCTGAGTTAGGGAGCCGTGTAAC 0: 1
1: 0
2: 0
3: 2
4: 33
Right 1133312611 16:4859862-4859884 CAGAAGCGGAAGTTGAAGGAAGG 0: 1
1: 0
2: 0
3: 24
4: 407

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133312606 Original CRISPR GTTACACGGCTCCCTAACTC AGG (reversed) Intronic