ID: 1133312984

View in Genome Browser
Species Human (GRCh38)
Location 16:4862931-4862953
Sequence CTGGTCACCAGCTCCCCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 253}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133312984_1133312990 -1 Left 1133312984 16:4862931-4862953 CCCAGTGGGGAGCTGGTGACCAG 0: 1
1: 0
2: 0
3: 26
4: 253
Right 1133312990 16:4862953-4862975 GGAGAGGCTGATGTTCTGGTTGG 0: 1
1: 0
2: 1
3: 17
4: 234
1133312984_1133312988 -5 Left 1133312984 16:4862931-4862953 CCCAGTGGGGAGCTGGTGACCAG 0: 1
1: 0
2: 0
3: 26
4: 253
Right 1133312988 16:4862949-4862971 ACCAGGAGAGGCTGATGTTCTGG 0: 2
1: 0
2: 0
3: 21
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133312984 Original CRISPR CTGGTCACCAGCTCCCCACT GGG (reversed) Intronic
900334751 1:2156850-2156872 CTGAACACCTGCTCTCCACTGGG - Intronic
900544725 1:3222244-3222266 GTCGTCACCAGCTCCTCACTGGG - Intronic
901230512 1:7639446-7639468 CTGGGCACCAACTGCCCCCTGGG + Intronic
901305585 1:8230503-8230525 CAGGTGACCTGCTCTCCACTGGG - Intergenic
902601847 1:17545263-17545285 CTGTTTACCAGCACACCACTGGG + Intronic
904056282 1:27672501-27672523 CTGATCACCAGCTCCCCCTGGGG + Intergenic
905922406 1:41728354-41728376 TTGGACTCCAGCTCCCCTCTAGG - Intronic
905934257 1:41811162-41811184 CTATTCACTAGCTGCCCACTGGG - Intronic
907579022 1:55555348-55555370 CTGAGCACCAGCTCCCTGCTAGG + Intergenic
908949310 1:69540322-69540344 ATGCTCACCAGCTGCCAACTTGG + Intergenic
911534122 1:99079235-99079257 CTGGTCTCCAGCTCCTAACCGGG - Intergenic
912355639 1:109052864-109052886 CTGGTCTCCAGCTCCTGACATGG + Intergenic
912497129 1:110098797-110098819 CTGCCCATCAGCACCCCACTTGG - Intergenic
913439463 1:118882580-118882602 CAGATTGCCAGCTCCCCACTTGG + Intergenic
913510786 1:119559716-119559738 CTGGTGACCAGGTACCCAATAGG + Intergenic
914257306 1:145970967-145970989 CTGGTCTCCACCTCCCGACCAGG - Intronic
914462591 1:147898663-147898685 CTATTCTCCACCTCCCCACTAGG + Intergenic
916759937 1:167806787-167806809 CTGGTCTCCAGCTCCTGACCTGG - Intergenic
917126782 1:171694467-171694489 CTGGTCTCCAGCTCCTAACCAGG - Intergenic
917517229 1:175718434-175718456 CAGGTCTCCAGCTCCTCTCTGGG - Intronic
919743891 1:200996648-200996670 CTGGTCCCCAACTTCCCACGAGG + Intronic
921303186 1:213770019-213770041 CTGGTGACCTCCTCCCCACTTGG - Intergenic
922022698 1:221720229-221720251 CTGGTGACCAGCTCCCTTCCTGG - Intronic
922136718 1:222835554-222835576 CCAGTAACAAGCTCCCCACTGGG - Intergenic
923095030 1:230768382-230768404 CTGTTCTCCAGCTCCACCCTGGG + Intronic
1064270395 10:13859987-13860009 ATATTCACCAGCACCCCACTGGG - Intronic
1064284628 10:13981851-13981873 CAGGTCACTGGATCCCCACTGGG - Intronic
1065581855 10:27180253-27180275 CTTGTGATCAGCTCCCCTCTTGG - Intronic
1066040374 10:31543339-31543361 CTGGTGACCAGCTCCCATCCAGG + Intergenic
1067749348 10:48959888-48959910 CTGGTCACTGGCCCTCCACTTGG - Intronic
1070516581 10:77213867-77213889 CTGTTCACGTGCTCCCCACTGGG + Intronic
1070891642 10:79945782-79945804 CTGGGCTCCATCTCCACACTGGG - Intronic
1071816688 10:89239536-89239558 CAGGTCACCTGCTCCCCAGCAGG - Intronic
1072946285 10:99812678-99812700 CAGGTCTCCAGGCCCCCACTAGG + Intronic
1073169223 10:101488798-101488820 CTGGTTACCAGGTACCCACCTGG + Intronic
1074392945 10:113073049-113073071 CTGGCCACCAGCACCTAACTAGG - Intronic
1076177162 10:128377027-128377049 GTGGTCTCCATCCCCCCACTTGG - Intergenic
1076791621 10:132779699-132779721 CTGCACACCCGCTGCCCACTGGG - Intronic
1076869689 10:133187258-133187280 CTGGTCAGCTGCTCCTCACGAGG + Intronic
1077108726 11:852951-852973 CTGGTCACTGGCTGCCCACTGGG - Intronic
1077119510 11:900348-900370 CCTGACACCAGCTCCCCACACGG + Intronic
1077975157 11:7240182-7240204 CTGGACAACAGCTCACCACTTGG - Intronic
1078086674 11:8237667-8237689 ATGGCCTCCAGCTCCCCACGAGG + Intronic
1082259057 11:50063538-50063560 CTGGTCTCCAGCTCCTAACCGGG - Intergenic
1082798518 11:57396135-57396157 CTGGACAACAGTTCCCCATTTGG + Intronic
1083120677 11:60509817-60509839 CTGGTCTCCAGCTCCTGACCGGG + Intergenic
1083893943 11:65611079-65611101 CTGGCCACCAGCTCCCTCCCTGG + Intronic
1084410302 11:69002855-69002877 TAGGTCAGCAGCTCCCCACGAGG + Intergenic
1084440029 11:69167520-69167542 CGTGTCACCAGCTCCCCAGGTGG - Intergenic
1084493183 11:69489250-69489272 CCGGGCACCTGCTCCCCACTTGG + Intergenic
1084775276 11:71370742-71370764 CTGGTCTGCTGCTCCCCACAGGG + Intergenic
1085444666 11:76592369-76592391 CTGATCACGAGCACCCCACGAGG + Intergenic
1086801689 11:91184037-91184059 CTGGGCAGGACCTCCCCACTGGG - Intergenic
1087189026 11:95232474-95232496 CTGGAGCCCAGCTCCCCACCCGG + Intronic
1087487110 11:98770536-98770558 CTGGTCTCCAGCTCCTAACTGGG - Intergenic
1087501912 11:98967398-98967420 CTGGTCAGAAACTCCACACTTGG + Intergenic
1089341829 11:117763341-117763363 CCGGACCCCAGCTGCCCACTGGG - Intronic
1089341891 11:117763683-117763705 CCGGACCCCAGCTGCCCACTGGG + Intronic
1090486389 11:127116119-127116141 GAGGCCACCAGCTGCCCACTCGG + Intergenic
1093927715 12:24925804-24925826 CTGGTCTCCAGCTCCTAACCGGG + Intronic
1094160733 12:27387394-27387416 CTGAACACCTTCTCCCCACTGGG + Intronic
1094717085 12:33023410-33023432 CTGGTCTCCAGCTCCCAACCGGG - Intergenic
1096041553 12:48521129-48521151 CTGGTCTCCAGCTCCTAACCGGG - Intronic
1097541237 12:60946237-60946259 CTGGTGACCAGCTCCTATCTAGG - Intergenic
1098131545 12:67356091-67356113 CTGGTCATAAGCTCCACAATGGG - Intergenic
1102558971 12:113748699-113748721 TTGATCTGCAGCTCCCCACTGGG - Intergenic
1103414201 12:120733003-120733025 CTGGTCTCCAGCTCCTAACCAGG - Intronic
1103674298 12:122643602-122643624 CTGGTGACCAGCCCCCAACCAGG + Intergenic
1103945019 12:124521103-124521125 CTGGCCCCCACCTCCCCCCTGGG - Intronic
1108291059 13:48961576-48961598 TTGGTCAGCAGCTCCACAATGGG + Intergenic
1108575177 13:51784283-51784305 CTGGTCAGATGCTCCCCTCTGGG - Intronic
1111086263 13:83379394-83379416 CTGGTCTCCAACTCCTGACTTGG + Intergenic
1112617388 13:101019300-101019322 CTGGTCACAAGCTGCCCACAGGG - Intergenic
1113131059 13:107037339-107037361 CTGGTTCCCAACTCCCCAATGGG + Intergenic
1113335053 13:109369682-109369704 CAGGTGCCCAGCTTCCCACTCGG - Intergenic
1113349425 13:109513790-109513812 CTGGGCACCAGTTCCTCAGTAGG + Intergenic
1117070412 14:52050821-52050843 CTGGTCTCGAACTCCCCACAGGG + Intronic
1117953884 14:61108034-61108056 CTGGTCCCCATTTCCCTACTGGG + Intergenic
1118716720 14:68564935-68564957 GTGGCCACCAGGTTCCCACTGGG + Intronic
1118955475 14:70477180-70477202 CTGGTCTCCAGCTCCTAACCGGG + Intergenic
1119861220 14:77937586-77937608 GTGATCACCAGCTCCCAGCTTGG - Intergenic
1121998237 14:98623510-98623532 CTGCTCACCTGGTCCCCACCTGG - Intergenic
1123059119 14:105586458-105586480 CTGGACTCCAGGGCCCCACTGGG - Intergenic
1123083448 14:105706689-105706711 CTGGACTCCAGGGCCCCACTGGG - Intergenic
1123734750 15:23174973-23174995 CTGGTCTCCTGCTCCTCACCTGG - Intergenic
1124285252 15:28396271-28396293 CTGGTCTCCTGCTCCTCACCTGG - Intergenic
1124297444 15:28515343-28515365 CTGGTCTCCTGCTCCTCACCTGG + Intergenic
1125474205 15:40034321-40034343 CTGTTCATCAGCATCCCACTAGG - Exonic
1127599891 15:60524771-60524793 CTGAGCACCTGCTCCCTACTAGG + Intronic
1127644553 15:60946482-60946504 CTGGTCTCCAGCTCCTAACCGGG + Intronic
1128089172 15:64907300-64907322 CTGTTCAGGAGCTGCCCACTGGG + Intronic
1129313645 15:74728486-74728508 CTGGTCTCCAGCTCCTAACAGGG + Intergenic
1130553366 15:84905794-84905816 CTGGTCCCCAGCTGCCCACCTGG - Intronic
1131054038 15:89365178-89365200 CTGGTCAGGTTCTCCCCACTTGG + Intergenic
1132066003 15:98731923-98731945 CTGGTCTCAAGCTACACACTTGG - Intronic
1132840578 16:1976743-1976765 CTGATGGCCAGCTCCCCACAGGG - Intronic
1132921951 16:2400544-2400566 CTGGTCTCCAGCTCCTAACCGGG - Intergenic
1133058324 16:3158545-3158567 CTGGTCACCGGCCCTCCTCTCGG + Intergenic
1133312984 16:4862931-4862953 CTGGTCACCAGCTCCCCACTGGG - Intronic
1134679588 16:16114888-16114910 CGGTTCACCAGGTTCCCACTGGG - Exonic
1135017392 16:18935208-18935230 CTGGTCTCCAGCTCCTCTGTGGG - Intergenic
1136626379 16:31464635-31464657 CCGGTCACAAGTGCCCCACTTGG - Exonic
1136990852 16:35150695-35150717 CTGGGCACCAGGACCCCACCTGG - Intergenic
1141143778 16:81514914-81514936 CTGGACCCCAGCGCCCCACTTGG - Intronic
1141503844 16:84462191-84462213 CTGGGCTGCAGCTCCCCACCTGG - Intronic
1142231914 16:88903938-88903960 CCCGGCACCAGCTCCCCAGTGGG - Intronic
1143029922 17:3962225-3962247 CTGGTTACCTGCTCCTCTCTGGG - Intronic
1143397942 17:6617663-6617685 CTGGTGACCAGCTCCCATCCAGG - Intronic
1143480484 17:7225068-7225090 GTGGTCACCAGCAACCCACTTGG + Exonic
1143902522 17:10184796-10184818 CTGGTGACCAGCTCCAACCTGGG - Intronic
1144162161 17:12570226-12570248 CTGGGCACCACCACCCAACTGGG + Intergenic
1147824831 17:43263734-43263756 CTGGTCTCCAACTCCCTTCTTGG + Intergenic
1148028429 17:44604206-44604228 CTGTTCTACACCTCCCCACTCGG + Intergenic
1148604189 17:48916465-48916487 CTGGTCTCCAGCTCCTGACCTGG + Intronic
1148618118 17:49014979-49015001 CTGGGCACCAGCTCCATCCTCGG + Intronic
1149506748 17:57200743-57200765 ATGCTCACCAGGTCTCCACTGGG - Intergenic
1152229657 17:79108118-79108140 GTGGTCTCCAGCTGTCCACTGGG - Intronic
1153596141 18:6727257-6727279 CTCGTCACCATCTCCTGACTAGG - Intergenic
1153627529 18:7035878-7035900 CTGGCCACCAGCTCCTTGCTGGG + Intronic
1156213016 18:34967506-34967528 CTGGTGACCAGCTTCCGTCTAGG + Intergenic
1157547320 18:48555563-48555585 CTGGCCACCCACTCACCACTGGG + Intronic
1157685502 18:49639763-49639785 GTGGTTCCCAGCTCCCCACCTGG + Intergenic
1158322231 18:56276185-56276207 CTAGTCACAAGCTCTTCACTGGG - Intergenic
1159004285 18:62998938-62998960 CTGTTCACAATCTCCCCATTAGG + Intergenic
1159883115 18:73878446-73878468 CTGGTCAGCAGCTCTCCAGCAGG + Intergenic
1160767534 19:815102-815124 CGGGTCCCCAGCTCCCCGCCTGG - Intronic
1162254990 19:9482877-9482899 CTGGTCTCCAGCTCCTAACCAGG + Intronic
1163017912 19:14467897-14467919 ATGGCGAACAGCTCCCCACTGGG - Exonic
1163415388 19:17183385-17183407 CTGGTCACCTGGTCACCACCAGG + Intronic
1163791165 19:19306810-19306832 CTGGTCTCCAGGTCCTCACCTGG - Intronic
1164064914 19:21707566-21707588 CTGGTCTCCAGCTCCTAACTGGG + Intergenic
1164913307 19:32029508-32029530 CTGGTCAGCCTCTCTCCACTTGG + Intergenic
1166529698 19:43535018-43535040 CTGTCCCCCAGCTCCCCACCAGG + Exonic
1167036141 19:46996023-46996045 CTGGCCACCCGCTCCTCACTAGG + Intronic
1167897636 19:52594099-52594121 CTGGTCTCCAGCTCCTAACCGGG - Intronic
925407710 2:3616540-3616562 CTGGTCTCCAGCTCCTAACCGGG - Intronic
925515761 2:4679176-4679198 CTGGTCTCCTGCTGCCCCCTAGG + Intergenic
926136233 2:10338586-10338608 CTGGTCACCAACACAGCACTGGG - Intronic
927049507 2:19313168-19313190 TTGTTCACCAGTTCCCCACCAGG - Intergenic
928283931 2:29972546-29972568 CAGGACACCAGCCACCCACTAGG + Intergenic
928921230 2:36530448-36530470 CTGGGCACAAACTCCACACTTGG - Intronic
929117401 2:38456052-38456074 CTGGTCACCAGCTGCCAAGCTGG + Intergenic
929448811 2:42022698-42022720 CAGCTCACCAGCACCACACTTGG + Intergenic
932228992 2:70066741-70066763 ATGTTCACCAGCACCACACTTGG + Intergenic
937635494 2:124151208-124151230 CTGGCCACAAGGTTCCCACTGGG - Intronic
941286392 2:163618699-163618721 CTGGGGACCAGCTCCCTCCTTGG + Intronic
943435975 2:187866591-187866613 AGGGACACCAGCTCCCCCCTGGG + Intergenic
947498957 2:230658626-230658648 CCAGCCACCAGCCCCCCACTGGG + Intergenic
948887605 2:240891953-240891975 ATGGTGGCCAGCTCCTCACTTGG - Intronic
1169469744 20:5873948-5873970 CTGGTCACCAGCCTCCACCTAGG - Intergenic
1170035624 20:11986533-11986555 CTGGTCAGCCATTCCCCACTGGG + Intergenic
1170431864 20:16283455-16283477 CTGGTCACCGCCTACACACTGGG - Intronic
1171161880 20:22933452-22933474 TTGGAAACCAGCTCCCCACTGGG - Intergenic
1172237591 20:33388839-33388861 CTGGTCTCCAGCTCCTAACCGGG + Intronic
1174181027 20:48674852-48674874 CTGGTCAACCCCTACCCACTGGG + Intronic
1174427049 20:50439236-50439258 CTGCTCATCATCTCCCCAGTGGG + Intergenic
1175171212 20:57082680-57082702 ATGCTCACCAGCTCCCCTCCTGG - Intergenic
1176135059 20:63518962-63518984 CAGGTCACCCGCTTCCCTCTAGG - Intergenic
1176145186 20:63562317-63562339 CTGGTCACCAGCATCGCACTGGG - Exonic
1176382478 21:6120266-6120288 CTGGGCAGCACCTCCCGACTTGG + Intronic
1179740994 21:43417973-43417995 CTGGGCAGCACCTCCCGACTTGG - Intronic
1179930693 21:44569047-44569069 CTGCTCTCCAGCTGCTCACTGGG - Intronic
1180757065 22:18169537-18169559 CTGCACTCCAGCTCCCCACTTGG + Intronic
1181074708 22:20367906-20367928 CTGCACTCCAGCTCCCCACTTGG - Intronic
1181396988 22:22629793-22629815 CTGCACATCAGCTCCCAACTGGG + Intergenic
1181499733 22:23309152-23309174 CTGCACATCAGCTCCCAACTGGG + Intronic
1182606939 22:31513033-31513055 CTGGTCTCAAGCTCCTGACTGGG + Intronic
1182959400 22:34457977-34457999 TTGGTCACCTTCTACCCACTGGG + Intergenic
1183328090 22:37205154-37205176 CTGGTAGCCAGCTCCACCCTAGG + Exonic
1184054154 22:42033203-42033225 ATGGGCACCAGCTCTCCACGAGG + Intronic
1184565275 22:45288127-45288149 CTGGGCCCCAGCTTTCCACTGGG - Intronic
1184659569 22:45959721-45959743 CTGGACACCGGCTCCCAACCTGG + Intronic
1184666948 22:45994356-45994378 CTGGACACCAGCTGCCCTCTTGG + Intergenic
1184804016 22:46780745-46780767 CTGGGCACCTGCTCCACACCAGG - Intronic
950405312 3:12800587-12800609 CAGTTCACCTGGTCCCCACTAGG - Intronic
950881504 3:16326276-16326298 CTGGTCACCAGCTCCACAAAGGG - Intronic
950941893 3:16901321-16901343 ATCAGCACCAGCTCCCCACTGGG - Intronic
952955802 3:38556413-38556435 TAGAGCACCAGCTCCCCACTGGG - Intronic
953526416 3:43693381-43693403 TTGTTTGCCAGCTCCCCACTGGG + Intronic
953742810 3:45551828-45551850 CTGGTCACCACCTCCCCTCCAGG - Intergenic
954567190 3:51608608-51608630 CTGGTCTCCAGCTCCTGACCAGG - Intronic
954711292 3:52506288-52506310 GCGGTGACCAGCTGCCCACTTGG + Intronic
954919640 3:54178871-54178893 CTGGAAACCAACTCCTCACTAGG - Intronic
962265954 3:133944499-133944521 CTGGCCACCAGCTTTCCACTTGG - Intronic
962688713 3:137872365-137872387 CTGGTCTCCAGCTCCTAACCAGG + Intergenic
962707735 3:138061686-138061708 TTGCTCAGGAGCTCCCCACTGGG + Intergenic
963233489 3:142933400-142933422 CTGGGCAACAGCTCCTAACTAGG - Intergenic
963815055 3:149820425-149820447 TTTATCACCAGCTCCTCACTAGG - Intronic
967578636 3:191125565-191125587 CTGGTCTCCAGCTCCTGACCTGG - Intergenic
968733300 4:2281904-2281926 CTGGGCACCAGCTCACTTCTCGG - Intronic
969299875 4:6291515-6291537 CTGGTCCCCTGGTCCCCACAAGG - Intronic
980027092 4:127780787-127780809 CTGCTCACGAGCTGCCCGCTGGG + Intergenic
983220933 4:165043840-165043862 CTGGTGACCACCTCCCTAATGGG - Intergenic
984140872 4:176002340-176002362 CTGGTCACTCGCTCTCCTCTGGG - Intronic
984813838 4:183819326-183819348 CTGGTCTCCAGCTCCTAACCGGG - Intergenic
984840305 4:184061765-184061787 CTGGTCACCTCCTCCACACATGG - Intergenic
985478159 5:91477-91499 CTGGGCACCAGCTTCCTGCTGGG - Intergenic
985575982 5:673700-673722 CTGGTCCCCGGCCCCACACTGGG + Intronic
985578437 5:684395-684417 CTGGCCCCAAGCTGCCCACTGGG + Intronic
986265754 5:6189060-6189082 CTGGACACCTGATCCTCACTCGG - Intergenic
987274305 5:16345828-16345850 GTGATCAGCAGCTTCCCACTAGG - Intergenic
990575528 5:57120232-57120254 CTGGTGACCAGCCCCCATCTAGG + Intergenic
990931305 5:61095178-61095200 CCGGGCAGGAGCTCCCCACTGGG - Intronic
992269193 5:75048810-75048832 GTGGTCACTAGCTTCTCACTGGG - Intergenic
994517093 5:100785382-100785404 CTGGTCTCCAGCTCCTGACCTGG + Intergenic
996749741 5:126876505-126876527 CTGGTCAACAGCACCACCCTGGG - Intronic
998646619 5:144069176-144069198 CTGGTGACCAGCCCCCCTCCAGG - Intergenic
1001808451 5:174608978-174609000 CTTCTCACCCGCTCCCCTCTTGG - Intergenic
1002593524 5:180307014-180307036 CTGAGCACCAGCTCTCCACCAGG - Intronic
1003483807 6:6557102-6557124 CTGGTCTGCAGCTTCCCACAAGG - Intergenic
1005681884 6:28216488-28216510 CAGGTGAGCAGCTCCCCACGGGG + Intergenic
1005931408 6:30487543-30487565 CTGGTCTCGAACTCCCGACTGGG + Intergenic
1007350777 6:41272066-41272088 GCGGTCACCATCTCCCCACGAGG + Intronic
1008990488 6:57595961-57595983 CTGGTGACCAGCCCCCATCTAGG + Intronic
1009179062 6:60494507-60494529 CTGGTGACCAGCCCCCATCTAGG + Intergenic
1009915204 6:69986729-69986751 CTGGTCTCCAGTGCCCAACTTGG + Intronic
1011361823 6:86534527-86534549 CTGGTGACCTGCTCCCTGCTTGG - Intergenic
1014834971 6:126150813-126150835 TTGGTCACCAGCACCCTTCTAGG + Intergenic
1016155377 6:140800330-140800352 CTGTTCAGCAACTCCACACTAGG - Intergenic
1016341159 6:143062421-143062443 CTTGTCACGGGCTCCTCACTTGG - Intronic
1017294364 6:152776872-152776894 CTGCCCACCAGCACCCCAGTGGG - Intergenic
1019610263 7:1933187-1933209 CTGGGTATCAGCTCCTCACTAGG + Intronic
1019685527 7:2379911-2379933 CTGCTCCCCAGCCCCCGACTTGG - Intronic
1020157162 7:5736334-5736356 CTGGTCTCCAGCTCCTAACCGGG + Intronic
1021534691 7:21689930-21689952 CTGGCCAGCAGCAACCCACTTGG + Intronic
1022133476 7:27425405-27425427 CTCGGCTCCAGCTGCCCACTGGG - Intergenic
1023021470 7:36015342-36015364 CTGGCTGCCAGCTCCCCACTTGG + Intergenic
1024352099 7:48376952-48376974 TTGGTCCCTAGATCCCCACTAGG - Intronic
1024971853 7:55078522-55078544 CTGGGCAGCAGTTCCCCACGGGG - Intronic
1026108445 7:67439203-67439225 CTGCTCCCCAGCTCAGCACTTGG + Intergenic
1026562856 7:71464686-71464708 CTAGTCTCAGGCTCCCCACTTGG + Intronic
1030288179 7:107847767-107847789 CTGGTCTCCAGCTCCTAACCGGG + Intergenic
1030334281 7:108307764-108307786 CTGGCCTCCTGCTCCACACTGGG + Intronic
1032151631 7:129434446-129434468 CTGGTCAGCGGCTCCCCTCAGGG - Exonic
1033130531 7:138741820-138741842 CTGGTCACCAGCTGCGACCTGGG - Intronic
1034951446 7:155299050-155299072 CTGCTCACCAGTTCCCCAGGCGG - Intronic
1035608864 8:947622-947644 CTGGTCACCACCTCCACGCGCGG + Intergenic
1037738141 8:21583018-21583040 CTGCTCCCCAGCACCCCTCTTGG - Intergenic
1037747853 8:21661137-21661159 CTGGATGCCACCTCCCCACTGGG - Intergenic
1039753286 8:40497008-40497030 CTGGTCTCCAGCTCCTAACCGGG - Intergenic
1039949917 8:42162293-42162315 TGGGTGACCAGCTTCCCACTGGG + Exonic
1042336933 8:67639485-67639507 ATGGGCACCAGCTCCCTACAAGG + Intronic
1043114856 8:76237607-76237629 CTGGCCAACAGCCCCCCACTAGG + Intergenic
1046628549 8:116600999-116601021 ATGGTCTCCAGCCCCCAACTAGG + Intergenic
1056235282 9:84588105-84588127 CAGGTCACAAGCTCCTCAGTGGG - Intergenic
1056487707 9:87075739-87075761 CTGCCCCCCAGCTCCCCACAGGG + Intergenic
1056822333 9:89852360-89852382 CTATTCACCAGCTCCCAACCTGG - Intergenic
1057187403 9:93064641-93064663 CTAGTCATGAGCTCCCCACAGGG + Intronic
1057751361 9:97796059-97796081 CTGGTCTCCAGCTCCTAACCGGG + Intergenic
1057957074 9:99418700-99418722 CCTGCCACCAGGTCCCCACTGGG + Intergenic
1060846676 9:126842815-126842837 CTGTTCCTCTGCTCCCCACTTGG + Intergenic
1061659332 9:132118255-132118277 TGGGTCAACAGCTCCCCAGTTGG + Intergenic
1061707078 9:132461484-132461506 CTGGTCCCCAGCAGCCAACTAGG + Intronic
1061749085 9:132763023-132763045 TTGGACACCTGCTCACCACTGGG + Intronic
1061753295 9:132795610-132795632 ATGGTCAGCAACTACCCACTGGG - Intronic
1062059000 9:134484611-134484633 GTTGGCACCACCTCCCCACTTGG - Intergenic
1062419705 9:136474271-136474293 CGGGTCAGCAGCTGCCCCCTCGG - Exonic
1062445782 9:136593663-136593685 CTGGTTGCCAGCTCTGCACTGGG - Intergenic
1062623173 9:137431644-137431666 CTGGTCACTCGCACCCCAGTGGG - Intronic
1187184450 X:16969507-16969529 CTGGTCTCCAGCTCCTAACCGGG - Intronic
1187212665 X:17245585-17245607 CTGGTCTCCAGCTCCTAACCGGG - Intergenic
1188091280 X:25968298-25968320 CTGGTCTCCCGCTCCCTCCTTGG - Intergenic
1188445050 X:30247045-30247067 CTGGTCCCTACGTCCCCACTAGG - Intronic
1188445096 X:30247266-30247288 CTGGTCCCTACGTCCCCACTAGG - Intronic
1189277594 X:39798000-39798022 TTGTTCACCAGCTCACCACAGGG - Intergenic
1189796567 X:44651454-44651476 CTTGGCTCCAGCTCCCCTCTGGG - Intergenic
1189825408 X:44911808-44911830 CTGGTCTCCAGCTCCTAACCCGG - Intronic
1189920270 X:45896619-45896641 CTGGTCACCAGCTCCCATCCAGG + Intergenic
1190359896 X:49638751-49638773 CTGCTCCAGAGCTCCCCACTGGG - Intergenic
1190385132 X:49877941-49877963 CTGGACATCAGCTCTCCACCTGG - Intergenic
1190769486 X:53503622-53503644 CTGGTCTCCAGCTCCTAACCGGG + Intergenic
1190801217 X:53790800-53790822 CAGGTCCCCAGTTCTCCACTGGG - Intergenic
1192592205 X:72369673-72369695 CTGGTCTCCTGCTCCCCAGTAGG + Intronic
1196859805 X:120016042-120016064 TTAGTCACCAGCTACCCAGTGGG - Intergenic
1197455537 X:126673433-126673455 CTGGTCTCCAGCTCCTAACCGGG + Intergenic
1198648739 X:138837916-138837938 CTGGGCAGGAGCTCCCAACTGGG - Intronic
1199687193 X:150274896-150274918 CTTCTCCCCAGCTCCTCACTGGG - Intergenic
1200048065 X:153413056-153413078 CTAGTCACCTGCTGCCCACCTGG - Intergenic
1201440358 Y:14001344-14001366 CTGGTCTCCAGCTCCTGACCTGG - Intergenic
1201444213 Y:14041364-14041386 CTGGTCTCCAGCTCCTGACCTGG + Intergenic