ID: 1133314434

View in Genome Browser
Species Human (GRCh38)
Location 16:4873768-4873790
Sequence CAGTCTGAGGAGATGGGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 1, 2: 1, 3: 31, 4: 272}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133314428_1133314434 5 Left 1133314428 16:4873740-4873762 CCATGAAAAGCTCACTCTTCTTT 0: 1
1: 0
2: 7
3: 33
4: 394
Right 1133314434 16:4873768-4873790 CAGTCTGAGGAGATGGGTGCTGG 0: 1
1: 1
2: 1
3: 31
4: 272
1133314426_1133314434 12 Left 1133314426 16:4873733-4873755 CCTGTTCCCATGAAAAGCTCACT 0: 1
1: 0
2: 2
3: 15
4: 156
Right 1133314434 16:4873768-4873790 CAGTCTGAGGAGATGGGTGCTGG 0: 1
1: 1
2: 1
3: 31
4: 272
1133314427_1133314434 6 Left 1133314427 16:4873739-4873761 CCCATGAAAAGCTCACTCTTCTT 0: 1
1: 0
2: 3
3: 31
4: 272
Right 1133314434 16:4873768-4873790 CAGTCTGAGGAGATGGGTGCTGG 0: 1
1: 1
2: 1
3: 31
4: 272
1133314424_1133314434 18 Left 1133314424 16:4873727-4873749 CCCATTCCTGTTCCCATGAAAAG 0: 1
1: 0
2: 1
3: 34
4: 322
Right 1133314434 16:4873768-4873790 CAGTCTGAGGAGATGGGTGCTGG 0: 1
1: 1
2: 1
3: 31
4: 272
1133314423_1133314434 19 Left 1133314423 16:4873726-4873748 CCCCATTCCTGTTCCCATGAAAA 0: 1
1: 1
2: 3
3: 61
4: 650
Right 1133314434 16:4873768-4873790 CAGTCTGAGGAGATGGGTGCTGG 0: 1
1: 1
2: 1
3: 31
4: 272
1133314425_1133314434 17 Left 1133314425 16:4873728-4873750 CCATTCCTGTTCCCATGAAAAGC 0: 1
1: 0
2: 3
3: 33
4: 491
Right 1133314434 16:4873768-4873790 CAGTCTGAGGAGATGGGTGCTGG 0: 1
1: 1
2: 1
3: 31
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133314434 Original CRISPR CAGTCTGAGGAGATGGGTGC TGG Intronic
900008941 1:88704-88726 AGGTCAGAGGAGATGGGGGCCGG - Intergenic
900008974 1:88850-88872 AGGTCAGAGGAGATGGGGGCCGG - Intergenic
900008991 1:88921-88943 AGGTCAGAGGAGATGGGGGCCGG - Intergenic
900324885 1:2103859-2103881 CAGTGGGAGGAGAGGGGTGAAGG + Intronic
900412460 1:2518999-2519021 CAGTCAGAAGGGAGGGGTGCTGG + Intronic
902112964 1:14098600-14098622 CAGTCTGGGCAGAGGGATGCTGG - Intergenic
902610094 1:17592197-17592219 CACTCAGAGGTGAGGGGTGCAGG - Intronic
902688749 1:18096480-18096502 CATTCTCAGGAGATGGGGCCAGG + Intergenic
903792853 1:25906378-25906400 CGGACTGAGCAGGTGGGTGCGGG - Exonic
904235426 1:29113512-29113534 CAGACTGAGTGGGTGGGTGCAGG - Intronic
904679241 1:32217168-32217190 CACTCTGGGGAGATGGGTTCTGG + Intronic
905018914 1:34795137-34795159 CATTCTGAGGGGGTGGGTCCAGG - Exonic
905708664 1:40082070-40082092 CATTTTGAGGAGGTGGGGGCTGG - Intronic
906316076 1:44787069-44787091 CAGGCACAGGAGCTGGGTGCTGG - Intronic
911792304 1:102032926-102032948 CTGTGTGAGGAGATGGATGCAGG + Intergenic
912932738 1:113979524-113979546 CAAGATGAGGAGAGGGGTGCTGG - Exonic
913053700 1:115138747-115138769 CATGCTGAGGAGATGTTTGCTGG - Intergenic
915164127 1:153939253-153939275 CAGTCTGAGGCAGTGGGTACAGG - Intronic
916440265 1:164817994-164818016 CACTCTGGGGAGTTGGGTGGGGG + Intronic
919923701 1:202181424-202181446 CATCCTGAGGAGCTGGGTGCAGG + Intergenic
923006803 1:230056702-230056724 CATTCTTAGGAGCTGTGTGCTGG - Intergenic
923263107 1:232286059-232286081 CAGCATGAGGAGATGGGTAATGG - Intergenic
923338177 1:232987370-232987392 CAGTCTGAGGAAATGGGTGCTGG + Intronic
923405994 1:233661140-233661162 CAGTCTGAGGAGGTAGGTTCTGG - Intronic
924482621 1:244451243-244451265 CAGTCGGAAGAGTTGGGAGCAGG + Intronic
1063025820 10:2178181-2178203 CAGTCAGAGAGGCTGGGTGCTGG - Intergenic
1063119193 10:3092859-3092881 CTGTCTGAGGAAAGGGGTGTGGG + Intronic
1063551772 10:7040671-7040693 GAGTCTGAGGAATTGGTTGCAGG + Intergenic
1065951774 10:30658944-30658966 CAGATTGTGGAGGTGGGTGCTGG + Intergenic
1066219459 10:33320864-33320886 GACTCTACGGAGATGGGTGCTGG + Intronic
1068816083 10:61314828-61314850 CAGTCTAAGGAGTTGGGATCTGG - Intergenic
1072751034 10:97979004-97979026 CTGAGTGAGGAGATGGGGGCAGG + Intronic
1073515842 10:104074850-104074872 CAGTGAGAAGAGATTGGTGCTGG - Intronic
1075321131 10:121492589-121492611 CATTGTGAGGGGATGGGTGTGGG + Intronic
1075717829 10:124567062-124567084 TGGCCTGAGGAGAGGGGTGCAGG + Intronic
1075877925 10:125823193-125823215 CAGTCTGAGGTGCGGGGTCCTGG - Exonic
1076406205 10:130213972-130213994 CAGGCTGGGGATCTGGGTGCTGG - Intergenic
1076510709 10:131012041-131012063 GAGTCTGGGGAAAAGGGTGCAGG - Intergenic
1076739932 10:132478089-132478111 CAGGCTGAGGAGAGGGGCCCTGG + Intergenic
1076801927 10:132834970-132834992 CGGGCAGAGGAGATGGGTGGGGG - Intronic
1077094924 11:795253-795275 CAGTCTGGGGTGGTGGGTGAGGG - Intronic
1077866224 11:6223774-6223796 CAGGCTCAGGAGGTGGCTGCAGG + Exonic
1078151014 11:8759738-8759760 GGGTCTGAGGAGATGTTTGCTGG - Intronic
1078368061 11:10722703-10722725 CAGCCTCAGGAAGTGGGTGCAGG + Intergenic
1078375717 11:10791763-10791785 GAGGCTGAGGAGAAGGGCGCCGG - Intergenic
1081601856 11:44500858-44500880 CATTCTGAGGTGGTGGGTGGGGG - Intergenic
1082556242 11:54566133-54566155 CAGTGTCAGAAAATGGGTGCAGG - Intergenic
1082789216 11:57335719-57335741 CAGCCTGAGGAGGTAGGTGGTGG - Exonic
1084126427 11:67102145-67102167 CATTTTGAGGATGTGGGTGCAGG - Intergenic
1085579783 11:77639911-77639933 CAGTCCCAGGAGATGGGGACGGG - Intergenic
1086412320 11:86554985-86555007 CAGCCTGAGGGGATGGGGGAGGG + Intronic
1089014374 11:115154430-115154452 CAATCTGAGGACCTGGGTCCTGG + Intergenic
1089681615 11:120121889-120121911 GGTTCTGAGGAGAGGGGTGCTGG + Intronic
1089732905 11:120530510-120530532 CAGGCTGAGGAGGTGGCTGTTGG + Intronic
1090532873 11:127609474-127609496 CTGTCTGGGTAGATGGGTGTGGG + Intergenic
1091222644 11:133938243-133938265 AAGCCTGAGGAGCTGGGAGCAGG - Intronic
1091227847 11:133968396-133968418 TTGTCTGAGGATAGGGGTGCAGG + Intergenic
1092230343 12:6772608-6772630 CAGCCTGAGGAGGTGGGGGCGGG - Exonic
1093469564 12:19486143-19486165 TAGTCTGGGCAGATGGGTGGAGG - Intronic
1093900862 12:24630551-24630573 CAGTCCCAGGAGATGGGTGGAGG - Intergenic
1094426399 12:30321164-30321186 GAGTCGGAGGAGATGGCTGCAGG + Intergenic
1096038112 12:48490770-48490792 CAGTCAGAGATGATGGGGGCTGG - Intronic
1096788076 12:54029220-54029242 CAGTCTGAGGAGAAGGGAGGGGG + Intronic
1096979827 12:55721939-55721961 CAGCCTGAGGTGAGGGGTACAGG + Exonic
1097388476 12:58979749-58979771 CAGACTGAGGAAATGGGCGCTGG + Intergenic
1098107618 12:67086311-67086333 CAGTGTAGGGAGATGGGTGTTGG + Intergenic
1101068075 12:101043861-101043883 CAGTGTGAGGAGCACGGTGCTGG + Intronic
1104364158 12:128161906-128161928 CAGTCAGAGGAGATGAGCACTGG + Intergenic
1104918100 12:132276501-132276523 CACTTTGAGGAGCTGGGAGCAGG - Intronic
1105230783 13:18493768-18493790 CAGTGTGGGGGGATGGGTGAGGG - Intergenic
1108339169 13:49479782-49479804 CAGACTGGGGAGATTGATGCCGG - Intronic
1110810557 13:79807496-79807518 CAGCCTGTGGAGATGGGGGTAGG - Intergenic
1111813981 13:93127397-93127419 GAGACTGGGGAGAAGGGTGCAGG + Intergenic
1112441241 13:99426436-99426458 CAGTGGCAGGAGAGGGGTGCAGG - Intergenic
1112634155 13:101196613-101196635 CAGTATGAGGAGAGGGGTACAGG + Intronic
1113983525 13:114295830-114295852 AGGTCTGAGGAGCTGTGTGCAGG - Intronic
1115517203 14:34197854-34197876 GAGACTGAGGAGATGGTTTCAGG + Intronic
1119330721 14:73791443-73791465 AAGTCTGAGGAGAGGGGTTATGG + Intergenic
1121451422 14:94010703-94010725 CAGTCTGAGAAGGTGGCTGGGGG + Intergenic
1121712720 14:96051511-96051533 CATGCTGAGGAGATGGATGAGGG - Intronic
1122827023 14:104375331-104375353 CAGGACGGGGAGATGGGTGCGGG + Intergenic
1122827047 14:104375402-104375424 CAGGACGGGGAGATGGGTGCGGG + Intergenic
1122827071 14:104375473-104375495 CAGGACGGGGAGATGGGTGCGGG + Intergenic
1123018860 14:105388258-105388280 CAGTGTGAGGAGACGGCGGCTGG - Intronic
1124023120 15:25941837-25941859 CAGTAGGTGGAGGTGGGTGCGGG - Intergenic
1124694588 15:31853492-31853514 CAGGTTCAGGAGGTGGGTGCTGG - Intronic
1125095581 15:35847036-35847058 ATGTCAGAGGAGATGGGTGGCGG - Intergenic
1125333598 15:38606016-38606038 CAGTCTGAGGACTGGGGTCCCGG - Intergenic
1127378448 15:58406775-58406797 CAGGCTGAGGAGATGGGGTGGGG - Intronic
1127388449 15:58486251-58486273 CAGCCTGAGGAGATGGGGGAGGG - Intronic
1127915578 15:63452272-63452294 CAGATTTAGGAGATGGGTGCTGG + Intergenic
1128516299 15:68344082-68344104 CAGCCTGAGGATATGGGGCCAGG + Intronic
1129389530 15:75213701-75213723 CAGTCTGAGGTGGTGGGGGCAGG + Intergenic
1129674919 15:77627358-77627380 GGGTCTGAGAAGCTGGGTGCTGG - Intronic
1131565858 15:93484756-93484778 TAGGCTGAGCACATGGGTGCAGG - Intergenic
1132623054 16:877017-877039 CTGTCTCAGGAGATGCGTGTCGG + Intronic
1133314434 16:4873768-4873790 CAGTCTGAGGAGATGGGTGCTGG + Intronic
1134686110 16:16159713-16159735 CAGTCTGAGGACCTGGGCCCAGG + Intronic
1135146724 16:19969128-19969150 CAGTCAGTGGAGATGGGAGGGGG + Intergenic
1135184756 16:20305900-20305922 CAGCCTGGGGTGAAGGGTGCAGG + Intergenic
1135857998 16:26029760-26029782 CAGTTCCAGGAGAAGGGTGCTGG + Intronic
1136071017 16:27787134-27787156 CTGTCTGTGGAGGTGGGTGGAGG + Intergenic
1136608440 16:31352094-31352116 GGGGCTGAGGAGATGGGTGACGG + Intergenic
1137350687 16:47711774-47711796 GAGTCTGAGAATATGGGTTCAGG + Intergenic
1138647311 16:58434711-58434733 TAGTCTGGAGGGATGGGTGCTGG - Intergenic
1139558894 16:67729394-67729416 GAGGATGAGGAGCTGGGTGCAGG + Exonic
1139853552 16:69964329-69964351 ATGTCTGAGGAGCTGGGTGAGGG - Exonic
1139882525 16:70187238-70187260 ATGTCTGAGGAGCTGGGTGAGGG - Exonic
1140060764 16:71567749-71567771 GAGTCTGAGGAAATGGTTGGGGG + Exonic
1140369984 16:74408266-74408288 ATGTCTGAGGAGCTGGGTGAGGG + Intronic
1140456818 16:75110494-75110516 CATTCTTAGGAGATAGATGCTGG + Exonic
1142005155 16:87686201-87686223 CAGTCCCAAGAAATGGGTGCAGG + Intronic
1142455344 16:90218043-90218065 AGGTCAGAGGAGATGGGGGCCGG + Intergenic
1142455360 16:90218114-90218136 AGGTCAGAGGAGATGGGGGCCGG + Intergenic
1142455377 16:90218185-90218207 AGGTCAGAGGAGATGGGGGCTGG + Intergenic
1142455395 16:90218260-90218282 AGGTCAGAGGAGATGGGGGCTGG + Intergenic
1143107506 17:4536935-4536957 AAGTCTGAGGTGGTGAGTGCAGG + Exonic
1143322549 17:6077535-6077557 TGGTCTGGGGAGGTGGGTGCTGG - Intronic
1143451941 17:7041905-7041927 AAGCCTGAGGAGATGGGTAAGGG + Exonic
1145977525 17:28992974-28992996 CAGTCTGAGGAACTGTGGGCAGG - Intronic
1147209879 17:38866751-38866773 CATTTTGTGGAGATGGGGGCAGG - Intergenic
1147260746 17:39208686-39208708 GAGTCTGGAGAGATGGATGCTGG - Intergenic
1147323890 17:39661258-39661280 CTGTCTGTGGAGATGGGGGGTGG + Intronic
1147445413 17:40472291-40472313 CAGGCTGGGGAGAAGGGTGCTGG - Intergenic
1147627730 17:41910673-41910695 CAGCCTCAGGACATGGGTCCGGG + Intronic
1147788770 17:42999548-42999570 CAGTCTCAGGAGATGGGAGAGGG - Intronic
1149656208 17:58310808-58310830 CTGTCTGGGGAGAGGGGAGCAGG - Intronic
1150003465 17:61455931-61455953 CTGTCTGAGGGGTTGGGTGAGGG + Intronic
1150130641 17:62666990-62667012 CAGTCTGGGGAGGGGGGTGGAGG - Intronic
1154522618 18:15246089-15246111 CAGTGTGGGGGGATGGGTGAGGG + Intergenic
1156465549 18:37346175-37346197 CAGTTGGAGGAGGTGGGGGCAGG - Intronic
1157090181 18:44627635-44627657 CAGTCTCAGGAGATGGGGCCTGG + Intergenic
1158999139 18:62955297-62955319 CATTCTGAGGAGTTTGGTGTCGG + Intronic
1160168264 18:76531976-76531998 GATTCTGAGAAGATGGGTTCAGG + Intergenic
1160667972 19:342160-342182 CAGACGGAGGAGTGGGGTGCTGG - Intronic
1161089546 19:2353093-2353115 ACGTCCGAGGAGATGGGGGCTGG + Exonic
1163528296 19:17834764-17834786 CAGTCTGGGGAGATTGGGGTGGG - Intronic
1164226428 19:23250132-23250154 CAGTTTGTGGAGATGACTGCGGG + Intronic
1165768996 19:38367612-38367634 GAGTGGAAGGAGATGGGTGCAGG + Intronic
1166307952 19:41945764-41945786 CACTTTGAGAAGATGGATGCTGG - Intergenic
926267877 2:11343686-11343708 CACTCTGGGGAGGTGGGTGGAGG - Intronic
927172981 2:20386170-20386192 GGGTCTGAGTTGATGGGTGCTGG + Intergenic
928370943 2:30739779-30739801 GAGTCTGAGGAGATGAGGGTAGG + Intronic
929028339 2:37626909-37626931 CACTCTGACGAGGTGGGTGTTGG - Intergenic
929666744 2:43839226-43839248 CAGTGTGAGGACATGGCCGCAGG + Intronic
931329568 2:61266619-61266641 CTGTCTGAGAAAGTGGGTGCTGG + Intronic
932447752 2:71791180-71791202 CAGCCTGTGGAGATGGCTGGGGG + Intergenic
932503466 2:72205544-72205566 CAGACTGAGGTGATAGGCGCTGG + Intronic
933846977 2:86334716-86334738 CAGCCTGAGCAGATGGGCTCTGG - Intronic
935199468 2:100843919-100843941 CAAACGGAGGACATGGGTGCTGG - Intronic
935756948 2:106283756-106283778 CAGTCTGAGAAGCTGGGTGGTGG + Intergenic
936112617 2:109677280-109677302 CAGTCTGAGAAGCTGGGTGGTGG - Intergenic
936457763 2:112688524-112688546 CAGAATGAGAAGATGGGTTCTGG - Intergenic
936538731 2:113332981-113333003 CAGACTGAGGTGTGGGGTGCAGG + Intergenic
938521904 2:132078942-132078964 CAGTGTGGGGGGATGGGTGAGGG + Intergenic
939557859 2:143698538-143698560 TAGTTTGAGAAGATGGGGGCAGG + Intronic
942777077 2:179594926-179594948 CATTCTGAGTAGCTGGGTACAGG + Intronic
944127053 2:196306033-196306055 TAGTATTAGGAGATGGGGGCAGG + Intronic
946156927 2:217813180-217813202 CAGACTGTAGAGATGGGGGCAGG + Intronic
947408004 2:229801195-229801217 CAGTCTGAGGAGATTGGGCTTGG - Intronic
947843148 2:233221759-233221781 CAGGCAGAGGAGATGGGAGAAGG - Intronic
948029057 2:234801421-234801443 CAGTTTGAGGAGAAGGGAGCAGG - Intergenic
948603251 2:239119439-239119461 CAGGCTGAGGACATGGGGACAGG + Intronic
949086825 2:242162769-242162791 AGGTCAGAGGAGATGGGGGCCGG + Intergenic
949086842 2:242162840-242162862 AGGTCAGAGGAGATGGGGGCCGG + Intergenic
949086859 2:242162911-242162933 AGGTCAGAGGAGATGGGGGCTGG + Intergenic
949086875 2:242162982-242163004 AGGTCAGAGGAGATGGGGGCCGG + Intergenic
949086894 2:242163057-242163079 AGGTCAGAGGAGATGGGGGCTGG + Intergenic
1169343918 20:4815390-4815412 TACTCTGGGGAGATGGGTGGTGG - Intronic
1169735102 20:8829327-8829349 CACACTGAGGAGATGGGAACTGG - Intronic
1170646769 20:18203408-18203430 CACTCTGAGGAGATGTCAGCAGG + Intergenic
1172274289 20:33671375-33671397 GTCTCTGAGCAGATGGGTGCGGG + Intronic
1172392367 20:34574595-34574617 CAGGCAGAGGAGAAGGGGGCCGG - Intronic
1172937361 20:38629703-38629725 AGGTGTGAAGAGATGGGTGCTGG - Intronic
1173859941 20:46276749-46276771 CTATCTGGGGAGATGGGTGTGGG + Intronic
1175406952 20:58741178-58741200 GAGTCTGAGAAGGTGGGTGCGGG - Intergenic
1175857839 20:62132247-62132269 CAGGCTGCGCAGATGAGTGCGGG + Intronic
1176267829 20:64219971-64219993 GAACCTGAGGAGGTGGGTGCAGG + Exonic
1176774775 21:13122121-13122143 CAGTGTGGGGGGATGGGTGAGGG - Intergenic
1178685604 21:34708285-34708307 AAGTGGGAGGAGATGGGTCCAGG + Intronic
1179176565 21:39011985-39012007 CAGTGTGGGGAGGTGGGTGCAGG + Intergenic
1180614494 22:17119067-17119089 CATTAGGAGGAGAGGGGTGCTGG - Exonic
1180783539 22:18534817-18534839 TGGTGGGAGGAGATGGGTGCAGG - Intergenic
1180958533 22:19751831-19751853 CAGTCTCAGGAGCTGGGTCCAGG - Intergenic
1181127106 22:20708868-20708890 TGGTGGGAGGAGATGGGTGCAGG - Intronic
1181240441 22:21474169-21474191 TGGTGGGAGGAGATGGGTGCAGG - Intergenic
1181495238 22:23283923-23283945 CAGCCTGGGGTGATGGGTGGGGG - Intronic
1182443923 22:30379536-30379558 CAGGCTGAGGACCGGGGTGCAGG + Exonic
950937505 3:16855122-16855144 TAGGCTGAGGTGATGGGTGAGGG - Intronic
953458662 3:43063890-43063912 CAGCCTGAGGAAATGGTTACGGG - Intergenic
954003074 3:47572950-47572972 CAGGCTGTGGAGATAGGTGTTGG - Intronic
954790054 3:53125755-53125777 TAGGCTGAGGAGAAGCGTGCAGG - Intronic
956665974 3:71642444-71642466 CAGTCTGAGGGAATGGGAGCTGG + Intergenic
960124154 3:113979793-113979815 CAGTCTGCTGAGATGAGTCCAGG - Intronic
962426632 3:135274504-135274526 CAGTGTGTGAAGATGGGTGTGGG + Intergenic
963167521 3:142220616-142220638 CATTCTGAGGAGAAGGGTAGAGG - Intronic
963956566 3:151260932-151260954 CAGTCTGGGGAGATGGAAACTGG - Intronic
964093906 3:152909369-152909391 CGGTCAGAAGAGCTGGGTGCTGG - Intergenic
964846596 3:161051110-161051132 CAGTCTGAGGAGATGGCGGGTGG - Intronic
965530464 3:169765518-169765540 CATTCTAAGGAGAAGGGGGCAGG - Intergenic
968506822 4:974561-974583 CAGTCTGAGGAGGGAGGAGCAGG + Intronic
968577839 4:1376217-1376239 CAGCCTGAGGAGGGGGCTGCCGG + Intronic
968607940 4:1544396-1544418 CATTCTGAGGTGCTGGGGGCTGG - Intergenic
968651260 4:1761152-1761174 CAGTGACAGGAGATGGGGGCGGG - Intergenic
968691036 4:1990313-1990335 CAGGCTGAGGAAATGGATGTGGG - Intronic
969479703 4:7441402-7441424 CAGCCTGATGAGCTGGGTGAGGG + Intronic
969663009 4:8541241-8541263 CAGTCTCTGGAGTGGGGTGCTGG - Intergenic
969680705 4:8641821-8641843 CTTTGTGAGGTGATGGGTGCAGG - Intergenic
969827526 4:9769302-9769324 CAGCCTGAGGAGATGCTTGGTGG + Intergenic
971221999 4:24717051-24717073 GAGTCTGAGGCCATGAGTGCTGG + Intergenic
975147114 4:70980618-70980640 CACTCTGTGGGGAGGGGTGCAGG - Intronic
976207892 4:82639639-82639661 CAGGCTGAGGACCTGGGAGCTGG + Intronic
978075265 4:104520970-104520992 GAATCAGAGGTGATGGGTGCAGG - Intergenic
980819801 4:137999366-137999388 CAGGATGAGAAAATGGGTGCTGG + Intergenic
981527448 4:145720585-145720607 CAGTGTGGGGAGATGAGTGGAGG - Intronic
982684980 4:158477301-158477323 AAGTCTGAAGAGATGTGTGAGGG - Intronic
983296112 4:165871534-165871556 TAGTCTAAGGAGATGTTTGCAGG + Intergenic
985194842 4:187418768-187418790 CAGTATGAGAAAATGGGTGAAGG - Intergenic
985955517 5:3262691-3262713 CAGTCAGAGGAGCTGTGGGCCGG + Intergenic
986163084 5:5249063-5249085 GAGTCTGAGGTGATGGCTGAAGG + Intronic
986350247 5:6871078-6871100 CTCTGTGAGGAGATGGATGCAGG - Intergenic
986644012 5:9898783-9898805 CTGTCTGTGGACAGGGGTGCAGG - Intergenic
989676921 5:43983224-43983246 CTGTATGAGGACATAGGTGCAGG + Intergenic
995784890 5:115816986-115817008 GGGTCGGAGGAGATGGCTGCGGG + Intergenic
996074173 5:119169866-119169888 CAGACTGAGGAGAAGTGTTCAGG + Intronic
998216780 5:140243469-140243491 CAATCAGAAGAGATGGGGGCAGG - Exonic
999319798 5:150606850-150606872 CAGGCTCAGGAGTTGGGGGCAGG - Intronic
999371051 5:151055625-151055647 CAGTATGAGGAGAGGTGTGGGGG - Intronic
1000340256 5:160271536-160271558 CAGTCTGCAGAGATGGGAACAGG + Intronic
1001233035 5:170006170-170006192 CAGTCTGAGGGGATGTGGACAGG + Intronic
1002605716 5:180381625-180381647 CAGGCTGGGGCGATGGGAGCAGG + Intergenic
1004079049 6:12372813-12372835 CAGTAAGAGTAGATGAGTGCTGG + Intergenic
1004479771 6:16007469-16007491 GAGTGTGATGGGATGGGTGCAGG - Intergenic
1005102483 6:22187445-22187467 CAGACTTAGGAGATGGGTGAGGG - Intergenic
1006388304 6:33744633-33744655 CTGGGTGAGGAGGTGGGTGCTGG - Intronic
1006741352 6:36311300-36311322 CAGACTGAGGATAAGGGTGTGGG + Intergenic
1006795679 6:36730851-36730873 CATTCTGAGGAAATGGGTCAGGG + Intronic
1007739187 6:44000719-44000741 CAGTCAAAGGAGAAGGGGGCAGG + Intronic
1008074260 6:47129384-47129406 CAGTCAGAATAGATGGGAGCAGG + Intergenic
1008862162 6:56161919-56161941 GAGTTTTAGGAGATGAGTGCGGG - Intronic
1011166857 6:84458140-84458162 CAGTCAGAGGAGCTGGGTTCAGG + Intergenic
1012553932 6:100489742-100489764 CAGCCTGAGGAGATGCCTGTGGG + Intergenic
1015340884 6:132099149-132099171 GAGTCTGAGGAGATGGCTGGGGG + Intergenic
1015897934 6:138035019-138035041 CAATCTGAGAAGATGTGGGCAGG - Intergenic
1016802780 6:148183428-148183450 CAGTGTGAGGAGATGGCTACGGG - Intergenic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018151006 6:160939810-160939832 CAGTCTGAGGACATGGCAGGGGG - Intergenic
1018750341 6:166798765-166798787 CTGTCTGTGGAGAAGGGGGCAGG - Intronic
1019324576 7:431952-431974 CAGTCTGGGGAAGCGGGTGCCGG - Intergenic
1020212796 7:6168441-6168463 GAGGCAGACGAGATGGGTGCAGG - Intronic
1020219182 7:6221610-6221632 CAGTGTGAGGAAATGAGTGAAGG + Intronic
1020408811 7:7867625-7867647 CAGACTCAGTAGAGGGGTGCAGG + Intronic
1020679101 7:11214856-11214878 CATTCTGAAGAGAAGGGTGGTGG - Intergenic
1023050572 7:36247676-36247698 CAGTCTGCTGTGATGGGTCCTGG - Intronic
1024016800 7:45324710-45324732 CAATCTCAGGAGTTGGGTGACGG + Intergenic
1024116352 7:46197412-46197434 CTGACTGAGGAGGTGGGAGCAGG - Intergenic
1026959480 7:74399239-74399261 CAGTGTAAGAAGAAGGGTGCTGG + Intronic
1029218301 7:98968390-98968412 TAGTGTGAGGAGTCGGGTGCTGG + Intronic
1029858634 7:103545234-103545256 CAGTGTGAGGAGATGTGTAATGG - Exonic
1032076938 7:128840529-128840551 CCCTCTGAGGAGATGGGGGCAGG - Exonic
1033213880 7:139480350-139480372 CAGGCTGAGGGGGTGGGTGCTGG - Intronic
1034116106 7:148585383-148585405 CAGTCTGAAGATATGGCTTCAGG + Intergenic
1034413920 7:150955295-150955317 CAGGCTGGGGAGAGGGCTGCTGG - Intronic
1035039835 7:155919659-155919681 CAGCCTGAGGGCCTGGGTGCAGG + Intergenic
1035162513 7:156961374-156961396 CAGTCTGAAGAGGAGGGGGCTGG + Intronic
1035497832 8:68283-68305 AGGTCAGAGGAGATGGGGGCTGG - Intergenic
1035497850 8:68358-68380 AGGTCAGAGGAGATGGGGGCTGG - Intergenic
1035497867 8:68429-68451 AGGTCAGAGGAGATGGGGGCCGG - Intergenic
1035497884 8:68500-68522 AGGTCAGAGGAGATGGGGGCCGG - Intergenic
1036229005 8:6983734-6983756 CACTCTGAGGAGCTGGGAGGTGG - Intergenic
1036231458 8:7002839-7002861 CACTCTGAGGAGCTGGGAGGTGG - Intronic
1036233915 8:7021933-7021955 CACTCTGAGGAGCTGGGAGGTGG - Intergenic
1036722040 8:11185089-11185111 CAGTCTAAGGACATGGGTGCGGG + Intronic
1037473818 8:19237341-19237363 CGGTGGGAGGAGTTGGGTGCAGG + Intergenic
1038421999 8:27439453-27439475 CAGGCTAAGGGGGTGGGTGCAGG + Intronic
1039389054 8:37162470-37162492 CAGTCAGAGGAGGTAGGTGAGGG - Intergenic
1039798265 8:40933443-40933465 CAGTCTATTGATATGGGTGCCGG + Intergenic
1040498901 8:47990505-47990527 CAGTCGCAGGTGATGGGTGCAGG + Intergenic
1042174830 8:66028695-66028717 CTGGCTGAGGTGATGGGTTCGGG - Intronic
1042518179 8:69681767-69681789 GAGTCTGTGAAGATGGGTGATGG - Intronic
1042526473 8:69769722-69769744 CAGGCTGGGGAGATGGGAGTTGG + Intronic
1043469866 8:80551446-80551468 CAGTCTGATGATGTGGGTGTGGG + Intergenic
1044918156 8:97137977-97137999 CAGTCTGAGGAGAAGTGAGAGGG - Intronic
1046515890 8:115260045-115260067 CAGGCTGTGAAGATGAGTGCTGG - Intergenic
1047650530 8:126915434-126915456 CAGTCAGAGGACCTGGGTCCAGG - Intergenic
1049779810 8:144423750-144423772 GAGTCTGAGGCGATGGCTCCTGG - Exonic
1050017990 9:1255776-1255798 CATTTTGAGGAGATGAGTGTGGG + Intergenic
1051367014 9:16328479-16328501 CAGTCTGAGGACTAGGGCGCTGG - Intergenic
1055922862 9:81479806-81479828 CTGGATGAGGAGATGGGTGGAGG + Intergenic
1057805393 9:98216309-98216331 CCGACTGAGGGGGTGGGTGCAGG - Intronic
1058868215 9:109180683-109180705 CAGTCTTACGAGATGGATGATGG - Intronic
1059431590 9:114253881-114253903 CAGTTTCAGGAGCTGGGTGAAGG + Intronic
1059450737 9:114370257-114370279 GAGTCTGAGCAGATGGCTGAGGG - Intronic
1060047923 9:120355120-120355142 CAGTCTGAGGGGCTGCGTTCAGG - Intergenic
1060394403 9:123305390-123305412 GAGTTTGAGGAGCTGGGTGGGGG + Intergenic
1060552264 9:124491257-124491279 CAGTCAGAGGACGTGGGTCCGGG + Intronic
1061510574 9:131058564-131058586 CTGTCTGAGAAGAAGGCTGCTGG + Intronic
1061531682 9:131218926-131218948 CAGGCTCAGAAGGTGGGTGCAGG - Intronic
1062474860 9:136721902-136721924 CACACTGAGGAGACAGGTGCAGG - Exonic
1186171586 X:6882837-6882859 ATGTCTGAGGTGATGGGTCCAGG + Intergenic
1189095509 X:38134540-38134562 CAGGCTGAGGAGTGGGCTGCTGG + Intronic
1195221796 X:102751513-102751535 CAGTGTGGTGAGATGGGTTCTGG - Exonic
1195492116 X:105483093-105483115 CAGTGTGTGGGGATGGGTGGTGG - Intronic
1198672517 X:139096235-139096257 AAGTCTGAGGGAATGTGTGCTGG + Intronic
1199685959 X:150265952-150265974 GATACTGGGGAGATGGGTGCTGG - Intergenic
1199786597 X:151111942-151111964 CAGTGTGGGGGAATGGGTGCTGG + Intergenic