ID: 1133316250

View in Genome Browser
Species Human (GRCh38)
Location 16:4885809-4885831
Sequence CTCTCCTCCAGCACGGGATC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 128}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133316247_1133316250 -4 Left 1133316247 16:4885790-4885812 CCGCTGCAGCTGCTGGAAGCTCT 0: 1
1: 1
2: 2
3: 51
4: 414
Right 1133316250 16:4885809-4885831 CTCTCCTCCAGCACGGGATCCGG 0: 1
1: 0
2: 1
3: 7
4: 128
1133316244_1133316250 9 Left 1133316244 16:4885777-4885799 CCTCTGCCAGCGTCCGCTGCAGC 0: 1
1: 0
2: 2
3: 20
4: 256
Right 1133316250 16:4885809-4885831 CTCTCCTCCAGCACGGGATCCGG 0: 1
1: 0
2: 1
3: 7
4: 128
1133316245_1133316250 3 Left 1133316245 16:4885783-4885805 CCAGCGTCCGCTGCAGCTGCTGG 0: 1
1: 0
2: 1
3: 28
4: 347
Right 1133316250 16:4885809-4885831 CTCTCCTCCAGCACGGGATCCGG 0: 1
1: 0
2: 1
3: 7
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133316250 Original CRISPR CTCTCCTCCAGCACGGGATC CGG Exonic
904605868 1:31697245-31697267 CCCTCCTCCAGCACGAGCTCCGG + Exonic
905647696 1:39635828-39635850 CTCCCTTCCAGCCCGCGATCTGG + Intronic
907222261 1:52915551-52915573 CTCTCCTGGAGCACTGGAGCTGG - Intronic
915901509 1:159850004-159850026 CTCTCCTCCAGCACTGAACAAGG + Intronic
1062768236 10:81184-81206 CACTCCCCCAGCACAGGGTCTGG + Intergenic
1064122917 10:12634977-12634999 CTCTCTTCCAGCACAGTATATGG - Intronic
1068705494 10:60071094-60071116 CCCTCCTCCACCACTGGATGCGG - Exonic
1072122619 10:92417687-92417709 CTCTCCTTCAGCATAGGATAGGG - Intergenic
1072240353 10:93490038-93490060 CTCTCCTGCAGCAGGAGAACTGG + Intergenic
1073146391 10:101284553-101284575 CTCGCCTCCAGCCCGGGGTAAGG + Intergenic
1075578326 10:123597059-123597081 CTTTCCTCTAGCACCAGATCAGG + Intergenic
1076499589 10:130926919-130926941 CTCACCTCCAGCACTGGTGCAGG - Intergenic
1077192062 11:1259700-1259722 CTCTCCTCCAGCACATGCCCCGG - Intronic
1077496934 11:2891004-2891026 CCCTGCTCCAGAACGGGACCAGG + Intronic
1083661819 11:64254934-64254956 TTCTCCTCCAGCCGGGCATCGGG - Exonic
1091235707 11:134020796-134020818 CTCTCCTCCACCGCGGGGTTAGG + Intergenic
1097167755 12:57094653-57094675 CCCTCCACCAGCGCGGGATGGGG - Exonic
1098878240 12:75889442-75889464 CTCTCTTCAGGCACGTGATCGGG + Intergenic
1102238250 12:111308229-111308251 CTCTCCTCCAGCCCGGGGGCTGG + Intronic
1104170559 12:126276157-126276179 CTCTCCTCCAAGCTGGGATCTGG + Intergenic
1104374527 12:128252122-128252144 CTCTCCTGCAGCCAGGGTTCTGG - Intergenic
1106157223 13:27170955-27170977 CTTTCCCCCAGCGCGGGGTCGGG + Intronic
1106242159 13:27920872-27920894 TCCTCCTCCAGCAGGGGATCCGG + Intronic
1106404120 13:29458916-29458938 CTCTGCTCCACAACGGCATCAGG + Intronic
1107865127 13:44695954-44695976 CTCTGCTCCAGCACTGGGGCTGG - Intergenic
1111735756 13:92137446-92137468 CTCTCCTCCAATACAGGATTGGG + Intronic
1113957279 13:114105517-114105539 CCCTCCTCCAGCACGGGGACAGG + Intronic
1119603698 14:75996013-75996035 TTCTCCGCCAGCACTGGCTCTGG + Intronic
1122777983 14:104131247-104131269 CTCCCCTCCAACACGGGATCTGG - Intergenic
1123705516 15:22948090-22948112 CCCTCCTCCAGCACTGGCGCAGG + Intronic
1124871908 15:33552129-33552151 TTTTCTTCCAGCACAGGATCAGG + Intronic
1124919632 15:34013561-34013583 CTGACTTCCAGCACTGGATCAGG + Intronic
1129749576 15:78052069-78052091 CTCTCCCCCAGCTCTGGCTCTGG + Intronic
1130844562 15:87732923-87732945 TTCACCTCCTGCATGGGATCTGG - Intergenic
1132497901 16:272574-272596 CTCTTCTCCAGAACAGTATCAGG - Intronic
1133316250 16:4885809-4885831 CTCTCCTCCAGCACGGGATCCGG + Exonic
1133791642 16:9013570-9013592 CTCTGCTCCAGCACGAGGCCTGG - Intergenic
1139484015 16:67246282-67246304 CTCTTCTCCAGCACTGGAGGCGG + Intronic
1140070699 16:71647487-71647509 CTCTCCTCCAGCATAGGAGAAGG + Exonic
1146932863 17:36790520-36790542 CTCTCCTCAAGCACAGGCCCTGG - Intergenic
1149992794 17:61392155-61392177 CCCTCCTCCAGCAGGGGAGGGGG - Exonic
1150930231 17:69576784-69576806 CCTTCCTCCAGCAAGGGTTCTGG - Intergenic
1151026043 17:70678183-70678205 CTCTTCTCCAGCACCAGTTCAGG + Intergenic
1151493417 17:74445747-74445769 CTTTCCTCCAGCATAGGAGCCGG + Intronic
1152961124 18:80681-80703 CACTCCCCCAGCACAGGACCTGG + Intergenic
1153416227 18:4849028-4849050 CTCTCCTAAAGCACAGGATGAGG + Intergenic
1157794265 18:50560085-50560107 CGCTGCTCCAGCTCGGGCTCCGG - Exonic
1160054674 18:75467263-75467285 CTTTCCTCCAGCACAGGGGCTGG + Intergenic
1160870258 19:1274690-1274712 CTCTCCTGGAGCACGGGCTGCGG + Intronic
1161011552 19:1961626-1961648 CTCTCTTCCAGCACAGGGACTGG - Intronic
1161354179 19:3810108-3810130 CACCACTCCAGCACGGGATGGGG + Intronic
1161578265 19:5066746-5066768 CGCATCTCCAGCCCGGGATCTGG - Intronic
1163506028 19:17706801-17706823 GTCGCATCCAGCTCGGGATCTGG + Intergenic
1165099329 19:33429180-33429202 CTCTCCTCCAGCAGGGATGCAGG - Intronic
1167308840 19:48724579-48724601 CTATCCTTCAGCCTGGGATCTGG + Intronic
929571993 2:43028489-43028511 ATCTCCTTCAGCACGGGCTGAGG - Intergenic
929686555 2:44040052-44040074 CTCCCCTCCATCACTGGTTCAGG - Intergenic
931872924 2:66481106-66481128 CCCTCCTGCTGCAGGGGATCAGG - Intronic
932059971 2:68486564-68486586 CTCTGCTCCAGCATAGGTTCTGG + Intronic
933818537 2:86088663-86088685 CTGTCCTCCTGCACAGGACCGGG - Exonic
936597733 2:113865412-113865434 CTCTCATCCATCACTGGTTCAGG + Intergenic
937366073 2:121262579-121262601 CTCCCCTGCAGCGTGGGATCCGG + Intronic
937681760 2:124651934-124651956 CTCGGCTCCAGCAAGGGCTCTGG + Intronic
945792204 2:214318859-214318881 CTCTACTTCAGCTCGGGTTCTGG - Intronic
947870732 2:233436454-233436476 CTCCCCTCCAGCCCGGGCGCAGG - Intronic
949041683 2:241852543-241852565 GTCCCCTCCTGCACAGGATCAGG - Intronic
1169415841 20:5415530-5415552 ACCTGCTCCACCACGGGATCAGG + Intergenic
1174398847 20:50264937-50264959 CCCTCCTCCCGCTGGGGATCCGG - Intergenic
1174958933 20:55133446-55133468 CTCTCCTCCAACCAAGGATCAGG - Intergenic
1175108111 20:56628731-56628753 CTCTCCTCCCGCCCGGGGGCCGG + Intergenic
1175947756 20:62566596-62566618 CTCCCCTCCAGGACAGGACCAGG - Intronic
1176113605 20:63421735-63421757 TCCTCCTCCAGCACGGGGGCAGG + Intronic
1179795967 21:43783728-43783750 CTCTCATCCTGCACGGGCACTGG + Intergenic
1180911754 22:19455642-19455664 CTCTCCTCCAGGACAGGAGGAGG - Intronic
1183049165 22:35246673-35246695 CACTCCTCCAGCACCCCATCTGG + Intergenic
1184161675 22:42700837-42700859 CTTTCCTCCGGCAGGGGAACTGG + Intronic
1184198257 22:42946712-42946734 CTCTCGTCCAGCTGGGGATCAGG + Intronic
1184795973 22:46732730-46732752 CTCTCAACCAGCAAGGGATGGGG - Intronic
1185144669 22:49124858-49124880 CTCTCCTGAAGCACAGGATGAGG - Intergenic
950425429 3:12922601-12922623 CTCTCCTTCTGCACGGGGTTGGG + Intronic
954904351 3:54047148-54047170 CTCTCCACCAGCACTGACTCAGG - Intergenic
955019470 3:55105343-55105365 CTCCCCTCCAGCATGGGAGCTGG + Intergenic
959382600 3:105659590-105659612 CTCTACTACAGCACAGGCTCTGG + Intronic
960947561 3:122977271-122977293 TCCTCCTCCAGCACGGAGTCAGG - Intronic
961592409 3:127990713-127990735 CTCTCCTCCAGAAGGCGAGCTGG - Intergenic
962927427 3:140007835-140007857 CTCTCCTCCACCACCGGACAAGG - Intronic
963919011 3:150888068-150888090 CTGTACTCCAGCCCGGGAGCCGG + Intronic
965532736 3:169790843-169790865 CACTCCTTCAGCACAGGATATGG - Intergenic
969177415 4:5409193-5409215 CTCTCTTGCAGCAAGGGTTCTGG - Intronic
970381017 4:15507971-15507993 CTCTCCTAAAGCACAGGATGAGG - Intronic
980649750 4:135696918-135696940 CTCTCCTCTAACATGGCATCTGG - Intergenic
981986157 4:150859616-150859638 CTCTCCTCCAGCAGCTGAACTGG - Intronic
983037148 4:162881082-162881104 CTCTCCTAAAGCACAGGATGAGG + Intergenic
985630937 5:1013666-1013688 CTGTCCTGCAGCAGGGGCTCTGG + Intronic
988306411 5:29499350-29499372 CTCTCCTCCAGCTGGAGTTCTGG + Intergenic
988530464 5:32022989-32023011 CACTCCTGCAGCACAGGCTCTGG - Intronic
991298182 5:65103067-65103089 CTCTCCTCCCGCTCGGGCCCGGG - Intergenic
994261543 5:97665248-97665270 CTCTCTTCCACCATGGCATCAGG + Intergenic
994291942 5:98037176-98037198 CTCTCCTCCATCACTGAATGTGG - Intergenic
995575737 5:113531230-113531252 CTCTCATCCATCACTGGGTCAGG - Intronic
997950986 5:138242273-138242295 CTCCCCTCCACCACGGCAGCCGG - Intergenic
1000002930 5:157157250-157157272 CTCTACTCCAGCAGGAGATGGGG + Intronic
1001879820 5:175233631-175233653 CTGACCTCCAGCACAGGGTCTGG + Intergenic
1001960601 5:175878508-175878530 TTCTCCTCCAGCAGGGCATTGGG + Intronic
1007632779 6:43282143-43282165 CCCTTGTCCAGCACAGGATCTGG + Intronic
1014538664 6:122648223-122648245 CTCTCCACCAGCACAGCATAAGG + Intronic
1017906038 6:158758069-158758091 CTCTCTCCCAGTCCGGGATCTGG - Intronic
1023054829 7:36283201-36283223 CTCTCCTCCAGAACAGCAGCCGG - Intronic
1023778592 7:43634610-43634632 CACTGCTCCAGCAGGGGATGGGG + Intronic
1026777384 7:73239172-73239194 CTCTCCTCCAACACAGGCCCTGG - Intergenic
1027018234 7:74792544-74792566 CTCTCCTCCAACACAGGCCCTGG - Intergenic
1027069793 7:75153374-75153396 CTCTCCTCCAACACAGGCCCTGG + Intergenic
1032001396 7:128267768-128267790 CTAGCCTCCAGCAAGGGATTTGG - Intergenic
1032803621 7:135335743-135335765 CCCTCCTCCAACAAGGGATGGGG - Intergenic
1034036849 7:147833821-147833843 CTCTCCTACAGCACAGGGACTGG - Intronic
1034742638 7:153492834-153492856 ATCTCCTCCAACAGGGGATGAGG - Intergenic
1035254993 7:157620684-157620706 CTTTCCTCCAGCACGGGCCTGGG - Intronic
1037768700 8:21786856-21786878 CCCTCCTGCAGTAGGGGATCTGG - Intronic
1038010203 8:23469503-23469525 CTCTTCCCCAGCAGGGGAGCAGG - Intergenic
1040384645 8:46906131-46906153 GTCCCCTCCAGCCTGGGATCTGG + Intergenic
1041233132 8:55773189-55773211 CGCTTCTCCAGCCCGGCATCGGG - Exonic
1044885063 8:96767977-96767999 CTCACCTCCAGCCTGGGATGTGG + Intronic
1047955222 8:129969657-129969679 CTTTCCTTCAGCACTGGATTTGG + Intronic
1048009222 8:130443186-130443208 CTCGCCTCCAGCTCGGGAGAGGG - Intronic
1051893617 9:21967183-21967205 CAGTGCTCCAGCACGGGATGAGG + Exonic
1055631897 9:78233220-78233242 CTCTCCTCCTTCAGGGGATCTGG - Intergenic
1055797594 9:79992165-79992187 CTCTCCTCCAGCATGATAGCAGG + Intergenic
1055999979 9:82205039-82205061 CTCTCTTCCAGCCGGGTATCAGG + Intergenic
1057178485 9:93016267-93016289 CTGTCCTCCTGCACCGGAGCCGG + Intronic
1062737037 9:138143305-138143327 CACTCCCCCAGCACAGGACCTGG - Intergenic
1187492419 X:19764467-19764489 CTCTACTCCATCATGGGACCTGG + Intronic
1193880001 X:86910337-86910359 ATCTCATCCAGCACTGGAGCAGG + Intergenic
1193997510 X:88384609-88384631 CTCTCCTCCTGCACCAGTTCTGG - Intergenic
1196808009 X:119605875-119605897 CACTGCTCCAGCACTGGCTCGGG + Exonic
1199334382 X:146600983-146601005 CTCTCCTCAAGCAGGGGAAAGGG + Intergenic
1201787310 Y:17799321-17799343 CCCTCCTCCAGCCCAGGATTGGG - Intergenic
1201814243 Y:18106667-18106689 CCCTCCTCCAGCCCAGGATTGGG + Intergenic