ID: 1133317015

View in Genome Browser
Species Human (GRCh38)
Location 16:4891179-4891201
Sequence CCTCATGACCAGACAGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 166}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133317015_1133317019 4 Left 1133317015 16:4891179-4891201 CCTGCCACTGTCTGGTCATGAGG 0: 1
1: 0
2: 1
3: 13
4: 166
Right 1133317019 16:4891206-4891228 GGCAAAAGCAAGTCGTGAGATGG 0: 1
1: 0
2: 0
3: 8
4: 158
1133317015_1133317021 18 Left 1133317015 16:4891179-4891201 CCTGCCACTGTCTGGTCATGAGG 0: 1
1: 0
2: 1
3: 13
4: 166
Right 1133317021 16:4891220-4891242 GTGAGATGGGAGTGTGAATAAGG 0: 1
1: 1
2: 0
3: 16
4: 283
1133317015_1133317022 19 Left 1133317015 16:4891179-4891201 CCTGCCACTGTCTGGTCATGAGG 0: 1
1: 0
2: 1
3: 13
4: 166
Right 1133317022 16:4891221-4891243 TGAGATGGGAGTGTGAATAAGGG 0: 1
1: 0
2: 1
3: 24
4: 265
1133317015_1133317020 5 Left 1133317015 16:4891179-4891201 CCTGCCACTGTCTGGTCATGAGG 0: 1
1: 0
2: 1
3: 13
4: 166
Right 1133317020 16:4891207-4891229 GCAAAAGCAAGTCGTGAGATGGG 0: 1
1: 0
2: 0
3: 8
4: 94
1133317015_1133317024 27 Left 1133317015 16:4891179-4891201 CCTGCCACTGTCTGGTCATGAGG 0: 1
1: 0
2: 1
3: 13
4: 166
Right 1133317024 16:4891229-4891251 GAGTGTGAATAAGGGGCCTCAGG 0: 1
1: 0
2: 0
3: 16
4: 122
1133317015_1133317023 20 Left 1133317015 16:4891179-4891201 CCTGCCACTGTCTGGTCATGAGG 0: 1
1: 0
2: 1
3: 13
4: 166
Right 1133317023 16:4891222-4891244 GAGATGGGAGTGTGAATAAGGGG 0: 1
1: 0
2: 0
3: 28
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133317015 Original CRISPR CCTCATGACCAGACAGTGGC AGG (reversed) Intronic
900080920 1:856779-856801 CCACCTGACCTGAGAGTGGCGGG - Intergenic
902290324 1:15431020-15431042 CCACAAGGCCACACAGTGGCCGG + Intergenic
902587722 1:17451143-17451165 CCTCGTCATCAGACAGTGGCAGG + Intergenic
905960913 1:42041361-42041383 CCTCATGCAGAGGCAGTGGCCGG - Intergenic
906939950 1:50247337-50247359 GCTCTGGTCCAGACAGTGGCTGG - Intergenic
907334820 1:53693260-53693282 CCCCATGTCAAGTCAGTGGCAGG + Intronic
915589313 1:156861566-156861588 CCTCATAACAAGAAAGTGGGCGG - Intronic
916059442 1:161088735-161088757 CCTGATGCCCAGAGAGTGGATGG - Intronic
917431705 1:174976113-174976135 CCTTTTGACCAAACAGAGGCTGG + Intronic
920176876 1:204107595-204107617 CCTCAAGACCAGACAGGGCAGGG + Intronic
920845308 1:209588624-209588646 CCTCATGACCCCACACTGGCCGG - Intronic
921878473 1:220226524-220226546 CATGATGACAAGATAGTGGCTGG - Intronic
922093729 1:222422960-222422982 CCTCATGGCCACACTCTGGCTGG + Intergenic
924486333 1:244487359-244487381 CATCATGCCCAGCCAGTGGAGGG + Intronic
1063038454 10:2313208-2313230 CCTCATGACTCGACAGGGTCAGG - Intergenic
1064033111 10:11895237-11895259 CCCCATGACCAGCGAGAGGCGGG + Intergenic
1064156349 10:12906337-12906359 GCTCATGCCCAGGCTGTGGCGGG + Intronic
1067693909 10:48522160-48522182 CCTCCCTGCCAGACAGTGGCTGG + Intronic
1069406327 10:68103602-68103624 CTTCATGATAAGACAGTGGAGGG + Intergenic
1075270628 10:121046646-121046668 CTTCATAGCCAGAAAGTGGCAGG - Intergenic
1075804464 10:125175566-125175588 CCTCATGAGTAGGCAGAGGCTGG - Intergenic
1076557106 10:131333653-131333675 CCTCATGAATAGCCAGTGCCTGG - Intergenic
1079351001 11:19691971-19691993 CCACCTGGCCAGACAGTGGCAGG - Intronic
1080412453 11:32038623-32038645 CATTATGACCAGACAGTCGGGGG - Intronic
1080830361 11:35888291-35888313 CACCATGCCCAGCCAGTGGCTGG - Intergenic
1080841228 11:35985263-35985285 CCACAGAACCAGACAGTGGAAGG - Intronic
1081658352 11:44872902-44872924 ATCCATGACCAGGCAGTGGCAGG + Intronic
1081775531 11:45673758-45673780 CCTCATGACCAGGCCTGGGCTGG - Intergenic
1081854117 11:46293335-46293357 CCTCCTGCCCAGACAGTGCCTGG + Intronic
1082848419 11:57744451-57744473 CTTCCTGACCATCCAGTGGCTGG + Exonic
1086177721 11:83912506-83912528 CATCAAGAACACACAGTGGCAGG + Intronic
1089002885 11:115067040-115067062 CCTCAGGAGCAGACAGTGTACGG - Intergenic
1090383872 11:126345328-126345350 CCTCCTGATGAGACAGGGGCAGG - Exonic
1091236931 11:134028452-134028474 CCTAAGGAGCAGACAGTGTCGGG - Intergenic
1091882236 12:3989344-3989366 TCTCCTGACCAGACAGAGGAAGG + Intergenic
1092577155 12:9798246-9798268 CCTCCTGACCACACAGTAGCAGG - Intergenic
1098891499 12:76014096-76014118 CCTCATGAAAAGAGAGTGGCCGG - Intergenic
1102452465 12:113052208-113052230 CCCCATCACCAGGCAGAGGCTGG - Intergenic
1103747029 12:123131895-123131917 CCTCAGGACCAACCAGAGGCAGG + Intronic
1104031290 12:125066963-125066985 CCTCCTCACCAAACAGTGGTTGG + Intronic
1105677428 13:22687325-22687347 GCCCAGGACCAGTCAGTGGCAGG - Intergenic
1105798818 13:23884777-23884799 CCTCATGCCTAGACAGTGTCTGG + Intronic
1105994199 13:25654602-25654624 TTTCATCACCAGACAGTGGGCGG + Intronic
1106029620 13:25988320-25988342 CCTCATTACCAGAGAGTTGGGGG - Intronic
1106481864 13:30143043-30143065 CCTTCAGACCAGACAGCGGCCGG + Intergenic
1111665830 13:91266947-91266969 GCTTGTGACCAGACAGTGACTGG - Intergenic
1113325189 13:109274733-109274755 TCTCATGACAAGCCAGTGCCAGG - Intergenic
1114473197 14:22977809-22977831 CCTCCTGAGCTAACAGTGGCAGG + Intronic
1118870153 14:69734575-69734597 CCTCATGACTAGAAAGAGGCTGG - Intronic
1119483374 14:74973615-74973637 CCTCATGCCCAGTCAGTAACAGG - Intergenic
1122804786 14:104250775-104250797 CCTCCTGACCATGCAGGGGCTGG - Intergenic
1124582884 15:30977088-30977110 CTTTATGACCATACAGTGCCTGG - Intronic
1128078646 15:64843271-64843293 ACTCCTGGCCTGACAGTGGCCGG + Intronic
1130351119 15:83092601-83092623 CCTCATGACTACCCACTGGCTGG + Intergenic
1133317015 16:4891179-4891201 CCTCATGACCAGACAGTGGCAGG - Intronic
1136398615 16:30006032-30006054 CCTCATGAGCAGACAGACCCGGG + Exonic
1136514789 16:30761710-30761732 CCTCATTCCCAAAAAGTGGCTGG + Exonic
1139433489 16:66923679-66923701 CCCCATGGCCATGCAGTGGCCGG + Exonic
1140137832 16:72223511-72223533 CCTTATGACCAGTCAGTGGCTGG + Intergenic
1140881922 16:79206210-79206232 CCTCATGGCCAGACATGGCCTGG + Intronic
1141331640 16:83116460-83116482 ACTCCTGACCAGTCAGTGGATGG + Intronic
1141525975 16:84612186-84612208 CCTAATGACCACACTGTAGCAGG + Intronic
1141628194 16:85272549-85272571 CCTCAGGCCCAGGCAGTGGGAGG + Intergenic
1141692626 16:85605197-85605219 CCTAGTGACCAGCCAGGGGCCGG + Intergenic
1142533204 17:596440-596462 CTGCATGACCAGGCAGTGCCAGG + Intronic
1142587785 17:985057-985079 TCTCATGACCAAACTGTAGCAGG + Intergenic
1143639493 17:8188034-8188056 CCTCATGAATAGGCAGGGGCTGG - Intergenic
1144493057 17:15731338-15731360 CATCATGTCCAGGCAGTGCCAGG + Intergenic
1144495519 17:15742639-15742661 CCTCATGGGCAGACTGGGGCAGG + Intronic
1144907198 17:18645315-18645337 CATCATGTCCAGGCAGTGCCAGG - Intronic
1145218511 17:21069971-21069993 CCCCATGACCAGGCTGTGGGCGG - Intergenic
1148392326 17:47281489-47281511 TCACATGACTAGTCAGTGGCAGG + Intronic
1152060243 17:78067806-78067828 CCTCAGTACCAGCCAGTGGGAGG + Exonic
1157644612 18:49255264-49255286 CCACATGCCCAGACTGAGGCAGG + Intronic
1158144623 18:54298325-54298347 CCTGATGTCCAGACAGAGGAGGG - Intronic
1159911811 18:74152646-74152668 CCTCATTGCCAGCCAGTGGCCGG + Intronic
1161445939 19:4319166-4319188 ACTCTGGACCAGACAGTGCCTGG + Intronic
1162015211 19:7841809-7841831 TCTCCTGCCTAGACAGTGGCCGG + Intronic
1163127843 19:15253906-15253928 CTCCATGACCAGACCCTGGCAGG + Intronic
1163234546 19:16023001-16023023 CCTCATGGGCAGACAGGGCCAGG + Intergenic
1163378618 19:16949592-16949614 CCTCTTGCCTAGACAATGGCAGG + Intronic
1163589729 19:18185717-18185739 CCTCATCACCAGAAACTAGCAGG + Intergenic
1165229979 19:34380881-34380903 CCTACTGACCAGTCAGTTGCAGG - Intronic
1165889192 19:39100493-39100515 ACTCAGGGCCTGACAGTGGCGGG + Intronic
1165948301 19:39458400-39458422 CCTCAGGGCCAGACCGGGGCTGG - Intronic
1166100425 19:40568295-40568317 CCTTATGACCAGAAAGTGAGGGG + Intronic
1166502757 19:43353698-43353720 GCTCATGACCCGTCTGTGGCTGG - Exonic
1167281801 19:48573548-48573570 GCTCAGGCCCAGAGAGTGGCAGG + Intronic
1167379096 19:49128348-49128370 ACTCCTGTCCAGACATTGGCAGG - Exonic
925889337 2:8421105-8421127 CCCCAGGACCAGGCAGTGCCAGG + Intergenic
927717118 2:25360077-25360099 GCTCTTGCCCAGAGAGTGGCAGG + Intergenic
931857359 2:66317370-66317392 CCACAAAACCAGGCAGTGGCAGG + Intergenic
932208887 2:69910306-69910328 CCCCAGCACCACACAGTGGCTGG + Intronic
938088345 2:128416552-128416574 CCTCGGGCCCAGACAGTGCCTGG - Intergenic
938117493 2:128611995-128612017 CTGGAAGACCAGACAGTGGCAGG - Intergenic
938159488 2:128972831-128972853 CCCAGTGGCCAGACAGTGGCAGG - Intergenic
939492153 2:142889290-142889312 CGTAATCAACAGACAGTGGCGGG + Intronic
944958247 2:204837674-204837696 CCTCATGATCAGACATCAGCAGG - Intronic
947947868 2:234121932-234121954 CCTCAGGACCAAACACTGGAAGG - Intergenic
948648321 2:239423019-239423041 TCACATGACCAGGAAGTGGCAGG + Intergenic
949018433 2:241726655-241726677 CTTCAGGCCCAGACACTGGCAGG - Exonic
1170032311 20:11956274-11956296 CCTCAGGACCAGGCTGAGGCTGG - Intergenic
1170750583 20:19141143-19141165 CCTCAAGAACAGACAGTTGAGGG + Intergenic
1170931696 20:20774402-20774424 CCTCATCTCCTGACAGTGCCGGG + Intergenic
1171401129 20:24873556-24873578 TGCCATGACCAGACAGGGGCAGG - Intergenic
1173334467 20:42101531-42101553 CCTGATGACAAGAAAGTGGGGGG + Intronic
1173647670 20:44643664-44643686 ACTCATGTCGAGACAGTGCCTGG + Intronic
1173804041 20:45912312-45912334 CCACTTGTCCAGACAGCGGCCGG - Intergenic
1174367730 20:50066673-50066695 CCCCAGGACCATACAGTGGAGGG + Intergenic
1174616228 20:51837674-51837696 GCTGTTGCCCAGACAGTGGCAGG - Intergenic
1175374568 20:58515331-58515353 CCTCATTTACAGACAGAGGCCGG - Intergenic
1176169702 20:63691247-63691269 CCTCAAGCGCAGCCAGTGGCAGG - Intronic
1179465379 21:41568230-41568252 CCTGCTGCCCAGACAGTGCCTGG - Intergenic
1180840558 22:18957037-18957059 CCTGATGCGCAGGCAGTGGCTGG + Intergenic
1181646042 22:24232288-24232310 CCTCAGGACCCTACAGTGGGGGG + Intronic
1181777329 22:25169108-25169130 CCTCATCAAAAGACAGTGACTGG + Intronic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1185050070 22:48549699-48549721 CTTCAGGACCAGGCAGTGCCGGG + Intronic
1185152869 22:49176100-49176122 ACACATTACCAGACAGTGGAAGG + Intergenic
1185277175 22:49954818-49954840 CCTCATGGCTGGACACTGGCTGG + Intergenic
950019491 3:9777076-9777098 ACTCAGGAGCAGACAGGGGCTGG + Intronic
952512675 3:34072792-34072814 CCTCATGACCAACCAGTGTGGGG + Intergenic
954936374 3:54330724-54330746 CCTCTTGGCCAGCCAGTGGGTGG + Intronic
960525383 3:118704140-118704162 CCTCTTGCCCATACAGTGCCTGG + Intergenic
961839975 3:129701456-129701478 CCCCATAACCAGCCAGTGGGTGG + Intronic
964604608 3:158546834-158546856 CCTCATAACTAGAGAGTGCCAGG - Intergenic
969188964 4:5501723-5501745 CCTCCTGTCCTGACAGTGCCTGG + Intergenic
969691213 4:8705265-8705287 CCTAGGGACCAGACACTGGCGGG - Intergenic
984654782 4:182306023-182306045 CCACCTGACCAGACAGGGCCAGG - Intronic
985509522 5:304978-305000 CCCCATGCCCAGACGGTAGCCGG + Intronic
985738752 5:1601912-1601934 CCCCATGCCCAGACGGTAGCCGG - Intergenic
986376651 5:7138949-7138971 CCTGATGACCACAGAGAGGCTGG - Intergenic
986746908 5:10753144-10753166 CCTCATCACCACTCTGTGGCAGG + Intronic
987211999 5:15693018-15693040 CATCAGGACCAGACAGTGATGGG + Intronic
990991675 5:61690455-61690477 CCTCATGACTAGACAGATCCTGG - Intronic
993074473 5:83211269-83211291 CCTCATGGCCAGCCAGATGCTGG - Intronic
994891288 5:105639707-105639729 CCTCCTGGCCAGAAAGGGGCGGG + Intergenic
996496292 5:124161100-124161122 CCTTCTCACCAGAAAGTGGCTGG + Intergenic
1000480129 5:161763188-161763210 CTTAATGACCAGAGAGTGGGGGG - Intergenic
1003577708 6:7313053-7313075 CCTCGGAACAAGACAGTGGCAGG + Exonic
1006914633 6:37586306-37586328 CCTGATGACCAGACTGATGCTGG + Intergenic
1012975394 6:105776152-105776174 CCCCCTGATTAGACAGTGGCAGG - Intergenic
1013607158 6:111761077-111761099 TCACATCACCAGCCAGTGGCAGG + Intronic
1018629041 6:165806292-165806314 CCACATGAATAGACAGTGACAGG - Intronic
1018655632 6:166033010-166033032 GCTCATGGCCAGCCAGTGGGCGG - Intergenic
1019471020 7:1221075-1221097 CCTCAAGACCAGGGAGTGGCGGG + Intergenic
1019517632 7:1446812-1446834 CCCCAGGACCAGGCATTGGCGGG - Exonic
1021799035 7:24285411-24285433 CCTCATCACCAGGCAGAGGTGGG + Exonic
1023029480 7:36079841-36079863 CCACATTCCCAGACAGTGACAGG - Intronic
1023037562 7:36146941-36146963 CCTTATAGCCAGAGAGTGGCTGG - Intergenic
1024241296 7:47438579-47438601 CTTCAAGACCAGAAAGAGGCAGG + Intronic
1026919714 7:74146337-74146359 CCTTCTGACCAAACAGTGGCTGG - Intergenic
1030157987 7:106476350-106476372 AGTATTGACCAGACAGTGGCAGG + Intergenic
1033356140 7:140601805-140601827 CCTCCTGACAAGGCAGAGGCAGG - Exonic
1035524348 8:300683-300705 CCACCTGACCTGAGAGTGGCGGG + Intergenic
1037886324 8:22598307-22598329 CCTGGTGACCAGACTGGGGCTGG - Intronic
1039902351 8:41762084-41762106 CCTCATGAACAGACAGCCACAGG - Intronic
1043741139 8:83812826-83812848 CAAAATGACCAGTCAGTGGCTGG + Intergenic
1044827768 8:96214605-96214627 CTACATGAACTGACAGTGGCTGG - Intergenic
1045737491 8:105313851-105313873 TCACATGACCAGAGAGTGGGAGG + Intronic
1046854444 8:119015305-119015327 CCTAATGGGCAGACAGTGGGAGG - Intronic
1048972054 8:139650636-139650658 ACTCATGTGCAGGCAGTGGCTGG + Intronic
1049097923 8:140559670-140559692 CCTCAGGCCCAGACACGGGCAGG + Intronic
1049594555 8:143477421-143477443 CCTCTGGCCCAGACAGTGCCCGG - Intronic
1052869103 9:33486098-33486120 CCTCATGAGTAGCCAGTAGCTGG - Intergenic
1055056580 9:72029677-72029699 CCCAATGTCCAGACAGTGCCTGG - Intergenic
1055401899 9:75932949-75932971 CCTCAGGACTAGACTGTGTCTGG + Intronic
1056165472 9:83936903-83936925 CCTCCCCACCACACAGTGGCTGG + Intergenic
1056910683 9:90697398-90697420 CCTCATGACCCAGCAGTGGGAGG - Intergenic
1057564979 9:96159770-96159792 CCTCATCACCAGCCACTGGATGG + Intergenic
1057689294 9:97268967-97268989 CCTCATGAGTAGCCAGTAGCTGG + Intergenic
1060291153 9:122304143-122304165 CCTCATGACCTGACTTGGGCTGG + Intronic
1060881796 9:127122777-127122799 CCTCAGCCCCAGACAGAGGCGGG + Exonic
1061826305 9:133260447-133260469 AGTCATGGGCAGACAGTGGCTGG - Intronic
1186639246 X:11437604-11437626 CCTCAGGACCAGACTGAGACTGG - Intronic
1186970054 X:14832286-14832308 GCTCATGACAAGGCAGGGGCTGG - Intergenic
1189739022 X:44099896-44099918 CATTATGACCAGAATGTGGCAGG + Intergenic
1190278551 X:48914493-48914515 CCCAGTGACCAGACAGTGGCCGG + Exonic
1190297699 X:49038280-49038302 CCTCAGGGGCAGGCAGTGGCTGG + Exonic
1196225847 X:113165727-113165749 CCACATTACCAGACAGTAGTAGG - Intergenic
1200096324 X:153665799-153665821 CCACATGCCCAGACAGTGCCTGG + Intergenic