ID: 1133318086

View in Genome Browser
Species Human (GRCh38)
Location 16:4896291-4896313
Sequence GAGAGTTCTTAAGAAGCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 168}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133318086_1133318090 19 Left 1133318086 16:4896291-4896313 CCCGCAGCTTCTTAAGAACTCTC 0: 1
1: 0
2: 1
3: 19
4: 168
Right 1133318090 16:4896333-4896355 AGTGTCCAGCCACAGATGAGTGG 0: 1
1: 4
2: 95
3: 1216
4: 2731

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133318086 Original CRISPR GAGAGTTCTTAAGAAGCTGC GGG (reversed) Intronic
900612286 1:3549227-3549249 GTGAATGCTCAAGAAGCTGCAGG + Intronic
902384144 1:16066964-16066986 GAGAGTTGTAAAAAAGCTTCAGG - Intronic
903133243 1:21292723-21292745 GAGAGTTCTTGAGAACTTGAAGG - Intronic
904362491 1:29985698-29985720 GAGAGGTCTCATGAAGCTTCAGG - Intergenic
905387056 1:37612356-37612378 GAGCCTTCTGGAGAAGCTGCTGG - Exonic
905478384 1:38244857-38244879 GAGAGTTCCTGAGAAGATGCAGG + Intergenic
908131240 1:61077480-61077502 GAGATTTTTTAAAAAGCTGTTGG - Intronic
908863775 1:68521630-68521652 CAGAGTTCTCAAACAGCTGCTGG + Intergenic
910022700 1:82611520-82611542 GAGGGTTATGAAAAAGCTGCAGG + Intergenic
910051793 1:82983089-82983111 GAGAAATCTTAAGAGGCTGCGGG + Intergenic
913383788 1:118238107-118238129 GTGAGTTCTCATGAAGCTGATGG + Intergenic
915174249 1:154001734-154001756 CAGAGTTCTTAGGAAGCTAGAGG - Exonic
915840994 1:159212879-159212901 GAGAGTTCTTAAAAAGGGGGTGG + Intergenic
916397253 1:164404695-164404717 CAGATTTCTTAAGAATCTGTTGG + Intergenic
916436575 1:164783190-164783212 GTGAAGACTTAAGAAGCTGCAGG + Intronic
922076700 1:222252541-222252563 GAGAGCCCTTAAGGAGGTGCAGG + Intergenic
922590702 1:226773682-226773704 GAGAATCCTTGAGAAGCTGATGG - Intergenic
1068213302 10:53951406-53951428 AAGAGTTCTTAAAAAGCTAATGG - Intronic
1070147948 10:73788396-73788418 GAGATATCTTAAGAAACTCCTGG - Intronic
1072601411 10:96934380-96934402 GAGAGTTTTTAAAAAGCTTAAGG + Intronic
1073553864 10:104428921-104428943 GACAGTTCTGAAGAGGCTGCTGG + Intronic
1076152142 10:128171184-128171206 GAGAGGTCTTAGCGAGCTGCAGG + Intergenic
1077729451 11:4713992-4714014 GAAAGCTCTTAATAAGCTCCTGG - Intronic
1078019960 11:7648649-7648671 GAGAGTTCCTCTGTAGCTGCAGG + Intronic
1086734219 11:90285670-90285692 GAGAGATGTGAGGAAGCTGCAGG - Intergenic
1090972187 11:131653407-131653429 GAGATTTCTTCCGCAGCTGCAGG - Intronic
1090994347 11:131851908-131851930 AAGAGTTCTGAAGAAGCTTTTGG + Intronic
1091853343 12:3718889-3718911 GAGAGTTTACAAGAAGCTGGAGG + Intronic
1092482668 12:8874418-8874440 GAGTGTTCTTAATGAGCTGTGGG - Exonic
1093349414 12:18079567-18079589 GAGAGTAGATAACAAGCTGCAGG + Intergenic
1093778154 12:23101273-23101295 GAGAGTTGAGAACAAGCTGCTGG + Intergenic
1097193943 12:57233592-57233614 GAGCATTCTTCAGAACCTGCAGG - Exonic
1097226161 12:57477837-57477859 GAGAATTTTTAAAAAGCAGCTGG - Intronic
1097335615 12:58379592-58379614 GAAAGATCTTAAGAAGATGAAGG - Intergenic
1098767666 12:74510065-74510087 GAGAGTTCTAAATAAACTGCAGG + Intergenic
1101442335 12:104713088-104713110 GCGTGTTCTTAAGGATCTGCTGG + Intronic
1102497276 12:113328467-113328489 GAGAGCTCTTCAGCAGCTGGAGG - Intronic
1110469196 13:75839794-75839816 GATATTTCTGAAGAAGCTTCAGG - Intronic
1111519384 13:89380385-89380407 AGGACTTCTTAAGAAACTGCTGG - Intergenic
1111577040 13:90168540-90168562 GAGAGAGCTTCAGAAGCAGCAGG + Intergenic
1112388170 13:98959445-98959467 CAGAGGTCTTCAGCAGCTGCTGG + Intronic
1113937886 13:114004720-114004742 GAGATTTCTCAAGAAGCTAAAGG + Intronic
1115235744 14:31207466-31207488 TAGAGTTCCCAAGAAGCCGCAGG + Exonic
1116539613 14:46083625-46083647 GACCGTTTTTAAAAAGCTGCAGG - Intergenic
1117152698 14:52905495-52905517 GAGAGTGCTTAGGAGGCTCCTGG + Intronic
1118490557 14:66255371-66255393 GAGAGCTCTTAGGAGGCTGGGGG - Intergenic
1118622836 14:67629988-67630010 GAGGGCTCTTCAGAAGCTGGAGG - Intronic
1120410360 14:84146358-84146380 TTGAGTTCTTGAGAAGCTGTTGG + Intergenic
1122981454 14:105194031-105194053 GGGAGATCTAAAGAAGGTGCAGG + Intergenic
1125964571 15:43863531-43863553 GAGAGTAGTTAACAAACTGCTGG - Intronic
1126023342 15:44423237-44423259 GAGAATACTTAAGGAGGTGCAGG + Intergenic
1129050290 15:72775745-72775767 GTGAGTTCTTAAAATGCTGCAGG - Intronic
1129311227 15:74710723-74710745 GAGAGTTCCAAAGGAGATGCTGG - Intergenic
1129738741 15:77979713-77979735 AAGAGTTCTGCAGAGGCTGCGGG - Intergenic
1130124532 15:81081924-81081946 GAGACTTTTGAAGAGGCTGCTGG - Intronic
1132075748 15:98818457-98818479 GAGACCGCTTAGGAAGCTGCTGG + Intronic
1133318086 16:4896291-4896313 GAGAGTTCTTAAGAAGCTGCGGG - Intronic
1134244862 16:12532541-12532563 GAGAATTCCTAAGAACTTGCAGG + Intronic
1135542672 16:23344300-23344322 GAGAGGTGTTAAGGAGCTGTTGG + Intronic
1136079596 16:27842971-27842993 GAGAGTTCACAGGCAGCTGCAGG - Intronic
1136386952 16:29933865-29933887 GAGAGGGATTAGGAAGCTGCAGG + Intergenic
1137467685 16:48725796-48725818 GAGACTTCTGCAGAAACTGCTGG + Intergenic
1140888224 16:79262816-79262838 GAGAGTTATCTAGAAGCTGGTGG + Intergenic
1142566486 17:843570-843592 GAGAGATCTTAAGAAGCGGCTGG + Intronic
1145734633 17:27218990-27219012 GAGTGTGCTCAAGAACCTGCAGG - Intergenic
1147817961 17:43223914-43223936 GAGAGTGGTTGAGAAGCTGTCGG - Intergenic
1147951082 17:44108444-44108466 TAGGGTTCTAAAGATGCTGCTGG + Intronic
1151178222 17:72306527-72306549 AAGAGTTCTTTAAAAACTGCTGG + Intergenic
1151289021 17:73135344-73135366 GAGAGTTTTTCAGAAGCTTTGGG - Intergenic
1154228534 18:12531404-12531426 GAGAGTTCTGAAGAAAATGGAGG - Intronic
1155200654 18:23514822-23514844 TATAGTTCTTAAGAAGCTTACGG + Intronic
1158958764 18:62569356-62569378 TATAGTTCTTAAGAAGCCTCTGG + Intronic
1160272921 18:77403886-77403908 GGGAGTTCTCAGGAAGCTTCTGG + Intergenic
1161930176 19:7334231-7334253 CAGGGTTCTTAAGAAACTGAAGG + Intergenic
1162822259 19:13230070-13230092 GTGACTTCTTACCAAGCTGCGGG + Exonic
1163949007 19:20566962-20566984 GAGAGGTCTTATGAAGCTTCAGG - Intronic
1164985234 19:32643577-32643599 GAGAGTCCCTCAGAAGCTGCTGG + Exonic
926818505 2:16826350-16826372 GAGAGAGGTGAAGAAGCTGCCGG - Intergenic
927665256 2:25027576-25027598 GAGAGATTCTAAGAAGATGCAGG + Intergenic
933272602 2:80249242-80249264 TAGAGTTCTAAAGAACCTGCAGG + Intronic
935556915 2:104519969-104519991 AAGAGTCCTTAAGTACCTGCTGG - Intergenic
937683370 2:124668331-124668353 GAGAGATCTTAAGCAGCTAACGG + Intronic
939093989 2:137811558-137811580 GAGAGTTCTGAAGAGGCAGAGGG + Intergenic
940037427 2:149325482-149325504 GAGAGAGGTGAAGAAGCTGCAGG - Intergenic
941716462 2:168768599-168768621 GAGGCATCTTAAGAACCTGCTGG - Intronic
944981089 2:205120801-205120823 GAAAGCTCTTTAGAAGCGGCTGG - Intronic
945549640 2:211204875-211204897 GAGAGTTCTTGTGAAGCTGTGGG - Intergenic
1168817752 20:751952-751974 GAAAGTTTTTTAGAAGCTCCTGG - Intergenic
1169755842 20:9042409-9042431 GGAAGTTCTTAAGAAGCTTGTGG + Intergenic
1170012167 20:11736091-11736113 GAGAGTTCTTGGGAAGCAGGTGG - Intergenic
1171190221 20:23153711-23153733 GAGAGGTCTTCAGAAACAGCAGG + Intergenic
1172284844 20:33733014-33733036 GAGATCTCCTAGGAAGCTGCAGG - Intronic
1179179010 21:39029533-39029555 GAGACTGCTACAGAAGCTGCAGG - Intergenic
1180662974 22:17485121-17485143 GAGTGTTCTTGAGAAGCAGTTGG - Intronic
1181150817 22:20882021-20882043 CAGAGATCTGAAGATGCTGCTGG + Intronic
949194755 3:1291281-1291303 GTGAGATATTTAGAAGCTGCTGG - Intronic
953113169 3:39963571-39963593 GATAGTGCTTAAGAAGCAGGGGG - Intronic
955972691 3:64451611-64451633 GGGAGTTCTTAAAATGCTGATGG - Intergenic
956409001 3:68959308-68959330 GTGGGGGCTTAAGAAGCTGCTGG - Intergenic
959096740 3:101964702-101964724 GGGAGTTCTCTAGAGGCTGCGGG + Intergenic
960423008 3:117471711-117471733 GAAATTTCTTCAGATGCTGCTGG - Intergenic
964699740 3:159552408-159552430 GAGAGTAATTAAGAAACTGAAGG - Intronic
964941965 3:162169360-162169382 GAGAGCACTTCTGAAGCTGCAGG + Intergenic
966738640 3:183211298-183211320 GTGACTTCTTGAGAAGCTGCAGG + Intronic
968801388 4:2745481-2745503 GAGTGTTATTGAGAAGTTGCAGG - Exonic
970090990 4:12407719-12407741 GAGAGTCCTGAAGAATATGCTGG + Intergenic
971046011 4:22806052-22806074 GAGAGTTCTTGAGAAGCATTGGG + Intergenic
979318926 4:119300542-119300564 TAGGGTTGTTACGAAGCTGCAGG - Exonic
980341201 4:131549393-131549415 GAGGGATGTCAAGAAGCTGCAGG + Intergenic
980857754 4:138460404-138460426 GAGAGAGGTGAAGAAGCTGCAGG - Intergenic
981700269 4:147600243-147600265 GACATGTCTGAAGAAGCTGCAGG - Intergenic
982912426 4:161161193-161161215 CAGAGTTCTGAAGAATATGCAGG + Intergenic
983714072 4:170755401-170755423 GTAAGTTCTTATGAATCTGCTGG + Intergenic
986585325 5:9310751-9310773 GCCAGTTCTAAAGAAGCTGCTGG - Intronic
987736569 5:21852811-21852833 GAGTGTTCTTCATAAGCTGAAGG + Intronic
987811492 5:22841846-22841868 AAGAATACTTAGGAAGCTGCTGG + Intronic
990157483 5:52895301-52895323 CTGAGTTCTTCAGAAGCAGCTGG - Intronic
992500794 5:77340899-77340921 GAGGGCTCTTAAGAAGGTGCAGG + Intronic
992736663 5:79728561-79728583 AAGAGTTATTATGAAGATGCTGG + Intronic
992942837 5:81779757-81779779 GAGAGTTCTTGAAAAGCTATAGG + Intergenic
993143215 5:84060405-84060427 GAGCGTTCTGAAGATGCTGGAGG + Exonic
993661459 5:90641805-90641827 GATAATTCTTAAGAGCCTGCTGG + Intronic
995839144 5:116426776-116426798 GTGAGAGCTGAAGAAGCTGCAGG + Intergenic
1000621825 5:163494774-163494796 CAGAGTTCTGAAAAAGATGCTGG + Intergenic
1002973957 6:2055192-2055214 AAGAGATCTTAAGAACCTGTGGG + Intronic
1005579675 6:27221776-27221798 GAGAGGTCTGCAGGAGCTGCTGG + Intergenic
1005916115 6:30352978-30353000 GAGGCTTCATAAGAAGCTCCAGG - Intergenic
1008837959 6:55860611-55860633 TAGAATTTTTAAGAAGCAGCAGG + Intronic
1010453387 6:76028270-76028292 GATAGTTTATAATAAGCTGCAGG + Intronic
1010729435 6:79373683-79373705 GAAAGTACTTAAAAAGCTCCAGG + Intergenic
1011599296 6:89045076-89045098 GAGAGATATTCCGAAGCTGCAGG - Intergenic
1012699729 6:102439726-102439748 GAGAGTTATTAAGATGCTTATGG - Intergenic
1013148755 6:107423894-107423916 GAAAAATTTTAAGAAGCTGCTGG - Intronic
1013823797 6:114186506-114186528 GAGAGACGTGAAGAAGCTGCAGG + Intronic
1014820576 6:125984582-125984604 AAGAGTGGTTAAGAAGCAGCAGG - Intergenic
1015023695 6:128507669-128507691 GGCAGTTCATAAGCAGCTGCAGG + Intronic
1016030508 6:139332730-139332752 TAGAGTTATGAAGAAGCTGCAGG - Intergenic
1016634452 6:146271426-146271448 GAGACTTGTTAGGAAGCTGGTGG + Intronic
1017224363 6:152003033-152003055 AAGAGTTCTGAAGAAGCTGATGG - Intronic
1017980042 6:159393517-159393539 GAGAGCTCTCAAGAAGCTGTTGG + Intergenic
1020768433 7:12355578-12355600 ATGAGTTTTTAAAAAGCTGCGGG + Intronic
1021338472 7:19433724-19433746 GAGAGCTCCCAGGAAGCTGCTGG - Intergenic
1022982566 7:35618216-35618238 ACCATTTCTTAAGAAGCTGCTGG - Intergenic
1024392572 7:48832103-48832125 GGGAGTTCAAATGAAGCTGCAGG + Intergenic
1024392601 7:48832394-48832416 GAGAACACTTTAGAAGCTGCTGG - Intergenic
1024499558 7:50090057-50090079 GAGTGTTATTAAAAAGGTGCTGG - Intronic
1027131110 7:75592097-75592119 GAGAGTCCTTCAGGACCTGCAGG + Exonic
1027338165 7:77176503-77176525 GAGAGTTCAGAAGAAGCAACAGG + Intronic
1029777561 7:102694290-102694312 GAGAGTTCAGAAGAAGCAACAGG - Intergenic
1030339686 7:108362977-108362999 GCAAGTTCTTAAGATGCTCCAGG - Intronic
1032591400 7:133195015-133195037 AAGAGCCCTTGAGAAGCTGCTGG - Intergenic
1039416045 8:37394751-37394773 GAGAGCACTCAAGATGCTGCGGG + Intergenic
1039504731 8:38043732-38043754 CAGGGGTCTTATGAAGCTGCTGG - Intronic
1041764483 8:61404077-61404099 GAGGATTCTTATGGAGCTGCTGG + Intronic
1043745234 8:83867005-83867027 GAGGGGTCATAAGAAGATGCAGG - Intergenic
1045752689 8:105504275-105504297 GAGAGTTGATAAGCAGCAGCAGG + Intronic
1047020408 8:120769555-120769577 GAGACTTCTTACATAGCTGCTGG - Intronic
1047178617 8:122566288-122566310 TAGACTTGTTAGGAAGCTGCAGG + Intergenic
1049534833 8:143174300-143174322 TAGGGTTCTTATGAAGCTGAAGG + Intergenic
1052318757 9:27144447-27144469 GAGAGTTCTTGAGAAACTTTAGG - Intronic
1055779616 9:79805877-79805899 GACAGTTCTTAAGAGTCAGCTGG + Intergenic
1056731758 9:89172067-89172089 GAGAGTTGGTGAGAAGGTGCCGG - Intronic
1057325725 9:94061664-94061686 GACACTGCTTAAGAAGGTGCAGG - Intronic
1058277045 9:103056409-103056431 GAGAGTACTTAAGTATCTGATGG + Intergenic
1059909911 9:119031522-119031544 GAATATTCTTAAGAATCTGCTGG - Intergenic
1060259204 9:122058999-122059021 CAGAGTGCTTAAGGACCTGCAGG - Intronic
1061790758 9:133057683-133057705 TCGAGCTCTTAAGAAGCTGGTGG - Intronic
1185466464 X:358007-358029 GTGAGTTCTCAAGCAGCCGCCGG + Intronic
1188439823 X:30205027-30205049 GTGAGTTCTTAAAAAGCAGCAGG - Intergenic
1188777598 X:34240159-34240181 GAGAATCCTAAAGAATCTGCTGG - Intergenic
1190180647 X:48189023-48189045 GAGAGAGGTGAAGAAGCTGCAGG + Intronic
1190183570 X:48215594-48215616 GAGAGAGGTGAAGAAGCTGCAGG - Intronic
1190193694 X:48298526-48298548 GAGAGAGGTGAAGAAGCTGCAGG + Intergenic
1190199561 X:48348880-48348902 GAGAGAGGTGAAGAAGCTGCAGG + Intronic
1190204336 X:48390570-48390592 GAGAGAGCTGAAGAAGCTGCAGG - Intronic
1190206200 X:48404833-48404855 GAGAGAGCTGAAGAAGCTGCAGG + Intronic
1190660213 X:52647156-52647178 GAGAGAGGTGAAGAAGCTGCAGG + Intronic
1190663370 X:52675657-52675679 GAGAGAGGTGAAGAAGCTGCAGG - Intronic
1190666334 X:52699325-52699347 GAGAGAGGTGAAGAAGCTGCAGG + Intronic
1190673084 X:52759085-52759107 GAGAGAGGTGAAGAAGCTGCAGG - Intronic
1190676053 X:52782825-52782847 GAGAGAGGTGAAGAAGCTGCAGG + Intronic
1192589818 X:72350706-72350728 GTGAGTTGTGAAGAAGCAGCTGG + Intronic
1193611521 X:83637057-83637079 ACGTGTTCCTAAGAAGCTGCTGG + Intergenic
1197492814 X:127139594-127139616 GGAAGTGTTTAAGAAGCTGCTGG + Intergenic
1197638877 X:128946635-128946657 GAGAGTTTTTCACAGGCTGCTGG - Intergenic
1198089087 X:133310059-133310081 CAGTGTTCTTAAGAATCTGTTGG + Intronic
1199304532 X:146251866-146251888 GAGAGACCCTAAGAAGCTGCTGG - Intergenic
1200206984 X:154323631-154323653 AAGGGTGCTTAAGAAGCCGCAGG + Intronic
1201567858 Y:15385336-15385358 GGAAGCTCTGAAGAAGCTGCAGG + Intergenic