ID: 1133319580

View in Genome Browser
Species Human (GRCh38)
Location 16:4904656-4904678
Sequence CTGTGGATAGGGAGGAAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 309}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133319570_1133319580 26 Left 1133319570 16:4904607-4904629 CCTGAGGCAGGAGAGAGCGAGCT 0: 1
1: 0
2: 1
3: 32
4: 296
Right 1133319580 16:4904656-4904678 CTGTGGATAGGGAGGAAACAGGG 0: 1
1: 0
2: 1
3: 27
4: 309
1133319574_1133319580 -6 Left 1133319574 16:4904639-4904661 CCATAGTGAAAAGGTCTCTGTGG 0: 1
1: 0
2: 0
3: 9
4: 143
Right 1133319580 16:4904656-4904678 CTGTGGATAGGGAGGAAACAGGG 0: 1
1: 0
2: 1
3: 27
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133319580 Original CRISPR CTGTGGATAGGGAGGAAACA GGG Intronic
900271652 1:1793162-1793184 CTGTGAACATGGAGGAAATAAGG - Intronic
900300210 1:1973343-1973365 CTGTGGGGAGGGAGGAGGCAGGG + Intronic
903363246 1:22790378-22790400 CTGGGGTTGGGGAGGGAACAGGG - Intronic
903852834 1:26318477-26318499 CTGTGGTTATGGAGGTGACAGGG + Intronic
904272229 1:29357555-29357577 CTGGGGCTAGGGGGGACACAGGG - Intergenic
904563925 1:31415918-31415940 CTTTGGATGGGGAGGTAAGATGG + Intronic
905805474 1:40873954-40873976 CTGTGGGTAGGGAGGGACAACGG + Intergenic
906714142 1:47954499-47954521 CTATGGAGAGGGAGGAGCCATGG + Intronic
907113948 1:51952157-51952179 CTGAGGATAGGGATCACACATGG - Intronic
908427494 1:64021686-64021708 GTGTGTATAGGGAGGAAAGAAGG + Intronic
908692683 1:66800465-66800487 ATGTGGTTAGGTAGGAAACTGGG - Intronic
909512900 1:76475067-76475089 GTGTGCATAGGGAGGAAGCTGGG + Intronic
911471695 1:98327146-98327168 AGGTGGAGAGGCAGGAAACAAGG + Intergenic
911939055 1:104019081-104019103 CTTTGGAAAGGTAGGAAATATGG - Intergenic
913660683 1:121003882-121003904 CTTTGGATGTGAAGGAAACATGG + Intergenic
914012047 1:143787038-143787060 CTTTGGATGTGAAGGAAACATGG + Intergenic
914165785 1:145174096-145174118 CTTTGGATGTGAAGGAAACATGG - Intergenic
914650677 1:149695698-149695720 CTTTGGATGTGAAGGAAACATGG + Intergenic
915457866 1:156052817-156052839 ATGTGGTTAGGGAGGGAGCAAGG + Intronic
915831962 1:159139774-159139796 CTGGGGATGAGGTGGAAACAGGG - Intronic
915903942 1:159864660-159864682 CTGTGGTTAGGGTTGGAACATGG + Intronic
916919034 1:169441850-169441872 CAGTGGAGAGGGAAGACACATGG - Intronic
918481813 1:184986184-184986206 CTGTGGTTAGGGAAGAAAGGAGG + Intergenic
919879697 1:201893531-201893553 CTGTGGATGGGGAGAAAAGGAGG - Intergenic
920804544 1:209220131-209220153 CTGTGCGTAGGGAGGAGACTGGG + Intergenic
921762405 1:218931111-218931133 CGGTGGAAAGCCAGGAAACAGGG + Intergenic
922218052 1:223536560-223536582 CTGGGGAGAGGGAGGAAGCTGGG + Intergenic
922910688 1:229213697-229213719 CTGTGGGCAAGGAGGAAAGAAGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924146213 1:241077522-241077544 CAGTGGAAGGGGAGGAAAAAGGG + Intronic
924464842 1:244290617-244290639 CAGTGGGTAGGGAGGAAAGAAGG + Intergenic
1062819709 10:525640-525662 CTGAGGACAGGGAGAGAACAGGG + Intronic
1063500493 10:6549309-6549331 ATGTAGATAGGGAGGAAGTACGG + Intronic
1064265232 10:13820601-13820623 CTGTGCTTTGGGAGGAACCACGG + Intronic
1065132428 10:22635665-22635687 CTGTGGGCAGCGAGGAAGCATGG + Intronic
1068668582 10:59701423-59701445 CTGTGGGTAATGAGGAACCATGG - Intronic
1070847964 10:79539287-79539309 CTGTGGTTGGGGAGGAAGGAGGG + Intergenic
1071112324 10:82174355-82174377 ATGTGCATAAAGAGGAAACAAGG - Intronic
1074883384 10:117675931-117675953 CTGGGGGTAGGGAGGAGAGAAGG - Intergenic
1075241569 10:120784113-120784135 GTCTGCATAGGGAGGAAACCTGG - Intergenic
1075723800 10:124601701-124601723 CTGTCCACAGGGAGGAAACGGGG - Intronic
1076079391 10:127565116-127565138 CTGGGGACAGGGAGGAAAGTCGG - Intergenic
1076172093 10:128327636-128327658 ATGTGGCTGGGGAGGAAGCAGGG - Intergenic
1076760971 10:132605489-132605511 CTGGGGATGGGGAGGGGACAGGG + Intronic
1076863750 10:133157133-133157155 CTGTGGCTCTGGCGGAAACACGG - Intergenic
1077353980 11:2106274-2106296 TGGTGGATAGGGAGGAAGCATGG - Intergenic
1077433258 11:2526432-2526454 CTGTGGGGAGGGAGGAACCCAGG + Intronic
1078049385 11:7948519-7948541 CTGTGGAAGGGAAGGAAAGAAGG - Intergenic
1078267021 11:9762623-9762645 CTGTGGACAAGGAGGATACGTGG + Intergenic
1079252262 11:18794931-18794953 GGGTGTATAGGGTGGAAACAGGG - Intergenic
1081412113 11:42772051-42772073 ATGTGGAGATGGAGGAAAAAAGG + Intergenic
1081413437 11:42786054-42786076 CTGTCAGTGGGGAGGAAACAGGG + Intergenic
1081430408 11:42970480-42970502 CTCTTGAAAGGGAGGAAAGAAGG - Intergenic
1081920029 11:46766461-46766483 CTGAGCATAGGGAAGAAAAATGG + Intronic
1082206111 11:49436051-49436073 CTGTGGAAACGGAGATAACATGG + Intergenic
1082659670 11:55894815-55894837 CTATGGATAGAAAGGAACCAGGG + Intergenic
1083854899 11:65388201-65388223 CATTTGATAGGGAGGAAACTGGG + Intronic
1085238361 11:75032241-75032263 ATGGGGAAAGGGAGGAATCAAGG + Intergenic
1085388789 11:76171813-76171835 TTGGGGGTAGGGAGGAATCATGG - Intergenic
1085625789 11:78071781-78071803 AGGTGGATGGGGTGGAAACAGGG + Intronic
1086649153 11:89265720-89265742 CTATGGAAAGGGAGATAACATGG - Intronic
1088450874 11:109980132-109980154 CTGAGGATAGGTAGAAAGCATGG - Intergenic
1088589742 11:111393158-111393180 CAGTGGATTTGGAGGAAACTTGG - Intronic
1089433614 11:118443187-118443209 CTGGGAATAGGGAGGAAAAAGGG + Intronic
1089634016 11:119800869-119800891 CTGTGCATTGTGAGGAAAGAAGG - Intergenic
1090383135 11:126340648-126340670 CTGGGGATAGGGAGGCACCCTGG + Intronic
1090493282 11:127185158-127185180 CGGTGGACAAGGAGGAGACAAGG - Intergenic
1091436332 12:475938-475960 ATGTCCATACGGAGGAAACACGG - Intronic
1091889279 12:4040188-4040210 CTGTGGTTTGGCAGGATACAGGG - Intergenic
1092489135 12:8929377-8929399 CTGTGGATAAGGAGGTAGGAAGG - Intronic
1095921833 12:47539529-47539551 CTGAGGAAAGGGAGGTACCAAGG + Intergenic
1096660582 12:53121608-53121630 CTGTGGACAGGGTGGAATTAAGG - Intronic
1096787286 12:54024463-54024485 CTGGGGAGAGAGAGGAGACAGGG + Intronic
1097295173 12:57955048-57955070 CAGTGGAGAGGGTGGAAGCAGGG + Intronic
1098209879 12:68152356-68152378 CAGTGTGTAGGGAGGAAACCTGG - Intergenic
1102600358 12:114025098-114025120 GTGTGGAAAGGGAGTAAGCAGGG - Intergenic
1103055867 12:117819777-117819799 CTGTTCACAGGAAGGAAACAGGG + Intronic
1103187456 12:118971857-118971879 CTGAGGAGAGGGAGGGAATAGGG + Intergenic
1103669665 12:122602812-122602834 CTGTAGCTAGAAAGGAAACAAGG - Exonic
1104067589 12:125318255-125318277 CTGTGGTTGGGGAGGGACCACGG + Intronic
1104080895 12:125429862-125429884 GTGTGGAAAGGGGGGAAGCAGGG - Intronic
1104326073 12:127799969-127799991 CTGTGCAGAAGGAGTAAACAAGG + Intergenic
1104510010 12:129368711-129368733 CTGTTGGTAAGGAGGAAAGAGGG - Intronic
1104616437 12:130273694-130273716 CTGTGGATACAGAGGGTACATGG - Intergenic
1104850636 12:131871906-131871928 CAGGGGATGGGGAGGAAAGAAGG + Intergenic
1104855950 12:131902641-131902663 CTATTTAAAGGGAGGAAACAGGG - Intronic
1104950712 12:132438715-132438737 CTGTGGCTGTGCAGGAAACAGGG - Intergenic
1105415151 13:20205547-20205569 CTGTTCATGGGGAGGGAACAGGG - Intergenic
1106602229 13:31198116-31198138 CTGTGGAAAGGAAGGACACCAGG + Intergenic
1107086225 13:36430852-36430874 CTTTGAATATGAAGGAAACACGG - Intergenic
1107335094 13:39346333-39346355 ATGTGGAAAGGGAGAAATCAAGG - Intronic
1111682978 13:91466730-91466752 CTGGGGAGAGGGAGGAACCTAGG + Intronic
1111704130 13:91726800-91726822 CTGTGCAGATGGAGGAAAAAGGG - Intronic
1112248543 13:97756663-97756685 AGGTGGCTAGGGAGGCAACATGG - Intergenic
1112607243 13:100918986-100919008 CTATGGAGAGGGAAGAAATAGGG + Intergenic
1114454248 14:22845134-22845156 CTGTGGACAGGGTGGGGACAGGG - Intronic
1115851011 14:37590560-37590582 CTGTGGGTAGAGAGGACAAAGGG + Exonic
1117865424 14:60143446-60143468 CTTAGGATGGGGAGGAAACGGGG - Exonic
1117897495 14:60503142-60503164 CTGTGTATTGGCAGGAAAAATGG - Intronic
1118870443 14:69736790-69736812 GGGTGGACAGGGAGGAAGCAGGG + Intronic
1119251348 14:73157629-73157651 CTGGGGATGGGGAGGAATCAGGG - Intronic
1119635476 14:76269848-76269870 TTGTGGAGAGGGAGGAAGGAGGG - Intergenic
1122148185 14:99706569-99706591 CTGTGGAGAGGGAGGGCACATGG + Intronic
1126109760 15:45168365-45168387 GTGTGTATAGGGAGCATACAGGG + Intronic
1128219089 15:65955073-65955095 CTGTGGATGGGGTGTATACAGGG - Intronic
1128545778 15:68566651-68566673 CTGTGGTTAAGGAGCAAATAAGG + Intergenic
1128570824 15:68731551-68731573 GAGGGGATAGGGAGGCAACAGGG + Intergenic
1129226430 15:74173056-74173078 CACTGGCTGGGGAGGAAACAGGG - Intergenic
1129608316 15:77035485-77035507 CTGGGAACAGGGAGGAAAGAGGG - Intronic
1130829375 15:87583967-87583989 CTGTGAATACGGAAGAAGCAAGG + Intergenic
1131116529 15:89799560-89799582 CTGTGGAGAGGGACGAGACCTGG + Intronic
1132083934 15:98891302-98891324 CTGTGGAGAGAGAGGAGAGACGG - Intronic
1132638855 16:967834-967856 CAGTGGACAGCGAGGAAGCAGGG - Intronic
1133319580 16:4904656-4904678 CTGTGGATAGGGAGGAAACAGGG + Intronic
1133837313 16:9378517-9378539 CTGTGGATAAAGAGTTAACAAGG + Intergenic
1135738290 16:24951286-24951308 CTGAGGCTTGGGAGGGAACAGGG - Intronic
1135972082 16:27079642-27079664 CTTAGGACAGGGAGGCAACAGGG + Intergenic
1135994640 16:27238791-27238813 TTGGGGATAGGCAGGAAGCATGG - Intronic
1136073718 16:27804435-27804457 GTGGTGATGGGGAGGAAACAGGG - Intronic
1136418419 16:30117286-30117308 CTGTGGATAAGGAGGTGACTTGG + Intronic
1137579374 16:49623870-49623892 CTGTGGCTAGGTAGGGACCAGGG + Intronic
1138663676 16:58543877-58543899 CTGTGGATGGGCCTGAAACAAGG + Exonic
1139029828 16:62866522-62866544 CTGTTAATAGGGAAGAAAGAAGG + Intergenic
1139550922 16:67672586-67672608 GTGTGGATAGGGAGGGATCTTGG + Intergenic
1139837879 16:69854299-69854321 ATGTGGATGGCGAGGAAAGAGGG + Intronic
1142723843 17:1797257-1797279 CTCTTGAGAGGGAGGAAACCAGG - Intronic
1143477438 17:7210977-7210999 CTCAGGATTGGGAGGCAACATGG + Intronic
1143847218 17:9781595-9781617 CTGTGGGGAAGAAGGAAACAGGG + Intronic
1144231093 17:13204650-13204672 AGGTGGAAAGGGAGCAAACAGGG + Intergenic
1145869274 17:28260149-28260171 GTGTGGAGAAGGAGGAAACAGGG - Intergenic
1147141788 17:38464571-38464593 CTGGGGAGAGGGAGGAAGGAGGG + Intronic
1147288785 17:39424739-39424761 CTGGGGATAGGAAAGAAAAAGGG + Intronic
1148516857 17:48227163-48227185 CTGTGAATGGAGAGGGAACATGG + Intronic
1149383118 17:56114110-56114132 ATATGAATATGGAGGAAACATGG - Intronic
1149640177 17:58197692-58197714 CTGGGGACAGGGAGGAACTACGG - Intronic
1151984137 17:77531299-77531321 GTGGGGATAGGCAGGAAACAGGG - Intergenic
1152209590 17:78996017-78996039 CCTTGGATAGGGAGGAAAGCGGG - Intronic
1154146524 18:11870883-11870905 CTGTTAATAGGAAAGAAACAGGG + Intronic
1154972521 18:21424812-21424834 CTGAGGAAAGGGATGAAACAGGG - Intronic
1155005015 18:21720991-21721013 GTGTGGATTGAGATGAAACAAGG + Intronic
1155868386 18:30995153-30995175 GTGAGGAAAGGGAGGAGACATGG - Intronic
1156451965 18:37271839-37271861 CTTGGCATAGGGAGGACACAGGG - Intronic
1157197008 18:45627623-45627645 CTGAGGAAGGGGAGCAAACAGGG + Intronic
1157366464 18:47069206-47069228 CTGTGGATACTAAGGAAACAAGG - Exonic
1157928732 18:51795474-51795496 CTGTGGATAAGGGGGAACTATGG - Intergenic
1157943563 18:51955077-51955099 CTGTGTAAAGGGAGGGAAAAGGG + Intergenic
1158270172 18:55704362-55704384 GTGGGGATGGGGAGGAAAAATGG + Intergenic
1159564146 18:70029140-70029162 CTTTGGCTAGGGAGGAAAAGAGG + Intronic
1159777138 18:72616263-72616285 CTACATATAGGGAGGAAACATGG - Intronic
1162733644 19:12734051-12734073 CTGTGGAGAATGAGGAAACGTGG - Intronic
1163362787 19:16858407-16858429 CCGTGACTAGGGAGGAATCAAGG - Intronic
1164191189 19:22918687-22918709 CTCTGAATAGGGAGTAAGCAGGG - Intergenic
1166801357 19:45459522-45459544 CTGTGGATAGGGTGTATATATGG + Intronic
1167291144 19:48625868-48625890 CTGTGGGAAGGGAGGAGAGAAGG - Intronic
1168375614 19:55876866-55876888 CTGTGGATATGGAGGACTGACGG + Intronic
925501793 2:4513072-4513094 ATGTGGGTAGTGAGGAAAAACGG + Intergenic
926344723 2:11934844-11934866 CTCTGAATTGGGAGGAAAGATGG + Intergenic
926902115 2:17763519-17763541 CAGTGGATTAGGAGGAAGCAGGG - Intronic
926983201 2:18593535-18593557 GTGGGGAGAGGGAGGAAAGAAGG - Intergenic
927126597 2:20017527-20017549 CTGTGAATAAGCAGAAAACATGG + Intergenic
927655625 2:24943070-24943092 CTGTGACCAGGGAGGAAAGATGG + Intergenic
927702146 2:25275544-25275566 CTGTGGAGAGGGAAGAACAAAGG + Intronic
929610105 2:43264696-43264718 CTCTGGATTGGGAGAAAAGAAGG + Intronic
931638243 2:64359836-64359858 CTGGAGAAAGGGATGAAACAGGG - Intergenic
932142012 2:69287392-69287414 ATGTGGGTAGGGAGGGAACAGGG - Intergenic
932179737 2:69635336-69635358 CTGTTGATGGGAATGAAACATGG + Intronic
935745690 2:106188508-106188530 CTCTGGAGAGGGTGGAATCAGGG + Intronic
935848486 2:107193016-107193038 CTGAGGGAAAGGAGGAAACAAGG + Intergenic
937081633 2:119144564-119144586 CAGTGGGCAGGGAAGAAACAAGG + Intergenic
937143898 2:119626184-119626206 GTCTGCATAGGAAGGAAACAGGG - Intronic
937220884 2:120342838-120342860 CTGTGGAAAGGGAGAGAATATGG - Intergenic
937226262 2:120371762-120371784 CTGGGGGGTGGGAGGAAACAGGG - Intergenic
937417518 2:121728279-121728301 CTGTGGATAGCCAGGTAAAATGG - Exonic
938248920 2:129798816-129798838 CTGTGTGCAGGGAGGACACAGGG - Intergenic
940243277 2:151586510-151586532 CTGTGGAGAGGAGGGAAATAGGG + Intronic
940244233 2:151597063-151597085 CTGTGGAGAGGAGGGAAATAGGG + Intronic
940245189 2:151607609-151607631 CTGTGGAGAGGAGGGAAATAGGG + Intronic
940683032 2:156810036-156810058 CTGTGGATAAGGAGGACATACGG - Intergenic
940700258 2:157032107-157032129 CTGTGGATGTGCAAGAAACAGGG - Intergenic
940754640 2:157668227-157668249 CTGAGGATATGGAGTAAAAAAGG - Intergenic
944315505 2:198281230-198281252 CTGGGGAGAGGGAGGAAATAGGG - Intronic
944673455 2:202015590-202015612 CTTTGGAGAGGCAGCAAACATGG - Intergenic
944688103 2:202135714-202135736 CTGTGGCTTGGAAGGAACCATGG - Intronic
944747651 2:202674674-202674696 CTGTGGATGGAGAAGAAACTGGG - Intronic
945281634 2:208040923-208040945 ATGTTGCTAGGGAGGAAAAAAGG - Intergenic
945309672 2:208296633-208296655 GTGTGAAAAGGGAGGAAATAAGG + Intronic
946940198 2:224762097-224762119 CTGTCATTAGGAAGGAAACATGG + Intergenic
947414066 2:229875184-229875206 CTGTGGATAGTGATGAAGGATGG + Intronic
1168907242 20:1416281-1416303 CTGTGATTAGGCAGGAAATATGG - Intergenic
1169087580 20:2836894-2836916 CTTTGGATTGGCAGGAAAGAGGG - Intronic
1169267329 20:4174657-4174679 CTGTGGTCAGGGAAGAAGCAGGG + Intronic
1170728162 20:18948253-18948275 CTGAGGAAAGGTAGGAAAAAGGG + Intergenic
1171294349 20:24004601-24004623 CAGTGGATAAGGAGATAACAGGG - Intergenic
1173041206 20:39464728-39464750 CTGTGGGTAGAGGGGAAAAAAGG - Intergenic
1174848417 20:53967148-53967170 ATGTGGACAGGGGGGCAACAAGG - Intronic
1175039198 20:56029863-56029885 CTGTGGATACAGAGAAAAGATGG + Intergenic
1176269896 20:64230847-64230869 CTGTGGAGAGAGAGAAAGCAGGG + Intronic
1177684857 21:24422799-24422821 CTGTGCATGTGGAGTAAACACGG + Intergenic
1178695154 21:34786412-34786434 CTGAGCACAGGTAGGAAACAGGG - Intergenic
1180119408 21:45736874-45736896 CAGTGGCTGTGGAGGAAACAGGG + Intronic
1181901011 22:26155876-26155898 GTATGGATAGGGAAGAAAAAAGG + Intergenic
1182046368 22:27277339-27277361 CAGTGGATACGGTGGCAACACGG + Intergenic
1184090884 22:42292486-42292508 CTGAGGATAGGGACATAACAAGG + Intronic
1184252925 22:43271148-43271170 TTGTGGAGAGGGTGGAAACAAGG - Intronic
1185258599 22:49849555-49849577 CTGCGGAGAGGGAGGAAGGAAGG + Intergenic
950145021 3:10642851-10642873 CAGTGTATGGGGAGGAAGCAGGG - Intronic
952702120 3:36338744-36338766 CTGTGTATAGTGTGGAGACAAGG + Intergenic
952947568 3:38489552-38489574 TTGTGGATTGGGAGGAGAGAGGG + Exonic
953666412 3:44929250-44929272 CTGGGGATGGGGAGGACCCAGGG - Intronic
954899771 3:54008818-54008840 CTGTGGGTAGGGAAGTAGCAGGG - Intergenic
955884813 3:63586492-63586514 CTGGGGATAGGGATGGAAGAAGG - Intronic
958018644 3:87971009-87971031 CTGTGGAAGGGGAGGAGGCAGGG - Intergenic
958537168 3:95418558-95418580 GTGTGGGTAGGGAGGGAACCCGG + Intergenic
958985705 3:100777283-100777305 CTGGAGAGAGGGAGGAAAGATGG + Intronic
959793897 3:110398437-110398459 CTGTGGATAAAGCAGAAACATGG - Intergenic
960176574 3:114524671-114524693 ATTTGGATAGGGAGGAGAAAGGG - Intronic
963315261 3:143751977-143751999 CTGGGGAGAGGGAAGAACCAGGG + Intronic
964826625 3:160835491-160835513 AGCTGAATAGGGAGGAAACAAGG - Intronic
966062117 3:175770585-175770607 ATGTGAAATGGGAGGAAACATGG + Intronic
966133002 3:176665838-176665860 GTGTGGATATGGAGGAAAAGTGG - Intergenic
966769623 3:183492229-183492251 CTGAGGAGAGGGAGGAAACACGG + Intronic
967890694 3:194362373-194362395 CTGTGGATAAGCATGGAACAAGG - Intronic
968814174 4:2813123-2813145 CTGGGAACAGGAAGGAAACAAGG + Intronic
968917396 4:3502542-3502564 CTGTGGAAAGCCAGGAAGCAGGG + Intergenic
970238275 4:13981113-13981135 CTGCGGATGGGGAGATAACAAGG + Intergenic
970430855 4:15987774-15987796 TTGTGGGAAGGGAGGACACAAGG - Intronic
972648876 4:40996369-40996391 ATGAGGATGGGGTGGAAACATGG - Intronic
973221355 4:47730873-47730895 GTGTGCATAGGGAGGTATCAAGG + Intronic
973962308 4:56123880-56123902 GTGTGGTTAGTCAGGAAACATGG - Intergenic
975459045 4:74629076-74629098 CTGTGGCCAGGCATGAAACAGGG - Intergenic
977583173 4:98746914-98746936 CAGTGGATAGGGAGGTGAAAAGG - Intergenic
977918057 4:102615053-102615075 AGGTGGACAGGAAGGAAACAAGG - Intronic
977982556 4:103342071-103342093 CCAAGGATAGGGAGGAAAAATGG + Intergenic
978431584 4:108638779-108638801 CTGTGGAGAGGAAGGGACCAAGG - Intergenic
978436645 4:108692795-108692817 CTGTGGATAGGGTGAGATCAAGG - Intergenic
978461602 4:108960530-108960552 CTGAGGATAGGGAAGAATCAAGG + Intronic
981358020 4:143814091-143814113 CTGTGGAACTGGAGTAAACATGG - Intergenic
981369265 4:143940202-143940224 CTGTGGAACTGGAGTAAACATGG - Intergenic
982088974 4:151864126-151864148 CTGTGGATTGGGAGGAGAGGTGG - Intergenic
982506574 4:156226314-156226336 CTGTGGAATGGGAGGAAATGTGG + Intergenic
983129114 4:163992923-163992945 CTGGTGAAAGGGAGGAAACCTGG + Intronic
984184456 4:176526307-176526329 ATGTGGGGAGGGAGAAAACAGGG + Intergenic
985182435 4:187279836-187279858 CTGAGGATAGGGCGGAGACTCGG + Intergenic
985698387 5:1356137-1356159 CTGGGCATTGGGATGAAACATGG + Intergenic
987363548 5:17128069-17128091 CTGAGTATAGGGAGGAAATATGG - Intronic
989633689 5:43512347-43512369 CTGTTTATAGGTAGGAAATAGGG - Intronic
991645786 5:68799295-68799317 CTATGAATTGGGAGCAAACATGG + Intergenic
992056124 5:72992591-72992613 CTATAGATAGGGAGAAAAGAAGG + Intronic
995391939 5:111649494-111649516 AAGTGGATGGGGAGGAAAAATGG + Intergenic
996100155 5:119437348-119437370 AGGGGGAAAGGGAGGAAACAGGG + Intergenic
997998890 5:138608449-138608471 AAGTGGATAGCTAGGAAACAGGG + Intergenic
998385412 5:141754510-141754532 CTGGGGGTATGGAGGAACCAAGG - Intergenic
1000426836 5:161101234-161101256 TTATTGATTGGGAGGAAACAAGG - Intergenic
1001311198 5:170612263-170612285 ATGTGGCTAGGGAGGAAATTTGG - Intronic
1002578992 5:180195853-180195875 CTGTGGGCAGGGAGGATGCACGG - Intronic
1003068514 6:2924377-2924399 CTTTAGGTAGTGAGGAAACACGG - Intergenic
1004601720 6:17156844-17156866 GTGTGGATAAGAAGGAAACCAGG - Intergenic
1005127880 6:22469845-22469867 CTGTGGGGAGGGAGGCAATAGGG + Intergenic
1005332614 6:24764410-24764432 CTGTGGAGAAGGAGGTAAGAGGG - Intergenic
1005936788 6:30529186-30529208 CTGTGGCCAGGAAGAAAACAAGG - Intergenic
1006104869 6:31710462-31710484 CTGGGGATGGAGAGGAAACACGG + Intronic
1006708983 6:36048645-36048667 CTGAGGAAAGGGAGAAATCAAGG + Intronic
1007172868 6:39876869-39876891 CTGGGGACAGGAAGGAAAGAGGG + Intronic
1007718888 6:43873679-43873701 CTGAGGTCAGGGAGGTAACAGGG + Intergenic
1009288461 6:61852982-61853004 GTGTGAAGATGGAGGAAACAGGG - Intronic
1010752331 6:79629639-79629661 CTGCAGATAGGGAGGATGCAGGG - Intergenic
1012500329 6:99881213-99881235 CGGTGTATATGGAGGAAAAATGG + Intergenic
1013591457 6:111622471-111622493 CTGTGGGTATGGTGGAAAGAAGG + Intergenic
1015906076 6:138118178-138118200 CTGTGTACAGGCAGGAGACAAGG - Intergenic
1016047962 6:139499719-139499741 CTGTCAATATAGAGGAAACAGGG - Intergenic
1016234455 6:141846238-141846260 GTGTGGATAGGGATGCAATATGG + Intergenic
1018453062 6:163926826-163926848 CTGTTGGCTGGGAGGAAACATGG + Intergenic
1020034050 7:4953135-4953157 CTGTAGGGATGGAGGAAACAGGG - Intronic
1020938081 7:14493229-14493251 CTGTAGATAAGGGGAAAACATGG - Intronic
1021703358 7:23342070-23342092 CTGCGGGTAGGGAGGAGTCATGG + Exonic
1022611625 7:31880746-31880768 CTGTGTATATTGATGAAACAAGG - Exonic
1023081463 7:36530513-36530535 CTCTGAAGAGAGAGGAAACAGGG + Exonic
1023130241 7:36995912-36995934 CTCTGCATGGGGAGGAGACAAGG - Intronic
1023708199 7:42964465-42964487 CTGTAGATAATGAGGTAACAGGG + Intergenic
1024425432 7:49220090-49220112 CTGAGGCTAGGGAGGAAGAAGGG + Intergenic
1026101271 7:67386439-67386461 CTCAGGATAGAAAGGAAACAAGG + Intergenic
1027217911 7:76196040-76196062 CTGGGGAGGGGGAGGACACAGGG + Intergenic
1027230884 7:76271713-76271735 CTGTGGAGAGGGTGGAAAATGGG + Intronic
1028025654 7:85834946-85834968 CTCTGGATAGGAAGGACACAAGG + Intergenic
1029601093 7:101563885-101563907 CTGTGGAGAGGGAGGAGGGAAGG - Intergenic
1030328510 7:108247835-108247857 CTGGAGAAAGGGAGGAAAGAGGG + Intronic
1030699742 7:112624938-112624960 CTGGTGATAGGGAGGAAAATTGG + Intergenic
1031184589 7:118460482-118460504 CTGTGGGAAGGCAGGAAATAAGG - Intergenic
1033017105 7:137682556-137682578 CTGTGGATTGGGAGGAAGAAGGG - Intronic
1034062754 7:148108089-148108111 CTCTGGGGAGGGAGGAGACAGGG + Intronic
1035447469 7:158952604-158952626 CTGTGGACAGGGAGAAAAGGAGG + Intronic
1035543386 8:459399-459421 TGGTGGATAGTGAGGAAGCACGG + Intronic
1035881148 8:3245220-3245242 CTGTGGACAGGGAGGACTCAAGG - Intronic
1035912550 8:3583491-3583513 CTGTGATTAGGTAGGAAGCAGGG + Intronic
1037606250 8:20439861-20439883 CTGTGGAAGAGGAAGAAACATGG - Intergenic
1038437445 8:27545829-27545851 CTGTGTATAGGGAGAAAGCCAGG + Intergenic
1040078020 8:43259932-43259954 CTGTGGATCTGCAGGATACATGG + Intergenic
1040470431 8:47731750-47731772 CTGGGGGTAGGGAGGAAGAAAGG + Intronic
1040482281 8:47836965-47836987 CTGTGGATTGGGAGGAATGAGGG + Intronic
1041374685 8:57202141-57202163 CTGTGGATAGGGAGCCAACCAGG + Intergenic
1041853909 8:62426907-62426929 ATGTGGATAAGGTGGAAACATGG + Intronic
1042044411 8:64632410-64632432 CTGGGGAGAGGGAGGAAATGGGG + Intronic
1042205603 8:66327073-66327095 GTGTGGAGAAGGAGGAAATAGGG - Intergenic
1044794365 8:95881615-95881637 TTGGGGGTAGGGAGGAAAAAGGG + Intergenic
1045059382 8:98398789-98398811 GTGTGGATCTGGAAGAAACAGGG - Intergenic
1045820550 8:106332047-106332069 CTGAGGATGGGGAGGAAGAAGGG - Intronic
1046212293 8:111092706-111092728 CTGTGGATATGGAAGCAAAAGGG - Intergenic
1048337322 8:133512707-133512729 CTGAGGGTCGGGAGGAGACAGGG + Intronic
1049043441 8:140129952-140129974 CTGTGGCTTCGGAGGAATCAGGG + Intronic
1049130198 8:140832680-140832702 CTGTGGACAAAGAGGCAACAGGG + Intronic
1049161144 8:141098736-141098758 CTGAGGTCAGGGAGGTAACACGG - Intergenic
1049622485 8:143604914-143604936 CTTAGGATTGGGAGGAAAGAGGG + Exonic
1051029189 9:12654005-12654027 CAGTGGACAGTTAGGAAACATGG + Intergenic
1051130679 9:13856600-13856622 CTGTGAAGAGGTAGGAAAGATGG - Intergenic
1052994894 9:34546713-34546735 CTGAGGATGGGGAGGAGAAATGG - Intergenic
1058549054 9:106093705-106093727 ATGTAGACAGGGAAGAAACAAGG + Intergenic
1061857656 9:133451233-133451255 AAGTGGACAGGAAGGAAACATGG - Intronic
1062127467 9:134871345-134871367 CTGTCGAGAAGGAGGACACAGGG - Intergenic
1062422234 9:136488346-136488368 CTGTAGATAGGGAAGAGAAAAGG + Intergenic
1185449610 X:275393-275415 CTGGGGTGAGGGAGGAAACAGGG + Intergenic
1186298831 X:8177129-8177151 CTGTGTATAGTGTGGAGACAGGG + Intergenic
1190254416 X:48751885-48751907 CAGTGGATGGGGAAGAAGCACGG + Intergenic
1190477039 X:50838887-50838909 CTGTACATAGAGAGGAAATATGG - Intergenic
1190595544 X:52050042-52050064 ATGTAGAAAAGGAGGAAACAAGG + Intergenic
1190613280 X:52204031-52204053 ATGTAGAAAAGGAGGAAACAAGG - Intergenic
1190623566 X:52313644-52313666 CTGTTGATCAGCAGGAAACATGG - Intergenic
1190901026 X:54673148-54673170 CTGGGGTCAGGAAGGAAACAGGG - Intergenic
1191881530 X:65847796-65847818 CTGTGGATAGAGGGGATATATGG - Intergenic
1192554412 X:72078538-72078560 CTGTGGTTAGAGAGGAAAGAGGG - Intergenic
1192639438 X:72848002-72848024 CTGTGGGTAGTGAGGAGCCAGGG + Intronic
1192642273 X:72872803-72872825 CTGTGGGTAGTGAGGAGCCAGGG - Intronic
1195240863 X:102950478-102950500 CTGTTGATAGGGAGATAACAAGG - Intergenic
1195614342 X:106900909-106900931 CTGTGGACAGAGAAGAAACATGG + Intronic
1196794797 X:119493542-119493564 CTGTGGGTGGCGAGGGAACAGGG - Intergenic
1197230275 X:123996543-123996565 CTATGGTTGGGGAGGAAAGAAGG - Intronic
1197494303 X:127158647-127158669 CTGGGGAGAGGGAGAAAAGATGG + Intergenic
1198429672 X:136553071-136553093 CTGGGCAGAGGGAGGTAACATGG + Intronic
1200307962 X:155047719-155047741 CTATGGACAGGGGGGAAATAAGG - Intronic