ID: 1133319695

View in Genome Browser
Species Human (GRCh38)
Location 16:4905281-4905303
Sequence AGGCTTGTTCAGATGGAGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 183}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133319695_1133319698 -4 Left 1133319695 16:4905281-4905303 CCGTGCTCCATCTGAACAAGCCT 0: 1
1: 0
2: 0
3: 14
4: 183
Right 1133319698 16:4905300-4905322 GCCTGGAAGACGTTATTCAAAGG 0: 2
1: 0
2: 0
3: 11
4: 85
1133319695_1133319703 29 Left 1133319695 16:4905281-4905303 CCGTGCTCCATCTGAACAAGCCT 0: 1
1: 0
2: 0
3: 14
4: 183
Right 1133319703 16:4905333-4905355 AGACAGAGCCCACATGGTGTGGG 0: 1
1: 0
2: 3
3: 17
4: 188
1133319695_1133319700 23 Left 1133319695 16:4905281-4905303 CCGTGCTCCATCTGAACAAGCCT 0: 1
1: 0
2: 0
3: 14
4: 183
Right 1133319700 16:4905327-4905349 GAAGCCAGACAGAGCCCACATGG 0: 1
1: 0
2: 0
3: 30
4: 327
1133319695_1133319702 28 Left 1133319695 16:4905281-4905303 CCGTGCTCCATCTGAACAAGCCT 0: 1
1: 0
2: 0
3: 14
4: 183
Right 1133319702 16:4905332-4905354 CAGACAGAGCCCACATGGTGTGG 0: 1
1: 0
2: 2
3: 14
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133319695 Original CRISPR AGGCTTGTTCAGATGGAGCA CGG (reversed) Intronic
900033315 1:386841-386863 ATGAGTGTTCTGATGGAGCAGGG - Intergenic
900054153 1:616730-616752 ATGAGTGTTCTGATGGAGCAGGG - Intergenic
900790181 1:4674835-4674857 AGGCGCGTGCAGATGAAGCAAGG - Intronic
901892540 1:12279842-12279864 AGCCTTTTTCATATGGAGGAGGG + Intronic
903211636 1:21822380-21822402 AGGCTCCTGCAGATGGGGCAGGG + Exonic
903260466 1:22129129-22129151 AGGGTTGTTCAGGTGTACCAAGG + Intronic
903622047 1:24704917-24704939 CGGCTAGTTCAGAAGGAGAAAGG - Intergenic
907185686 1:52607452-52607474 AGGCTTCTGCAGCTGGAGAAGGG - Intronic
907267108 1:53269148-53269170 AAGCTGGTACAGTTGGAGCAAGG - Intronic
910898639 1:92095369-92095391 AGGGTTGGTCAGAAGGAGCAAGG - Intronic
912666006 1:111580316-111580338 TGGCTAGATAAGATGGAGCATGG + Intronic
915909110 1:159901284-159901306 AGGCTTAATCAGAGGGAGAAGGG + Intergenic
916246029 1:162689034-162689056 AGGCTGGTTGACATGGAGCTTGG + Intronic
917999971 1:180484487-180484509 AGGGTTGTTCTGTTGGAGAAAGG + Intronic
921959749 1:221022261-221022283 AGGCTTGTACAAAAGGAACAGGG + Intergenic
922094567 1:222432019-222432041 AGGAGTCTTCAGATGGGGCAGGG - Intergenic
922255675 1:223890995-223891017 ATGAGTGTTCTGATGGAGCAGGG - Intergenic
924336870 1:242993860-242993882 ATGAGTGTTCTGATGGAGCAGGG - Intergenic
924876784 1:248115004-248115026 TGGCTACTTCAAATGGAGCAGGG + Intergenic
1063771730 10:9211348-9211370 AGACTTGTTAAGAGAGAGCATGG + Intergenic
1065538643 10:26739132-26739154 AGGCCTGTGCAGCTGGTGCAGGG - Intronic
1066063522 10:31745187-31745209 AGGCTTGAAGAGAAGGAGCAAGG - Intergenic
1066139554 10:32489718-32489740 AGGCTGGTGCAGAGTGAGCATGG + Intronic
1068610762 10:59057480-59057502 ATGCTTTTTCAGATGGAGATTGG + Intergenic
1070007014 10:72434338-72434360 AGGCTTATTCATATTGATCAAGG - Intronic
1070421218 10:76239129-76239151 AGCCCTGTGCAGAGGGAGCATGG + Intronic
1071602270 10:86964176-86964198 AGGCTTGTTCAGAGTGGGCTGGG - Intronic
1073642550 10:105267784-105267806 AGCCTTATTCAGAGGGAGGAAGG + Intergenic
1075655138 10:124156280-124156302 AGGCTTGTGCCAAGGGAGCAGGG - Intergenic
1076028831 10:127140909-127140931 CGGCTTGTTCAGATAGTGCCTGG + Intronic
1076379975 10:130018274-130018296 AGGCTTCTTCAGAATGAGCTAGG + Intergenic
1078671460 11:13369456-13369478 AGGCTTTAACAGATGCAGCATGG - Intronic
1080052462 11:27871139-27871161 AGGCTGGTGCAGCTGGAGCCGGG + Intergenic
1080451150 11:32380025-32380047 AGGCTTGTTCAGGCGGGCCAGGG - Intergenic
1084770019 11:71336609-71336631 AGGCTTGCCCAGAGGCAGCACGG + Intergenic
1085888698 11:80552031-80552053 AGGCATGTTTATCTGGAGCATGG + Intergenic
1086452162 11:86927679-86927701 AGGGTAGTTCAGAAGGAGAAAGG - Intronic
1088070280 11:105775143-105775165 AGGCATGTGAAGATGGAGCTGGG - Intronic
1089407766 11:118212688-118212710 AGGCATGTTCAAAGGCAGCATGG + Intronic
1090185259 11:124734891-124734913 GGGTTTGTTCAGATGGCTCAAGG - Intergenic
1091840890 12:3619765-3619787 AGGCTTAGTCCGATGGACCAAGG + Intronic
1096084787 12:48858122-48858144 AGGCTTGTTCAGACACAGCATGG + Exonic
1100523186 12:95396089-95396111 AGGCTTTTTCACATGGTGCCTGG - Intergenic
1104533220 12:129592755-129592777 ACGTTTGTGAAGATGGAGCAAGG + Intronic
1106096339 13:26648161-26648183 AGGCTTCTTCATAATGAGCAGGG + Intronic
1107170305 13:37333559-37333581 AGCCTTGATCAGATTTAGCACGG + Intergenic
1111395697 13:87666509-87666531 AGATTTTTTCAGATGGAGAAAGG + Intergenic
1112243032 13:97701393-97701415 AGGTTTCTTCAGATTGAGTAAGG - Intergenic
1113036195 13:106052471-106052493 AGGCTGGTGCACAGGGAGCAGGG - Intergenic
1113708040 13:112446769-112446791 AGGCTTGTTCTGCTGGTCCAAGG + Intergenic
1114059557 14:19006997-19007019 AGGCTTGTGCAGGCCGAGCAAGG - Intergenic
1114102989 14:19394754-19394776 AGGCTTGTGCAGGCCGAGCAAGG + Intergenic
1115012705 14:28569250-28569272 AGTCATGTTCAGAGTGAGCAGGG + Intergenic
1116292297 14:43059518-43059540 AGGGCAGTTCTGATGGAGCATGG - Intergenic
1118740963 14:68738831-68738853 AGGGTGGTTGAGATGGAGCTTGG - Intergenic
1119958059 14:78822376-78822398 AGACTTGTTCATATGGAGGCTGG + Intronic
1123398725 15:19963245-19963267 GGGCTTGCTCAGCTGGAGAATGG + Intergenic
1124835832 15:33195094-33195116 GGACTTGTTCAGATGGGGGAAGG + Intergenic
1126174962 15:45727709-45727731 AGGATTGAATAGATGGAGCATGG + Intergenic
1127625163 15:60773152-60773174 AGACTTGTCAAGATGGATCAAGG - Intronic
1128780717 15:70357128-70357150 AGGCCTCTTCTGAGGGAGCAGGG - Intergenic
1132215609 15:100059517-100059539 ATGATTTTTCAGATGGACCACGG - Intronic
1133319695 16:4905281-4905303 AGGCTTGTTCAGATGGAGCACGG - Intronic
1133447731 16:5876572-5876594 AGGCTGGTTTAGCTGTAGCAGGG - Intergenic
1133738103 16:8630941-8630963 TGGCTTGTGAAGATGGAGCTGGG - Intronic
1134222111 16:12362996-12363018 AGACTTGGGCAGAGGGAGCATGG - Intronic
1135220547 16:20611171-20611193 AGGCTTGTTCAGAGGATGCCTGG + Intronic
1135329037 16:21545887-21545909 GGGCTGGTCCAGATGGAGCTGGG - Intergenic
1135985294 16:27179466-27179488 AGGCATTTTCAAAGGGAGCAAGG + Intergenic
1136339383 16:29631864-29631886 GGGCTGGTCCAGATGGAGCTGGG - Intergenic
1137863048 16:51866032-51866054 AGGCATCTTCAGATGAAGCAGGG + Intergenic
1139219351 16:65164128-65164150 AGGCTTCATGAGATGGTGCATGG + Intergenic
1142042049 16:87900451-87900473 AGGCTGGTCCAGATGGAGCTGGG - Intronic
1143259693 17:5588827-5588849 TGGCTACTTCAAATGGAGCAGGG + Intronic
1143903949 17:10195341-10195363 TTCCTTGTTCAGATGAAGCAAGG - Intronic
1152815230 17:82404012-82404034 GGGCTTGGTCAGATGCAGCGAGG + Exonic
1155784273 18:29877516-29877538 TGGCTACTTCAAATGGAGCAGGG - Intergenic
1156485796 18:37464750-37464772 TGGCTGGTTCACAGGGAGCAAGG + Intronic
1156579632 18:38359858-38359880 AGGCTGTGTCAGATGGAGTAAGG - Intergenic
1156850849 18:41724576-41724598 AGGCTTGTTAAGAGTGAGGAAGG - Intergenic
1158617154 18:58998654-58998676 AGGCTCCTACAGATGGAACAAGG - Intergenic
1159988711 18:74876785-74876807 CGGCTTGTACGGCTGGAGCAGGG - Intronic
1162148437 19:8628234-8628256 AGGGTCCTTCAGAAGGAGCATGG - Intergenic
1163828535 19:19536961-19536983 AGGCTGGGTCAGATGGAGGAGGG + Intronic
1164403744 19:27923196-27923218 AGGCACGCTCAGATGGAGCTAGG - Intergenic
1165693202 19:37880046-37880068 TGGATTGTTCTGATAGAGCAGGG - Intergenic
926786286 2:16521551-16521573 AGGCTTGATCAGAAGGATCATGG - Intergenic
927577155 2:24209312-24209334 AGCCTTGTTGAGAAGGAGAAAGG + Intronic
929400399 2:41573841-41573863 AGGCTTACTCAGTTGGAGGAAGG - Intergenic
933401191 2:81797656-81797678 AGGCTTGTACAAATTGAGTATGG + Intergenic
936061613 2:109298651-109298673 AGGCCTGGCCAGAGGGAGCACGG - Intronic
936408812 2:112235592-112235614 AGGCTTGGTCATATGGGACAAGG - Intronic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
940468175 2:154059427-154059449 AGGCTTGATCAGAAATAGCATGG + Intronic
945556922 2:211288304-211288326 GGGCTTGTTCTAATGGAGAAAGG + Intergenic
947758663 2:232587742-232587764 AGGCTGGGTGAGATGGAGAAAGG - Intergenic
947981584 2:234414973-234414995 ATGCTGGTTCAAATGGAGCAAGG - Intergenic
1168962602 20:1879494-1879516 AGGCCTCTTCAGCTGGAGCCTGG + Intergenic
1169641479 20:7757222-7757244 AGGCTTCTTGAGGTGGAACAGGG + Intergenic
1171361005 20:24586349-24586371 ATGCTTGTGCTGATGGAGAAGGG - Intronic
1173307740 20:41866185-41866207 AGGCTTGTTCACATGGTGTCTGG + Intergenic
1176745414 21:10647988-10648010 GGGCTTGTTCAGCTGGAGAATGG + Intergenic
1177251978 21:18604404-18604426 AGGCATGTTCACAGGTAGCAAGG + Intergenic
1178491752 21:33057012-33057034 GGGCCTGTGCAGTTGGAGCAAGG + Intergenic
1178682964 21:34688682-34688704 AGGCTTGGGCAGAGGGTGCAGGG + Intronic
1178789369 21:35685228-35685250 AGGGTTGTCCACATGGAGAAGGG + Intronic
1179169188 21:38959544-38959566 ACTCTTCTTCAGAGGGAGCAGGG + Intergenic
1179384235 21:40927278-40927300 GGGAGTGTTCAAATGGAGCAGGG - Intergenic
1179625245 21:42645597-42645619 AGCTTTGTACAGAAGGAGCAAGG + Intergenic
1180478037 22:15729612-15729634 AGGCTTGTGCAGGCCGAGCAAGG - Intergenic
1181016487 22:20072217-20072239 AAGCATCTTCAGATGGAGTAGGG + Intergenic
1181915609 22:26277416-26277438 ACGGTCGTACAGATGGAGCAGGG - Intronic
1182016894 22:27047939-27047961 GGGCTTGTTCTCATGGTGCATGG + Intergenic
1182768574 22:32776675-32776697 AGGGTAGTGCAGAGGGAGCATGG - Intronic
1182963942 22:34504179-34504201 AGGCTGGTAGAGAGGGAGCAGGG + Intergenic
1183669657 22:39264911-39264933 AGATTTGGTCAGATGGAGGAGGG - Intergenic
1185159869 22:49217110-49217132 TAGCTTGTTCTGATGGAGCATGG - Intergenic
953976729 3:47387164-47387186 AGGCTTGCTGACATGGACCAAGG + Intronic
954874058 3:53789596-53789618 TGGCCTGTTGAGATGGAGGATGG + Intronic
955343938 3:58147113-58147135 AGACTTGTTGAGGAGGAGCAGGG + Intronic
961001520 3:123377322-123377344 AGCCCTGTTAGGATGGAGCAGGG - Intronic
964401348 3:156302482-156302504 AGACTTGTCCAGGTGAAGCAAGG + Intronic
969695297 4:8730864-8730886 AGGCATGTTCACCTGGAGCCCGG + Intergenic
972675534 4:41256855-41256877 AGGCCTGTGCAGGGGGAGCAGGG - Exonic
976329457 4:83812727-83812749 ATACTGGTTCAGCTGGAGCAAGG - Intergenic
979240253 4:118441444-118441466 ATGAGTGTTCTGATGGAGCAGGG + Intergenic
979835695 4:125364710-125364732 AGGTTTTTTCAGCTGGTGCATGG + Intronic
982338739 4:154270939-154270961 AGATTTGTTCAGATAGAGCAGGG + Intronic
983414148 4:167434603-167434625 AGGCTAGTTCAGCTGAAGTATGG - Intergenic
984168129 4:176327528-176327550 GGGCTTGTTCAGATGCGGTAGGG + Intronic
985574070 5:665619-665641 AGGCTTGGTCTGAAGGGGCATGG - Intronic
986293680 5:6420187-6420209 TGGCATCTTCAGAGGGAGCATGG - Intergenic
990035387 5:51311829-51311851 AGGCTTGGTCAGAAGGTACATGG + Intergenic
991664552 5:68985612-68985634 TGGGTTGTTCAGATTTAGCATGG - Intergenic
992132704 5:73709503-73709525 AAGCTTGTTCCTATTGAGCAAGG + Intronic
994860814 5:105190518-105190540 AAGCTTGTTGAGGTGGTGCATGG - Intergenic
996487123 5:124049520-124049542 AGGCTGGTTCTGGTGGAGTAGGG + Intergenic
996535042 5:124569087-124569109 AGGCTAGTGCACATGGAGCCAGG - Intergenic
997146832 5:131443562-131443584 AGGTTTGTGCAGAAGGAGAAGGG - Intronic
997528506 5:134568424-134568446 TGGCTGGTTCAGGTGGAGCCTGG + Intronic
1000345099 5:160307775-160307797 GGGCTTCTGCAGATGCAGCAGGG + Intronic
1002740505 5:181432027-181432049 ATGAGTGTTCTGATGGAGCAGGG + Intergenic
1004019178 6:11761019-11761041 TGGCTGGTTCAGATTGAGGAGGG - Intronic
1006963613 6:37959679-37959701 ATGCTTGTCCATATGAAGCAAGG - Intronic
1007023159 6:38543087-38543109 AGGCTTGTACAGGTAGAACATGG - Intronic
1007113586 6:39327902-39327924 AGGCTCGTTCAGATGGAAAGAGG - Intergenic
1010495142 6:76525361-76525383 AGGCTTGTTCACATGGTGGCTGG + Intergenic
1014249311 6:119099483-119099505 GGTCTTATTGAGATGGAGCAGGG - Intronic
1014486601 6:122006888-122006910 AGGTGTGTTCAGATGGGGAAAGG + Intergenic
1016619608 6:146092729-146092751 CTGCTTCTTCAGATGCAGCAGGG - Intronic
1019245615 6:170707628-170707650 ATGAGTGTTCTGATGGAGCAGGG + Intergenic
1022487609 7:30791673-30791695 AGGCTTGTTCTGAGAGACCAAGG - Intronic
1022684815 7:32586699-32586721 AGCCTTTTTCAGATGGCGCCAGG + Exonic
1023215565 7:37859009-37859031 AAGCTTGTTCTCATGGAGGAAGG - Intronic
1024659531 7:51479435-51479457 AGTCTGGCTGAGATGGAGCACGG - Intergenic
1026540791 7:71278364-71278386 AGGATTCTTCAGAAGGAGCGTGG - Intronic
1027703395 7:81497670-81497692 AATCTTGTTCAGATGTATCATGG - Intergenic
1027954648 7:84862971-84862993 AGTCTTGCTCTGCTGGAGCAAGG - Intergenic
1028345730 7:89779858-89779880 AGGCTTTTTCAGCTGGAGGGTGG - Intergenic
1030757186 7:113301320-113301342 AGGGTTGAACAGATGAAGCACGG - Intergenic
1030765354 7:113402409-113402431 AAGCTTCTTAAGATGGAGGAGGG - Intergenic
1033831512 7:145259856-145259878 AGGCTTGTTAACATGGTGCTTGG + Intergenic
1034136767 7:148778174-148778196 ACAGTTCTTCAGATGGAGCATGG - Intronic
1034738349 7:153450224-153450246 AGGCTTGTGCAGAGGGAGAAAGG + Intergenic
1035114047 7:156507759-156507781 AGGCTAGTTAAGATGGGGAAAGG - Intergenic
1035502509 8:100574-100596 ATGAGTGTTCTGATGGAGCAGGG - Intergenic
1036772979 8:11591795-11591817 GGGCCTGTTCAGAGGGAGTAAGG + Intergenic
1037298999 8:17431840-17431862 AGGCTTGCTCAGATAGGGCCGGG + Intergenic
1037613095 8:20492993-20493015 ATTGGTGTTCAGATGGAGCATGG - Intergenic
1040439911 8:47430322-47430344 AGGCATGTCCAAATGGAGCATGG - Intronic
1041624767 8:60013194-60013216 AACCTTGTTCAGATGGTGCAGGG - Intergenic
1045384247 8:101655990-101656012 AGCCTTGTCCATATGGAGGAAGG - Intronic
1045861769 8:106821451-106821473 AGGATTGATCATATGAAGCATGG - Intergenic
1046057676 8:109098084-109098106 AGGCTTCTTCACATGTGGCAAGG - Intronic
1047039800 8:120980296-120980318 AGCCTTGTGCATATGGAGAATGG + Intergenic
1047689739 8:127339633-127339655 AGGAATGTACAGATGGAGCTAGG + Intergenic
1049178252 8:141206929-141206951 AGGCCTGTTCTGGTGGAGCCGGG - Intergenic
1049899895 9:149428-149450 AGGCTTTTACAGATGGAGTAGGG - Intronic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1055196237 9:73597879-73597901 AGGCATGTTCAGAAGGCACAAGG + Intergenic
1056926110 9:90835712-90835734 TGGCTGCTTCAGATGGAGCTTGG - Intronic
1057914222 9:99043303-99043325 AGGCCTGTGGAGATGGACCAGGG + Intronic
1058478369 9:105364557-105364579 AGTCCTGTTCAGAATGAGCAAGG + Exonic
1060218564 9:121752669-121752691 GGGCCTGGTCAGGTGGAGCAGGG + Intronic
1060370024 9:123059921-123059943 AGTCTTGGTAAGATGAAGCATGG + Intronic
1061832823 9:133306609-133306631 GGGCTGGTTCAGGTGCAGCAGGG - Intergenic
1061986434 9:134132755-134132777 AGGCTTGTTGGGAGGGTGCAAGG + Intergenic
1062250372 9:135590927-135590949 GGGGTTGTTCAGATGAAGCCCGG - Intergenic
1203605814 Un_KI270748v1:56835-56857 ATGAGTGTTCTGATGGAGCAGGG + Intergenic
1187023509 X:15408802-15408824 AGGCGAGTGCAGAAGGAGCAAGG + Intronic
1190061821 X:47216557-47216579 AAGCTTGTTTTGATGGAGAAGGG - Intergenic
1197986371 X:132270165-132270187 TGGGATGTTCAGAGGGAGCAGGG - Intergenic
1202387987 Y:24343273-24343295 ATGACTGTTCTGATGGAGCATGG + Intergenic
1202482800 Y:25326855-25326877 ATGACTGTTCTGATGGAGCATGG - Intergenic