ID: 1133321796

View in Genome Browser
Species Human (GRCh38)
Location 16:4918787-4918809
Sequence GTGTGCCCCTTGGAGAGCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 120}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133321785_1133321796 13 Left 1133321785 16:4918751-4918773 CCCCCCACCATCCAGCTGGCCGC 0: 1
1: 0
2: 1
3: 28
4: 391
Right 1133321796 16:4918787-4918809 GTGTGCCCCTTGGAGAGCTATGG 0: 1
1: 0
2: 0
3: 11
4: 120
1133321788_1133321796 10 Left 1133321788 16:4918754-4918776 CCCACCATCCAGCTGGCCGCAGG 0: 1
1: 0
2: 2
3: 13
4: 201
Right 1133321796 16:4918787-4918809 GTGTGCCCCTTGGAGAGCTATGG 0: 1
1: 0
2: 0
3: 11
4: 120
1133321790_1133321796 9 Left 1133321790 16:4918755-4918777 CCACCATCCAGCTGGCCGCAGGA 0: 1
1: 0
2: 0
3: 27
4: 175
Right 1133321796 16:4918787-4918809 GTGTGCCCCTTGGAGAGCTATGG 0: 1
1: 0
2: 0
3: 11
4: 120
1133321792_1133321796 2 Left 1133321792 16:4918762-4918784 CCAGCTGGCCGCAGGAATCAACC 0: 1
1: 0
2: 1
3: 5
4: 76
Right 1133321796 16:4918787-4918809 GTGTGCCCCTTGGAGAGCTATGG 0: 1
1: 0
2: 0
3: 11
4: 120
1133321783_1133321796 21 Left 1133321783 16:4918743-4918765 CCTGTGTTCCCCCCACCATCCAG 0: 1
1: 0
2: 1
3: 27
4: 275
Right 1133321796 16:4918787-4918809 GTGTGCCCCTTGGAGAGCTATGG 0: 1
1: 0
2: 0
3: 11
4: 120
1133321787_1133321796 11 Left 1133321787 16:4918753-4918775 CCCCACCATCCAGCTGGCCGCAG 0: 1
1: 0
2: 1
3: 29
4: 300
Right 1133321796 16:4918787-4918809 GTGTGCCCCTTGGAGAGCTATGG 0: 1
1: 0
2: 0
3: 11
4: 120
1133321786_1133321796 12 Left 1133321786 16:4918752-4918774 CCCCCACCATCCAGCTGGCCGCA 0: 1
1: 0
2: 3
3: 39
4: 566
Right 1133321796 16:4918787-4918809 GTGTGCCCCTTGGAGAGCTATGG 0: 1
1: 0
2: 0
3: 11
4: 120
1133321791_1133321796 6 Left 1133321791 16:4918758-4918780 CCATCCAGCTGGCCGCAGGAATC 0: 1
1: 0
2: 0
3: 4
4: 124
Right 1133321796 16:4918787-4918809 GTGTGCCCCTTGGAGAGCTATGG 0: 1
1: 0
2: 0
3: 11
4: 120
1133321793_1133321796 -6 Left 1133321793 16:4918770-4918792 CCGCAGGAATCAACCATGTGTGC 0: 1
1: 0
2: 0
3: 10
4: 137
Right 1133321796 16:4918787-4918809 GTGTGCCCCTTGGAGAGCTATGG 0: 1
1: 0
2: 0
3: 11
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133321796 Original CRISPR GTGTGCCCCTTGGAGAGCTA TGG Intronic
900795025 1:4702679-4702701 GTGTGGCCCTTGGTGTGCTGGGG + Intronic
901072217 1:6526756-6526778 CTGTGCCCCCGGAAGAGCTAAGG - Exonic
901479708 1:9516603-9516625 GTGTGACCCTTGAATAGCCACGG - Intergenic
902687323 1:18086915-18086937 GTGTGCTCACTGGAGAGCTGTGG + Intergenic
906248733 1:44295128-44295150 GTGTGCTCCATGGAGTTCTAGGG + Intronic
915162948 1:153932646-153932668 ATGTGCCCGTTGCAGAGCTGGGG + Exonic
917917301 1:179715562-179715584 TTGTGCCCCTTGCAGTGCTATGG + Intergenic
922603540 1:226874585-226874607 ATGTGCCTCTTGGAAAGTTACGG - Intronic
923069516 1:230549702-230549724 ATGAGCCACTTGGAGGGCTAAGG - Intergenic
923771496 1:236941799-236941821 GTGTGCCCACTGGAGAGCAGAGG - Intergenic
1064031304 10:11885151-11885173 CTGTGACACTTGCAGAGCTATGG + Intergenic
1066561998 10:36679585-36679607 GTGTGCTCCTGGCAGAGCCAGGG + Intergenic
1067073776 10:43160300-43160322 GTGCACCCCTTGGAGGGCCATGG - Intronic
1068711609 10:60141142-60141164 AAGTGCCTCTTGGAGAGTTATGG - Intronic
1068918385 10:62457973-62457995 ATGTCTCCCTGGGAGAGCTAAGG - Intronic
1069839406 10:71329922-71329944 GTTTCCCCCTTGGAGAATTAGGG + Intronic
1072627472 10:97122382-97122404 CTGTTTCCCTTGGAGAGCTGGGG - Intronic
1072810426 10:98457381-98457403 GGGTGCCCCTGGGCGAGCCATGG + Intronic
1073328438 10:102656150-102656172 ATGTGCCCCCGGGAGGGCTAGGG - Intronic
1073780164 10:106828914-106828936 TTGTGCCCATTGCAGAGTTATGG - Intronic
1073891905 10:108112139-108112161 CTGTGACCCTTGGAGGGGTAAGG + Intergenic
1074942040 10:118245579-118245601 GTGTGTGCCTTCCAGAGCTATGG - Intergenic
1076732171 10:132444401-132444423 GAGTGGCCCTTGGAGACCTCAGG - Intronic
1078615157 11:12857987-12858009 CCGTGCTACTTGGAGAGCTAAGG + Intronic
1078937822 11:15967246-15967268 GTGTGGCCCTTGAATTGCTAAGG - Exonic
1084030192 11:66476464-66476486 GTGTGCCCCTGGGGGAGTGAAGG + Exonic
1084383828 11:68829771-68829793 GTGTGCCCCTGGGCCAGCTATGG + Intronic
1089735827 11:120549686-120549708 GTGGGCCCCTGGGAGATCTGGGG + Intronic
1091669011 12:2439074-2439096 GTGAGCTCCTTGGAGAGTTTGGG + Intronic
1091691323 12:2599340-2599362 ATGTCCCCCTTGGACAGCCACGG - Intronic
1096374395 12:51096293-51096315 GTGTGCTCCTTGGAGAGTCTTGG - Intronic
1096633792 12:52945932-52945954 GAGAGCCTCTTGGAGAGCTGGGG - Intronic
1096636109 12:52960652-52960674 GTGGGCCCCAAGGAGACCTAAGG - Intergenic
1106793541 13:33181146-33181168 CTATGCCCCTTGGAGGCCTAAGG + Intronic
1113424790 13:110199164-110199186 ATGTGCCCCTGGGAGAGCTGAGG + Intronic
1113445810 13:110365663-110365685 GGGTGACTCTTGGAGAGCCAAGG - Intronic
1118708065 14:68498356-68498378 GTCTGCCCCTTGCTTAGCTATGG - Intronic
1118741981 14:68746339-68746361 AGGTGCACCTTGGAGAGCCAGGG + Intergenic
1119862428 14:77946083-77946105 GTGTAGTCCTTGGAGAGCAAGGG + Intergenic
1122414310 14:101541547-101541569 GTGGGCTCTTCGGAGAGCTAGGG - Intergenic
1122416241 14:101550881-101550903 CTGTGCCCTTTGCAGAGCTGTGG - Intergenic
1123020879 14:105397413-105397435 GGCAGCCCCTTGTAGAGCTAGGG + Exonic
1126558145 15:50013301-50013323 ATGTCCCCCTAGAAGAGCTATGG - Intronic
1130821657 15:87502447-87502469 GTGTGGGTCTTGGAGAGCTTAGG + Intergenic
1130889460 15:88120898-88120920 ATGTGCCCATTGTACAGCTAAGG - Intronic
1133321796 16:4918787-4918809 GTGTGCCCCTTGGAGAGCTATGG + Intronic
1134445924 16:14331347-14331369 GTGTGCCCCCTGAAGAAGTAGGG + Intergenic
1136991237 16:35152478-35152500 CTGTCCCCCTTGGAGAGCCTAGG + Intergenic
1139593777 16:67946959-67946981 GGGAGCTTCTTGGAGAGCTATGG - Exonic
1140980589 16:80105135-80105157 GAGTGGACCTGGGAGAGCTATGG - Intergenic
1143180329 17:4980459-4980481 GTGTGTGCCTTGGGGAGCTCTGG + Exonic
1144769464 17:17751624-17751646 GTGTGCCCGCAGGAGAGCAAGGG - Intronic
1148048888 17:44759609-44759631 GTGTGGCCCCTGGAGCCCTAGGG - Intronic
1155450988 18:25962652-25962674 GTTTGTCCCTTGGATAGCTCAGG + Intergenic
1158380232 18:56921620-56921642 TTGTGGCCCTTGTAGAGCCAGGG + Intronic
1164160593 19:22623450-22623472 GTGTGGCGCCTGGAGCGCTAGGG + Intergenic
1165321519 19:35088347-35088369 GTGTGACCCTTGTAGAGGTGGGG - Intergenic
1166788719 19:45385105-45385127 GCCTGCCCCCTGGAGAGATAGGG + Intronic
926046893 2:9716583-9716605 GCGTGCACTTTGGAAAGCTAAGG + Intergenic
927465148 2:23331272-23331294 GTGGGCAGCCTGGAGAGCTAAGG - Intergenic
935082466 2:99811628-99811650 GTATGCCCCTTGCAGAGCTGAGG + Intronic
936709437 2:115115107-115115129 GTGTGCACATCGGAGACCTACGG + Intronic
947459814 2:230293924-230293946 GTGTGCTGCTTGGATAGCTCTGG + Intronic
947470059 2:230393069-230393091 GTGTGCTGCTTGGATAGCTCTGG + Intronic
948201145 2:236130557-236130579 CTGAGCCGCTTGGAGAGCTTTGG + Exonic
948371800 2:237494316-237494338 GTGTGCCCCAGGGAGAGCACAGG + Intronic
1168935210 20:1659036-1659058 ATATGCACCTTGTAGAGCTATGG + Intergenic
1169975618 20:11323944-11323966 CTGTGCTCCTTGGAGAATTAGGG - Intergenic
1170945437 20:20887443-20887465 CTGGGCCCCGTGGAGAGCTGTGG + Intergenic
1172898724 20:38318698-38318720 GTTTGGCCCTTGCAGAGCTGAGG - Intronic
1173837104 20:46133034-46133056 GTGTGCCCCATCCGGAGCTAGGG + Intergenic
1174674600 20:52341222-52341244 GTGTCCCCCATGGAGAGCACTGG - Intergenic
1178428585 21:32499377-32499399 GTGTGCCCCAAGGACAGCCAAGG + Intronic
1180124738 21:45782816-45782838 CTGGGCTCCTTGGAGAGCAATGG - Intronic
1180594266 22:16963234-16963256 TTGCGCCCCTTGGGGAGATAGGG - Intronic
1182792374 22:32963790-32963812 GCCTGCACCGTGGAGAGCTAAGG + Intronic
1183191888 22:36326839-36326861 GTCTGGCCCCTGGAGAGCCATGG - Intronic
1184822315 22:46918481-46918503 GTGTGCCCCGGGGAGAGGTATGG + Intronic
949198253 3:1339286-1339308 CTATGCTCCTTGGAGAGCTAGGG - Intronic
950440161 3:13005825-13005847 GGGTCCCCCTTGCAGAGCAAAGG + Intronic
952546169 3:34421775-34421797 GTGTGTCCCTTGGAAAACTAAGG + Intergenic
952755255 3:36859930-36859952 GTGTGGCACTTTGAGGGCTAAGG + Intronic
953481288 3:43254508-43254530 GTGTGCCACATGGTGAGCTTGGG - Intergenic
954649240 3:52150177-52150199 GTGTGCTCCTTGGAGAACTCTGG - Intronic
956482265 3:69685094-69685116 GGTTTCCCCTTGGTGAGCTATGG + Intergenic
961682343 3:128607806-128607828 GGATGCCCGTTGGAGAGCCATGG - Intergenic
961885092 3:130091783-130091805 GTGTGCCCCTGGGTAAGCTGGGG + Intronic
969109814 4:4837224-4837246 GTGTGCCCATTTCACAGCTAGGG - Intergenic
969819651 4:9710254-9710276 GTGTGCCCCTGGGTAAGCTGGGG - Intergenic
975161024 4:71124078-71124100 GTGTGTCCCTTGGGAAGGTAGGG - Intergenic
982495676 4:156088917-156088939 GTGTGTCACCTGGAGAGCAAAGG - Intergenic
984875340 4:184362926-184362948 GTCTTCTACTTGGAGAGCTAAGG + Intergenic
986172776 5:5327288-5327310 GTGTGCCCTGTGCAGAGCTTGGG - Intergenic
986769475 5:10958585-10958607 GTATCCACCTTGGAGAGCTTTGG + Intergenic
989022106 5:37020043-37020065 GTGTGTTTCTTGGAGAACTAAGG + Intronic
990613568 5:57484212-57484234 GTGAGCCTCTTGGAGAGTCATGG + Intergenic
992035935 5:72776049-72776071 TTGTGACCCTTGCAGTGCTATGG - Intergenic
996415839 5:123209226-123209248 TTGTGGCCCTTGCAGAGCCAAGG + Intergenic
999326595 5:150648090-150648112 GAGTTCACCTTGGAGAGCCACGG + Exonic
1001228419 5:169965060-169965082 GTGTGCCACTTGCTGTGCTAGGG + Intronic
1003425460 6:5995700-5995722 GTGGGCCACTTGAAGAGCCACGG + Intergenic
1007781478 6:44257221-44257243 TTGTGCTCCTTGGGGAGCTTCGG - Intronic
1007914073 6:45544566-45544588 GTGTGCCCCCTGCAGAAGTATGG - Intronic
1012749441 6:103139717-103139739 GTGTTCCCCTTGGCCAGATATGG - Intergenic
1012989548 6:105911296-105911318 GTGTGCCTCTAGGAGAGCTGGGG - Intergenic
1013659749 6:112283071-112283093 GTGTGCCAAGTGGATAGCTATGG - Intergenic
1014366340 6:120547283-120547305 TTGTGCCCTATGGACAGCTATGG + Intergenic
1015493205 6:133852519-133852541 GTGTGCTCCTGGGAAGGCTAAGG + Intergenic
1015511463 6:134041921-134041943 GTGTGAGCCTTGGTGAGCCATGG + Intronic
1020318565 7:6924347-6924369 GTGTGCCCCTGGGTAAGCTGCGG + Intergenic
1022147155 7:27555944-27555966 GTATGCCCCTTGAAGAGAAAGGG - Intronic
1033024355 7:137758228-137758250 ATGAGCCCCTGGGTGAGCTATGG + Intronic
1034556429 7:151853087-151853109 CTGTGTCCCTCGGAGAGCTCGGG + Intronic
1036215778 8:6878517-6878539 GTGTGGCCCTTGGAGGGTGAGGG + Intergenic
1036381854 8:8240845-8240867 GTGTGCCCCTGGGTAAGCTGGGG - Intergenic
1038438861 8:27558070-27558092 CTGGGCCCCTTGCAGAGCTTTGG + Intergenic
1040577693 8:48668137-48668159 AGGTGGCCCTTGGATAGCTAAGG + Intergenic
1040958291 8:53003334-53003356 AATTGCCCCTTGCAGAGCTAGGG - Intergenic
1042722496 8:71841540-71841562 GTGTGCCCCTTGGAGGTGTCAGG - Exonic
1048964285 8:139604130-139604152 GTCTGCGCCCTGGAGAGCCAGGG - Intronic
1049689530 8:143952632-143952654 GTGGGGCCCTTGGAGATCTGGGG - Intronic
1050248025 9:3712773-3712795 GTGTTCCAGTTGGGGAGCTAAGG - Intergenic
1055378850 9:75684162-75684184 TGGAGCCCATTGGAGAGCTAAGG + Intergenic
1057878196 9:98773628-98773650 CTGTGCTCCTTGGAGATCTAGGG + Intronic
1059769283 9:117412304-117412326 CTCTGCCCCTTGGAGAGCACGGG - Intronic
1060502632 9:124173602-124173624 GTGAGCCCCTTGGGGGGTTACGG - Intergenic
1190311000 X:49117003-49117025 GTGAGCCTCTTGTAGAGCTAGGG - Intronic
1192543998 X:71997555-71997577 TTCTGCCTCCTGGAGAGCTATGG - Intergenic
1192916044 X:75652262-75652284 GTTTGCCCCTTACAGCGCTAAGG - Intergenic
1197703132 X:129614938-129614960 GTTTGCCCCTTTGAGAGTTTTGG - Intergenic
1197775459 X:130115933-130115955 GTGTGCCACTTGGATACCCATGG - Intergenic
1198311301 X:135427203-135427225 CAGTGCCCCTTGGAGAGGCAGGG + Intergenic