ID: 1133322590

View in Genome Browser
Species Human (GRCh38)
Location 16:4923480-4923502
Sequence CCTTCCAGGTCGCTGATGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 138}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133322590_1133322599 -8 Left 1133322590 16:4923480-4923502 CCAGCCATCAGCGACCTGGAAGG 0: 1
1: 0
2: 0
3: 7
4: 138
Right 1133322599 16:4923495-4923517 CTGGAAGGGGGCTCCCTGGGTGG 0: 1
1: 0
2: 2
3: 40
4: 421
1133322590_1133322601 -6 Left 1133322590 16:4923480-4923502 CCAGCCATCAGCGACCTGGAAGG 0: 1
1: 0
2: 0
3: 7
4: 138
Right 1133322601 16:4923497-4923519 GGAAGGGGGCTCCCTGGGTGGGG 0: 1
1: 0
2: 3
3: 44
4: 510
1133322590_1133322603 -2 Left 1133322590 16:4923480-4923502 CCAGCCATCAGCGACCTGGAAGG 0: 1
1: 0
2: 0
3: 7
4: 138
Right 1133322603 16:4923501-4923523 GGGGGCTCCCTGGGTGGGGGTGG 0: 1
1: 0
2: 12
3: 101
4: 1101
1133322590_1133322600 -7 Left 1133322590 16:4923480-4923502 CCAGCCATCAGCGACCTGGAAGG 0: 1
1: 0
2: 0
3: 7
4: 138
Right 1133322600 16:4923496-4923518 TGGAAGGGGGCTCCCTGGGTGGG 0: 1
1: 0
2: 1
3: 38
4: 343
1133322590_1133322602 -5 Left 1133322590 16:4923480-4923502 CCAGCCATCAGCGACCTGGAAGG 0: 1
1: 0
2: 0
3: 7
4: 138
Right 1133322602 16:4923498-4923520 GAAGGGGGCTCCCTGGGTGGGGG 0: 1
1: 1
2: 2
3: 52
4: 398

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133322590 Original CRISPR CCTTCCAGGTCGCTGATGGC TGG (reversed) Intronic
901044160 1:6385593-6385615 TCTTCCAGGAGGCTGGTGGCTGG - Exonic
901744949 1:11366155-11366177 CTTCCCAGGATGCTGATGGCAGG + Intergenic
903146451 1:21375914-21375936 GCTTCCAGGTCTGTGATGGGAGG - Intergenic
903283366 1:22262785-22262807 CCCTCCAGGTGGCTGATACCAGG - Intergenic
907424399 1:54370168-54370190 CCTTCCTGGAAGCTGGTGGCTGG + Intronic
912713947 1:111968768-111968790 GCTTCCAGCTCTCTGCTGGCTGG + Intronic
914805033 1:150985419-150985441 CCTTTCATGTCCCTGATGGCTGG + Intronic
916579511 1:166095149-166095171 CCTTCCAAGCCTCTGAGGGCAGG - Intronic
916650496 1:166830577-166830599 GCTTCCAGGTCTATGATGGGAGG - Intergenic
916910498 1:169341111-169341133 CCTTCCAGGTCTGTGATAGGAGG - Intronic
917486659 1:175461117-175461139 CCTTCCTGGTCCCAGATGGATGG + Intronic
922241136 1:223756111-223756133 CCCCCCAGGGCTCTGATGGCTGG + Intronic
922363975 1:224846577-224846599 AATTCCAGGTCACTGATGGAAGG + Intergenic
922748728 1:228060933-228060955 CCTTCCTGGCCCCTCATGGCGGG + Exonic
922817710 1:228462611-228462633 CCATCCATGTTGCTGATGACGGG - Intergenic
1069925345 10:71846608-71846630 CCTCCCAGGTAGCTGATAGCTGG - Intronic
1072769420 10:98125114-98125136 ACTTCCAGGCCTGTGATGGCAGG + Intergenic
1073117042 10:101097154-101097176 ACTTCCAGGGCGGTGGTGGCAGG - Intronic
1076353419 10:129834175-129834197 CCTTCCAAGTGGCTGGAGGCTGG - Intergenic
1077343063 11:2034611-2034633 GCTTCCAGCTCCCTGATGACGGG + Intergenic
1077533446 11:3107931-3107953 CCCCGCAGGTCGCTGCTGGCTGG - Exonic
1078985114 11:16586429-16586451 CCTTGAAGGTCACTGATGGTTGG - Intronic
1083253330 11:61482144-61482166 CCTTTCAGGACTGTGATGGCAGG - Intronic
1085086617 11:73672072-73672094 CCTCCTAGGTCTCTGATGGGAGG + Intergenic
1087891582 11:103542982-103543004 CCTTCCAGGCCCCTGACTGCCGG - Intergenic
1202826049 11_KI270721v1_random:89800-89822 GCTTCCAGCTCCCTGATGACGGG + Intergenic
1092821429 12:12357072-12357094 CCTTCCGGGACGCAGATGGGCGG - Intronic
1093230599 12:16537842-16537864 CCTTCCCGGTCTGTGATGGGAGG + Intronic
1094777305 12:33745643-33745665 GCCTCCAGGTCTGTGATGGCAGG - Intergenic
1098391734 12:69977083-69977105 CATGCCAGTTCTCTGATGGCTGG - Intergenic
1102498403 12:113335050-113335072 CCTTCCAGGTCCCTGGCCGCCGG + Intronic
1104471691 12:129034664-129034686 CCTTCCAGCTCTCAGATGCCTGG + Intergenic
1105852991 13:24352032-24352054 CTTTCCAGTTTGCTCATGGCAGG + Intergenic
1110902288 13:80837846-80837868 GCTTCCAGGTCTGTGATGGGAGG + Intergenic
1112792178 13:103015353-103015375 CCTTGCAGGTGGCAGATGGTGGG - Intergenic
1114904077 14:27102814-27102836 TCTTCCAGTCAGCTGATGGCAGG - Intergenic
1115143022 14:30196022-30196044 GCTTCCAGGTCACAGAGGGCTGG - Intergenic
1115751956 14:36502891-36502913 CCTTCCAAGCCTCAGATGGCTGG + Intronic
1119208088 14:72809586-72809608 CCCTGCATGTGGCTGATGGCAGG + Intronic
1119903659 14:78282564-78282586 CCTGCCAGGGCTCTGATGGATGG - Intronic
1120262195 14:82199796-82199818 CCTGAAAGGTGGCTGATGGCTGG + Intergenic
1121405518 14:93717235-93717257 CCCTCCATGTCCCTGATGCCTGG + Intergenic
1129657962 15:77537185-77537207 CCTTCCAGAAAGCTGAGGGCAGG - Intergenic
1132655023 16:1038208-1038230 CCTTCCAGGGAGCAGAGGGCTGG - Intergenic
1133319207 16:4902603-4902625 CCTTCCAGGACACTGAGGCCGGG - Intronic
1133322590 16:4923480-4923502 CCTTCCAGGTCGCTGATGGCTGG - Intronic
1134058993 16:11187831-11187853 CCTTTCAGGCCTCTGATGTCAGG - Intergenic
1136295769 16:29301317-29301339 CCTTCCGGGGCATTGATGGCGGG + Intergenic
1137265901 16:46868681-46868703 CCTTCCAGGCCTGTGATGGAAGG + Intergenic
1138346713 16:56324672-56324694 CTTTCCAGGTCACTGCTGCCAGG + Intronic
1140033166 16:71354423-71354445 CCCACCAGTTCTCTGATGGCTGG - Intergenic
1142101687 16:88275504-88275526 CCTTCCGGGGCGTTGATGGCGGG + Intergenic
1142903874 17:3029671-3029693 CCTTCCTGGAAGCTGCTGGCTGG - Intronic
1143041765 17:4043457-4043479 CCTTCCTGCTCTGTGATGGCGGG - Intronic
1143977089 17:10837889-10837911 CCTTCCATCTCGCTGAAGGAAGG - Intronic
1145394751 17:22486388-22486410 CCTTCCAGGTCTCTGCTGTGGGG - Intergenic
1147562478 17:41517595-41517617 CCCTCCAGGTTGCTACTGGCTGG - Intronic
1147614530 17:41820363-41820385 CATTGCAGGTCTCAGATGGCCGG - Exonic
1148643092 17:49202819-49202841 CCATCCAGTTCTCTGGTGGCAGG + Intronic
1149544934 17:57496416-57496438 CCTTCCAGGAGGCTGATGAACGG + Intronic
1149733439 17:58969681-58969703 CCTTCCGGGTCACTGATGAGCGG + Exonic
1150463438 17:65371914-65371936 CCTCCCAGCTCCCTGATGCCAGG + Intergenic
1152355087 17:79803035-79803057 CCTTCCAGGTTGCGGTTGTCCGG - Intergenic
1154157674 18:11956601-11956623 CCTGGCAGGTCTCTGAGGGCTGG - Intergenic
1160766050 19:808542-808564 CCGTTCAGGTGGCTCATGGCTGG - Exonic
1163233997 19:16020601-16020623 ACTTCCAGGGCACTGATGGGTGG - Intergenic
1164735995 19:30541180-30541202 CCATCCAGGTGCCTTATGGCTGG + Intronic
1168646653 19:58063346-58063368 TCTTCCAGGTCCCAGATGGCTGG - Intronic
1168705329 19:58467370-58467392 CGTTCCACGTCCATGATGGCCGG + Exonic
927813629 2:26194860-26194882 CCTTCAAGGTCTGGGATGGCTGG + Intronic
928773757 2:34733595-34733617 CCTTCCAGTTAGCTTATGCCTGG + Intergenic
930585646 2:53263916-53263938 ACTTCCAGGTCTGTGATGGGAGG + Intergenic
936357281 2:111762372-111762394 CCTCCCAGGTCTCAGTTGGCCGG - Intergenic
937404872 2:121617744-121617766 CCTTCCAGATCTCTGTTGGTGGG + Intronic
938074294 2:128323503-128323525 CCTTCCTGGAGGATGATGGCCGG + Intergenic
938568638 2:132542532-132542554 CCTTCCAGGTCTATGATAGGAGG - Intronic
938825664 2:135003123-135003145 TCTTCCTGGTTGCAGATGGCTGG - Intronic
941335725 2:164241054-164241076 GCTTCCAGGTCTGTGATGGGAGG + Intergenic
942950037 2:181712033-181712055 GCTTCCAGGTCTGTGATGGGTGG - Intergenic
943470856 2:188292276-188292298 CCTTCCCGGGCACTGGTGGCCGG - Intronic
944935330 2:204561516-204561538 CCTGCCAGGTCACTGTGGGCTGG + Intronic
945644855 2:212478619-212478641 AGTTCCAGGTCCCTGATGCCAGG + Intronic
946725334 2:222656359-222656381 GCTTCCAGGGCGCTAACGGCCGG + Intergenic
948456982 2:238109122-238109144 CCTGACAGGTGGCTGGTGGCAGG + Intronic
1169194803 20:3677348-3677370 CCTTCCAAGTGGCTGTTGTCAGG - Intronic
1169937923 20:10904732-10904754 CCTGCCAGGTCAGTGAAGGCTGG + Intergenic
1170643920 20:18179630-18179652 GCTTCCAGGTCTGTGATGGGAGG + Intronic
1171359386 20:24576502-24576524 CCTTCCAGGTATGTGATGCCAGG - Intronic
1174044595 20:47724510-47724532 CCTTCTAGGGAGCGGATGGCTGG - Intronic
1176511201 21:7749644-7749666 TCTTCCAGGCTGCTGACGGCTGG - Intronic
1178645315 21:34380173-34380195 TCTTCCAGGCTGCTGACGGCTGG - Intronic
1179186750 21:39090671-39090693 CCTCCCAGGTTGCTGATGGAAGG - Intergenic
1179492235 21:41748141-41748163 CCTGCCAGGCCTCTGCTGGCCGG - Intronic
1181458240 22:23071305-23071327 CCTTCCTGGGTGATGATGGCAGG + Intronic
1184144723 22:42602866-42602888 CCCGCCAGGTTGCTGATGCCCGG - Exonic
1184640873 22:45869320-45869342 CCATCCAGGGCGCTGAGGTCAGG - Intergenic
1184857809 22:47156086-47156108 CCTCCCAGATGGCTGAAGGCAGG + Intronic
950477218 3:13221796-13221818 CTTTCCAGATCGCTGACTGCAGG - Intergenic
951058274 3:18173276-18173298 GCTTCCAGGTCTGTGATGGGAGG + Intronic
953413727 3:42703774-42703796 CCTTCCTGGGCCCTGATGGGTGG - Intronic
954321230 3:49833263-49833285 CCCTCCAGGTGGCTCAAGGCAGG + Intronic
956004141 3:64761026-64761048 CCTTCCAGCTCCCAGATTGCTGG - Intergenic
957922614 3:86765315-86765337 CCTTTCAGGCCGCTGGTGGAAGG + Intergenic
958038018 3:88192573-88192595 GCTTCCAGGTTGCAGATGGCAGG - Intergenic
961457765 3:127032711-127032733 ATGTCCTGGTCGCTGATGGCTGG - Exonic
961461082 3:127050815-127050837 CCATGGAGGTCGATGATGGCTGG + Intergenic
964767069 3:160189574-160189596 ACTTCCATGTCTCTGATGCCTGG - Intergenic
967074330 3:185988661-185988683 ATTTTCAGGTCCCTGATGGCAGG - Intergenic
967609103 3:191483036-191483058 GCTTCCAGGTCTGTGATGGGAGG - Intergenic
968590500 4:1456639-1456661 CCTTCCAGGCCTGTGATGGGAGG + Intergenic
968665898 4:1822210-1822232 CCTTCAAGGTCTCTGACTGCAGG + Exonic
970461233 4:16276964-16276986 GCTTCCAGGCCTGTGATGGCAGG - Intergenic
970673465 4:18421705-18421727 GCCTCCAGGTGGCTGAGGGCAGG - Intergenic
972307250 4:37843444-37843466 ACTTCCAGTGCTCTGATGGCTGG - Intronic
981279119 4:142936623-142936645 ACTTCCAAGTGGCTGCTGGCTGG - Intergenic
984816773 4:183845458-183845480 TCTTCCAGGTCTTTGATGCCAGG + Intergenic
985877559 5:2611786-2611808 ACTTGCAGGTCCCTGATGCCGGG - Intergenic
986466582 5:8032361-8032383 CCTGCCAAGTCTCTGCTGGCTGG + Intergenic
992198816 5:74364566-74364588 CCATCCAAGGCCCTGATGGCAGG + Intergenic
997197602 5:131990226-131990248 CCATCCAGGTTTCTGATGGGCGG - Intronic
999768163 5:154756016-154756038 TCCTCCCCGTCGCTGATGGCCGG - Intronic
1002093130 5:176816431-176816453 CCTTCCTGGGCACTGATGTCAGG + Intronic
1005883258 6:30075633-30075655 CCTTCGAGCGCGCAGATGGCGGG + Exonic
1007604930 6:43110877-43110899 CTTTCCAGGCCTCTGTTGGCGGG + Intronic
1013564846 6:111347912-111347934 CCTTCCAAGTAGCTGTTGCCTGG + Intronic
1013759311 6:113498361-113498383 TCTTCCAGGTAGTTGCTGGCAGG + Intergenic
1015677140 6:135762593-135762615 GCTTCCAGGTCTGTGATGGGAGG + Intergenic
1019915162 7:4128467-4128489 CCTTCCAGGTCCCCGATCTCAGG + Intronic
1020098160 7:5379915-5379937 CCTTGGGGGTGGCTGATGGCCGG - Intronic
1024553732 7:50584999-50585021 CCCTCCAGGTGGCTGATGAGCGG + Intergenic
1025144376 7:56491980-56492002 CCATCCACATCGCTGAGGGCAGG - Intergenic
1026883274 7:73920736-73920758 CCTTCCAGGGCCCTCATGTCTGG - Intergenic
1035663802 8:1365502-1365524 CCTCCCAGGTCCAGGATGGCAGG + Intergenic
1036518440 8:9468092-9468114 ACTTCCAGGTCTGTGATGGGAGG - Intergenic
1045015686 8:97999824-97999846 CCTCCCAGGTGACTGGTGGCTGG - Intronic
1047564895 8:126033486-126033508 TCTTCCAAGTCTTTGATGGCGGG + Intergenic
1055127821 9:72739167-72739189 TCTCCCAGGTTGCAGATGGCTGG + Intronic
1056752564 9:89363037-89363059 CCCTCCAGGTAGCTCCTGGCTGG - Intronic
1057899706 9:98938951-98938973 ACTTCCAGGTTGCTCATTGCAGG + Intergenic
1060673161 9:125488485-125488507 CCTCCCAGGTAGCTGACGCCTGG + Intronic
1060730569 9:126034251-126034273 CCTGGCAGGAAGCTGATGGCAGG + Intergenic
1190974495 X:55386414-55386436 GCTTCCAGGTCTCTGATGGAAGG - Intergenic
1196522157 X:116686939-116686961 GCTTCCAGGTCTGTGATGGGAGG - Intergenic
1196846362 X:119899579-119899601 CCTGCGAGTTGGCTGATGGCTGG - Intronic
1199370446 X:147042104-147042126 GCTTCCAGGTCTGTGATGGGAGG - Intergenic
1199560710 X:149159730-149159752 GCTTCCAGGTCTGTGATGGGAGG + Intergenic