ID: 1133324254

View in Genome Browser
Species Human (GRCh38)
Location 16:4933924-4933946
Sequence TGTGAATGATAAGCGGCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 36}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133324254_1133324262 29 Left 1133324254 16:4933924-4933946 CCTGCGGCCGCTTATCATTCACA 0: 1
1: 0
2: 0
3: 4
4: 36
Right 1133324262 16:4933976-4933998 CTGAGCCAACATCGCCAGGCAGG 0: 1
1: 0
2: 0
3: 9
4: 189
1133324254_1133324260 25 Left 1133324254 16:4933924-4933946 CCTGCGGCCGCTTATCATTCACA 0: 1
1: 0
2: 0
3: 4
4: 36
Right 1133324260 16:4933972-4933994 AATCCTGAGCCAACATCGCCAGG 0: 1
1: 0
2: 0
3: 1
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133324254 Original CRISPR TGTGAATGATAAGCGGCCGC AGG (reversed) Intronic
902079434 1:13811271-13811293 TGTGAAGGTTAAGGGGCCTCTGG + Intronic
904878797 1:33678530-33678552 TGTGAATGAACAGCTGCTGCAGG + Intronic
1067534159 10:47095689-47095711 TGGGAAGGATAACCGGCAGCTGG + Intergenic
1070648612 10:78219159-78219181 TGTGCATGTTAAGCAGCAGCCGG + Intergenic
1078054300 11:7994727-7994749 TGTGAATGGTATGTGGCCTCTGG - Intronic
1095557151 12:43521569-43521591 TTTGAATGATAAGAGGCCGAAGG - Intronic
1122506319 14:102234081-102234103 TCTGACTGTTAAGCGGCCGGTGG + Intronic
1122873409 14:104651636-104651658 TGTCAGTGAGAAGTGGCCGCAGG + Intergenic
1125727059 15:41873554-41873576 GGTGGAGGAGAAGCGGCCGCTGG - Exonic
1126879513 15:53079371-53079393 TGTGATTGATAAACGCCTGCTGG + Intergenic
1132054727 15:98641732-98641754 TGTGACTGATGAGCTGCCGAAGG - Intergenic
1133324254 16:4933924-4933946 TGTGAATGATAAGCGGCCGCAGG - Intronic
1138184171 16:54963630-54963652 TGTGAGTGACAAGCAGCCGCAGG - Intergenic
1139717269 16:68823518-68823540 TGTGACTGTGAAGGGGCCGCTGG + Exonic
1147703030 17:42407784-42407806 AGTGAATGATAAGAGGCAGAGGG - Intronic
1164992007 19:32691691-32691713 TGTGAATGACAAACGGTCGCTGG + Intergenic
1168426763 19:56245341-56245363 TGTGAATGAGATGCGTCCGGGGG + Exonic
927981947 2:27380053-27380075 GGTTAAGGATTAGCGGCCGCTGG - Intronic
935040645 2:99423412-99423434 TGTGAATGGAAAGCAGCCACGGG - Intronic
941728715 2:168892038-168892060 TGTGAATGATAATGGGTCGGGGG - Intronic
948438097 2:237967304-237967326 CGTGAATGGGAAGGGGCCGCGGG + Intronic
1174720262 20:52804036-52804058 TGAGAATGAGAAGCAGCAGCCGG + Intergenic
949691445 3:6644495-6644517 TTTGAATGATAGGCTGCTGCAGG + Intergenic
952143236 3:30502460-30502482 TGTGAAGGAGAAGAGGCTGCTGG - Intergenic
952199754 3:31114015-31114037 TCTGAGTGATAAGCTGCCTCTGG - Intergenic
965823865 3:172711063-172711085 CGTGAATGAGCAGCTGCCGCGGG - Exonic
966241144 3:177756624-177756646 TGTGAATGCTGAGGGGCTGCAGG - Intergenic
985234016 4:187852834-187852856 TGTGAATGCCAAGCGGCCAAAGG - Intergenic
1003354978 6:5359800-5359822 TGTGAATGGTAAGGGGCTGCTGG + Intronic
1004165435 6:13252691-13252713 TGTGAAAGAGTATCGGCCGCAGG + Intronic
1007310046 6:40938161-40938183 TGGGAAGGATAAGCGGGCACTGG - Intergenic
1007415938 6:41691237-41691259 TGTGGATGAGAAGGGGCAGCAGG + Intronic
1015296041 6:131594210-131594232 TCTGAAGGATAATCGACCGCAGG - Exonic
1019533101 7:1513410-1513432 TCTGAATGACAAGTGGCCACAGG + Intergenic
1024971473 7:55075296-55075318 AGTGAATGAAAAGTGGCCACCGG - Intronic
1033992940 7:147310336-147310358 TGTCAATGGTAAATGGCCGCAGG - Intronic
1034255162 7:149720780-149720802 TGTGAGTGCTGAGCAGCCGCAGG + Intronic
1034985428 7:155510177-155510199 TGTGAATGTAGCGCGGCCGCTGG - Intronic
1043401823 8:79891837-79891859 TGTGAAAGAGCAGCGGCTGCCGG - Intergenic
1059417028 9:114168603-114168625 TGTGATGGTTGAGCGGCCGCAGG - Exonic
1186188297 X:7043123-7043145 TGTGAATGATCACCTGCCCCAGG - Intergenic