ID: 1133324255 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:4933931-4933953 |
| Sequence | GAAAGGTTGTGAATGATAAG CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 241 | |||
| Summary | {0: 1, 1: 0, 2: 2, 3: 11, 4: 227} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1133324255_1133324260 | 18 | Left | 1133324255 | 16:4933931-4933953 | CCGCTTATCATTCACAACCTTTC | 0: 1 1: 0 2: 2 3: 11 4: 227 |
||
| Right | 1133324260 | 16:4933972-4933994 | AATCCTGAGCCAACATCGCCAGG | 0: 1 1: 0 2: 0 3: 1 4: 65 |
||||
| 1133324255_1133324262 | 22 | Left | 1133324255 | 16:4933931-4933953 | CCGCTTATCATTCACAACCTTTC | 0: 1 1: 0 2: 2 3: 11 4: 227 |
||
| Right | 1133324262 | 16:4933976-4933998 | CTGAGCCAACATCGCCAGGCAGG | 0: 1 1: 0 2: 0 3: 9 4: 189 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1133324255 | Original CRISPR | GAAAGGTTGTGAATGATAAG CGG (reversed) | Intronic | ||