ID: 1133324256

View in Genome Browser
Species Human (GRCh38)
Location 16:4933948-4933970
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 712
Summary {0: 1, 1: 0, 2: 5, 3: 73, 4: 633}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133324256_1133324260 1 Left 1133324256 16:4933948-4933970 CCTTTCCCCTGCATTATTTCATT 0: 1
1: 0
2: 5
3: 73
4: 633
Right 1133324260 16:4933972-4933994 AATCCTGAGCCAACATCGCCAGG 0: 1
1: 0
2: 0
3: 1
4: 65
1133324256_1133324262 5 Left 1133324256 16:4933948-4933970 CCTTTCCCCTGCATTATTTCATT 0: 1
1: 0
2: 5
3: 73
4: 633
Right 1133324262 16:4933976-4933998 CTGAGCCAACATCGCCAGGCAGG 0: 1
1: 0
2: 0
3: 9
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133324256 Original CRISPR AATGAAATAATGCAGGGGAA AGG (reversed) Intronic