ID: 1133324256 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:4933948-4933970 |
Sequence | AATGAAATAATGCAGGGGAA AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 712 | |||
Summary | {0: 1, 1: 0, 2: 5, 3: 73, 4: 633} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1133324256_1133324260 | 1 | Left | 1133324256 | 16:4933948-4933970 | CCTTTCCCCTGCATTATTTCATT | 0: 1 1: 0 2: 5 3: 73 4: 633 |
||
Right | 1133324260 | 16:4933972-4933994 | AATCCTGAGCCAACATCGCCAGG | 0: 1 1: 0 2: 0 3: 1 4: 65 |
||||
1133324256_1133324262 | 5 | Left | 1133324256 | 16:4933948-4933970 | CCTTTCCCCTGCATTATTTCATT | 0: 1 1: 0 2: 5 3: 73 4: 633 |
||
Right | 1133324262 | 16:4933976-4933998 | CTGAGCCAACATCGCCAGGCAGG | 0: 1 1: 0 2: 0 3: 9 4: 189 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1133324256 | Original CRISPR | AATGAAATAATGCAGGGGAA AGG (reversed) | Intronic | ||