ID: 1133324257

View in Genome Browser
Species Human (GRCh38)
Location 16:4933953-4933975
Sequence GATTAAATGAAATAATGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 817
Summary {0: 1, 1: 1, 2: 10, 3: 115, 4: 690}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133324257_1133324266 26 Left 1133324257 16:4933953-4933975 CCCCTGCATTATTTCATTTAATC 0: 1
1: 1
2: 10
3: 115
4: 690
Right 1133324266 16:4934002-4934024 CGTGCTTATTCCCATCCCACAGG 0: 1
1: 0
2: 0
3: 2
4: 66
1133324257_1133324262 0 Left 1133324257 16:4933953-4933975 CCCCTGCATTATTTCATTTAATC 0: 1
1: 1
2: 10
3: 115
4: 690
Right 1133324262 16:4933976-4933998 CTGAGCCAACATCGCCAGGCAGG 0: 1
1: 0
2: 0
3: 9
4: 189
1133324257_1133324260 -4 Left 1133324257 16:4933953-4933975 CCCCTGCATTATTTCATTTAATC 0: 1
1: 1
2: 10
3: 115
4: 690
Right 1133324260 16:4933972-4933994 AATCCTGAGCCAACATCGCCAGG 0: 1
1: 0
2: 0
3: 1
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133324257 Original CRISPR GATTAAATGAAATAATGCAG GGG (reversed) Intronic