ID: 1133324258

View in Genome Browser
Species Human (GRCh38)
Location 16:4933954-4933976
Sequence GGATTAAATGAAATAATGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1536
Summary {0: 4, 1: 9, 2: 104, 3: 337, 4: 1082}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133324258_1133324266 25 Left 1133324258 16:4933954-4933976 CCCTGCATTATTTCATTTAATCC 0: 4
1: 9
2: 104
3: 337
4: 1082
Right 1133324266 16:4934002-4934024 CGTGCTTATTCCCATCCCACAGG 0: 1
1: 0
2: 0
3: 2
4: 66
1133324258_1133324262 -1 Left 1133324258 16:4933954-4933976 CCCTGCATTATTTCATTTAATCC 0: 4
1: 9
2: 104
3: 337
4: 1082
Right 1133324262 16:4933976-4933998 CTGAGCCAACATCGCCAGGCAGG 0: 1
1: 0
2: 0
3: 9
4: 189
1133324258_1133324260 -5 Left 1133324258 16:4933954-4933976 CCCTGCATTATTTCATTTAATCC 0: 4
1: 9
2: 104
3: 337
4: 1082
Right 1133324260 16:4933972-4933994 AATCCTGAGCCAACATCGCCAGG 0: 1
1: 0
2: 0
3: 1
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133324258 Original CRISPR GGATTAAATGAAATAATGCA GGG (reversed) Intronic